k t
‘i i ‘
% \ :
*
oe
j ' bs
i ‘
é {
yet
x y
ALBERT R. MANN LIBRARY
AT
CORNELL UNIVERSITY
—_— oo
CORNELL UNIVERSITY LIBRARY
- Ti
DATE DUE
=
ce)
D
i=)
on
i MYCOTAXO:
AN INTERNATIONAL JOURNAL FOR RESEARCH ON
TAXONOMY & NOMENCLATURE OF FUNGI, INCLUDING LICHENS
Volume LXXIX Juty-September 2001
CONTENTS
Macowanites vinaceodorus sp. nov. (Russulales) a new gasteroid fungus from coastal
Dunes of Spain Francisco D. Calonge & Josep Maria Vidal I
Phylogenetic relationships of Panellus (Agaricales) and related species based
on morphology and ribosomal large subunit DNA sequences
Jiankang Jin, Karen W. Hughes, & Ronald H. Petersen ¥!
Typification of Hypogymnia hypotrypa and H. sinica
Bruce McCune & Walter Obermayer 23
Caloplaca nashii sp. nov. (Teloschistaceae, Lichenes), a North American species
of the C. lactea-group growing in caliche
P. Navarro-Rosinés, E. Gaya, & N. L. Hladun 29
Aspidothelium gemmiferum sp. nov. from Papua New Guinea (lichenized Ascomycetes)
Emmanueél Sérusiaux & Robert Liicking 43
Pulvinella, anew genus with prosenchymatous propagules Annette W. Ramaley 51
A new Antrodia species (Coriolaceae, Basidiomycetes)
Annarosa Bernicchia & Leif Ryvarden 57
Muscodor albus anam. gen. et sp. nov., an endophyte from Cinnamomum zeylanicum
Jeerapun Worapong, Gary Strobel, Eugene J. Ford, J. Y. Li, Gary Baird,
& W.M. Hess 67
Histeridomyces tishechkinii sp. nov., a new species of Laboulbeniales (Ascomycetes)
from New Zealand Alex Weir 81
Perenosclerospora eriochloae sp. nov. and other downy mildews on native grasses
in Queensland, Australia M. J. Ryley & R.F.N. Langdon 87
Rhizopogon buenoi (Boletales, Basidiomycota) a new species from Spain
Maria P. Martin & Francisco D. Calonge - 101
Hymenochaetoid fungi (Basidiomycota) of North America Erast Parmasto 107
Scutellinia sinensis in Europe Stanislav Glejdura 177
Two new species of Brevicellicium and a survey of tropical and subtropical species
in the genus (Basidiomycotina, Aphyllophorales) Kurt Hjorstam 181
Corticioid species (Basidiomycotina, Aphyllophorales) from Colombia III
Kurt Hjorstam & Leif Ryvarden 189
Hyphomycetes from leaf litter of Miconia cabussu in a Brazilian Atlantic rain forest
Luis Fernando Pascholati Gusmao, Rosely Ana Piccolo Grandi,
& Adauto Ivo Milanez 201
ISSN 0093-4666 MYXNAE 79:1-530 (2001)
For subscription details, availability in microform, and
availability of articles as photocopies or tear sheets, see back cover.
[Contents continued from front cover]
A neglected calicioid lichen new to Taiwan
I-Chen Hsueh , Clifford M. Wetmore, & Ming-Jou Lai 215
Type specimen studies in New World Lentinula Juan L. Mata & Ronald H. Petersen 217
Doassansiopsis euryalis sp. nov. (Ustilaginomycetes) Kalman Vanky 231
Phylogenetic relationships of Asterodon and Asterostroma (Basidiomycetes), two genera
with asterosetae Tobias Wagner 235
A new species of Myelochroa and new records in the lichen family Parmeliaceae
(Ascomycotina) from Sikkim, India
P. K. Divakar, D. K. Upreti, G. P. Sinha, & John A. Elix 247
A new species and new records in the lichen family Parmeliaceae (Ascomycotina)
from the Philippines John A. Elix & Felix Schumm 253
Ustilago deyeuxicola sp. nov. from China Kalman Vanky & Lin Guo 261
Hyaloseta nolinae, its anamorph Monocillium nolinae, and Niesslia agavacearum,
new members of the Niessliaceae, Hypocreales, from leaves of Agavaceae
Annette W. Ramaley 267
Three noteworthy Amanitae of subgenus Lepidella from China
Zuo-Hong Chen, Zhu-Liang Yang, & Zhi-Guang Zhang 275
Studies in Neotropical polypores 13. Ceriporiopsis cystidiata sp. nov.
Clarice Loguercio-Leite, Gustavo Vernet de Costa Goncalves, & Leif Ryvarden 285
New species of Amanita from the Dominican Republic, Greater Antilles
Orson K. Miller, Jr. & D. Jean Lodge 289
Notes on discomycetes in Dongling Mountains (Beijing) Zheng Wang & Ke-quan Pei 307
Galiella celebica from India D.C. Pant 315
The lichen genus Topeliopsis in Australia and remarks on Australian Thelotremataceae
Klaus Kalb 319
Discomycetes of the Sarcoscyphaceae in Taiwan Yei-Zeng Wang 329
Some species of Xylaria (Hymenoascomycetes, Xylariaceae) associated with oaks
in Mexico Felipe San Martin, Pablo Lavin, & Jack D. Rogers 337
Notes on Hyphomycetes. LXXXIV. Pseudotrichoconis and Rhexodenticula, two new
monotypic genera with rhexolytically disarticulating conidial separating cells
William A. Baker, E. Christopher Partridge, & Gareth Morgan-Jones 361
A list of discomycetes in China. Supplement I Wen-Ying Zhuang 375
Physiological and morphological variations in Oidodendron maius
Adrianne V. Rice & Randolph S. Currah 383
Wenyingia, anew genus in the Pezizales (Otideaceae) Zheng Wang & Donald H. Pfister 397
Compiléments a l'inventaire des Basidiomycétes de Gréce
Zacharias Athanassiou & Ioanna Theochari 401
An index to Batsch's Elenchus Fungorum, 1783-89 S.R. Pennycook 417
Additions to the knowledge of the genus Cladonia (Cladoniaceae, lichenized Ascomycotina)
in the alpine belt of the Pyrenees in Andorra
Teresa Azuaga, Mercedes Barbero, & Antonio Gomez-Bolea 433
Biosystematics of the Didymium iridis super species complex: additional isolates —
Jim Clark, Steven L. Stephenson, & John C. Landolt 447
Developmental morphology and ultrastructure of Pestalotiopsis maculans
M. Murugan & J. Muthumary 455
Morphological cladistic analysis of tropical Hymenochaetales (Basidiomycota)
Aristételes Gées-Neto, Clarice Loguercio-Leite, & Rosa Trinidad Guerrero 467
The genus Kretzschmaria from Tucumén, Argentina
A. I. Hladki & A.I. Romero 481
MYCOTAXON
AN INTERNATIONAL JOURNAL OF RESEARCH ON
TAXONOMY & NOMENCLATURE OF FUNGI, INCLUDING LICHENS
VOLUME LXXIX, 2001
-COMPLETE IN ONE VOLUME
CONSISTING OF v + 530 PAGES INCLUDING FIGURES
EDITOR-IN-CHIEF
Pavel Lizon
Department of Cryptogams, Institute of Botany
Dubravska 14
SK-842 23 Bratislava, Slovakia
ASSOCIATE EDITORS
David L. Hawksworth
BOOK REVIEW EDITOR
114 Finchley Lane, Hendon
London NW4 1DG, United Kingdom
Grégoire L. Hennebert
FRENCH LANGUAGE EDITOR
32 Rue de I'Elevage
B-1340 Ottignies - LLN, Belgium
Karen D. Gettelman
INDEX EDITOR
7044 Amherst Avenue
St. Louis, MO 63130, USA
EDITORIAL ADVISORY BOARD
GREGORY H. MUELLER, Chicago, Illinois, USA (1998-2002, Chm.)
DONALD H. PFISTER, Cambridge, Massachusetts, USA (1997-2001, Past Chm.)
CAROL H. SHEARER, Urbana, Illinois, USA (1999-2003)
RANDOLPH S. CURRAH, Edmonton, Canada (1999-2004)
SEPPO HUHTINEN, Turku, Finland (2000-2005)
Published by
MYCOTAXON, LTD., P. O. BOX 264
ITHACA, NY 14851-0264, USA
~ Www.mycotaxon.com
Printed in the United States of America
© Mycotaxon, Ltd., 2001
TABLE OF CONTENTS, VOLUME SEVENTY-NINE
July - September 2001
Macowanites vinaceodorus sp. nov. (Russulales) a new gasteroid fungus from
coastal dunes of Spain Francisco D. Calonge & Josep Maria Vidal
Phylogenetic relationships of Panellus (Agaricales) and related species based on
morphology and ribosomal large subunit DNA sequences
Jiankang Jin, Karen W. Hughes, & Ronald H. Petersen
Typification of Hypogymnia hypotrypa and H. sinica
Bruce McCune & Walter Obermayer
Caloplaca nashii sp. nov. (Teloschistaceae, Lichenes), a North American species
of the C. lactea-group growing in caliche
P. Navarro-Rosinés, E. Gaya, & N. L. Hladun
Aspidothelium gemmiferum sp. nov. from Papua New Guinea (lichenized
Ascomycetes) Emmanuél Sérusiaux & Robert Liicking
Pulvinella, a new genus with prosenchymatous propagules Annette W. Ramaley
A new Antrodia species (Coriolaceae, Basidiomycetes)
Annarosa Bernicchia & Leif Ryvarden
Muscodor albus anam. gen. et sp. nov., an endophyte from Cinnamomum
zeylanicum Jeerapun Worapong, Gary Strobel, Eugene J. Ford,
J. Y. Li, Gary Baird, & W. M. Hess
Histeridomyces tishechkinii sp. nov., a new species of Laboulbeniales
(Ascomycetes) from New Zealand Alex Weir
Perenosclerospora eriochloae sp. nov. and other downy mildews on native
grasses in Queensland, Australia M. J. Ryley & R. F. N. Langdon
Rhizopogon buenoi (Boletales, Basidiomycota) a new species from Spain
Maria P. Martin & Francisco D. Calonge
Hymenochaetoid fungi (Basidiomycota) of North America Erast Parmasto
Scutellinia sinensis in Europe Stanislav Glejdura
Two new species of Brevicellicium and a survey of tropical and subtropical
species in the genus (Basidiomycotina, Aphyllophorales) Kurt Hjorstam
Corticioid species (Basidiomycotina, Aphyllophorales) from Colombia III
Kurt Hjorstam & Leif Ryvarden
Hyphomycetes from leaf litter of Miconia cabussu in a Brazilian Atlantic rain
forest Luis Fernando Pascholati Gusmao, Rosely Ana Piccolo Grandi,
& Adauto Ivo Milanez
A neglected calicioid lichen new to Taiwan
I-Chen Hsueh , Clifford M. Wetmore, & Ming-Jou Lai
Type specimen studies in New World Lentinula
Juan L. Mata & Ronald H. Petersen
Doassansiopsis euryalis sp. nov. (Ustilaginomycetes) Kalman Vanky
Phylogenetic relationships of Asterodon and Asterostroma (Basidiomycetes),
two genera with asterosetae Tobias Wagner
A new species of Myelochroa and new records in the lichen family Parmeliaceae
(Ascomycotina) from Sikkim, India
P. K. Divakar, D. K. Upreti, G. P. Sinha, & John A. Elix
101
107
181
189
201
PANS)
217
Jah
235
247
iv
A new species and new records in the lichen family Parmeliaceae (Ascomycotina)
from the Philippines John A. Elix & Felix Schumm
Ustilago deyeuxicola sp. nov. from China Kalman Vanky & Lin Guo
Hyaloseta nolinae, its anamorph Monocillium nolinae, and Niesslia agavacearum,
new members of the Niessliaceae, Hypocreales, from leaves of Agavaceae
Annette W. Ramaley
Three noteworthy Amanitae of subgenus Lepidella from China
Zuo-Hong Chen, Zhu-Liang Yang, & Zhi-Guang Zhang
Studies in Neotropical polypores 13. Ceriporiopsis cystidiata sp. nov.
Clarice Loguercio-Leite, Gustavo Vernet de Costa Gongalves,
& Leif Ryvarden
New species of Amanita from the Dominican Republic, Greater Antilles
Orson K. Miller, Jr. & D. Jean Lodge
Notes on discomycetes in Dongling Mountains (Beijing)
Zheng Wang & Ke-quan Pei
Galiella celebica from India D. C. Pant
The lichen genus Topeliopsis in Australia and remarks on Australian
Thelotremataceae Klaus Kalb
Discomycetes of the Sarcoscyphaceae in Taiwan Yei-Zeng Wang
Some species of Xylaria (Hymenoascomycetes, Xylariaceae) associated with oaks
in Mexico Felipe San Martin, Pablo Lavin, & Jack D. Rogers
Notes on Hyphomycetes. LXX XIV. Pseudotrichoconis and Rhexodenticula, two
new monotypic genera with rhexolytically disarticulating conidial separating
cells William A. Baker, E. Christopher Partridge, & Gareth Morgan-Jones
A list of discomycetes in China. Supplement I Wen-Ying Zhuang
Physiological and morphological variations in Oidodendron maius
Adrianne V. Rice & Randolph S. Currah
Wenyingia, a new genus in the Pezizales (Otideaceae)
Zheng Wang & Donald H. Pfister
Compléments a l'inventaire des Basidiomycetes de Gréce
Zacharias Athanassiou & Ioanna Theochari
An index to Batsch's Elenchus Fungorum, 1783-89 S. R. Pennycook
Additions to the knowledge of the genus Cladonia (Cladoniaceae, lichenized
Ascomycotina) in the alpine belt of the Pyrenees in Andorra
Teresa Azuaga, Mercedes Barbero, & Antonio Gomez-Bolea
Biosystematics of the Didymium iridis super species complex: additional isolates
Jim Clark, Steven L. Stephenson, & John C. Landolt
Developmental morphology and ultrastructure of Pestalotiopsis maculans
M. Murugan & J. Muthumary
Morphological cladistic analysis of tropical Hymenochaetales (Basidiomycota)
Aristételes Gées-Neto, Clarice Loguercio-Leite, & Rosa Trinidad Guerrero
The genus Kretzschmaria from Tucuman, Argentina
A. I. Hladki & A. I. Romero
Online resources for fungal taxonomy & nomenclature: Web design
Kathie T. Hodge
phe fe)
261
267
vA BS
285
289
307
Anis
319
29
ay
361
SH ee,
383
397
401
417
433
447
455
467
481
497
Nomenclatural novelties proposed in volume 79
Author index
Index to fungous and lichen taxa
Errata
Reviewers
Publication date for volume 78
i Nahe Md
i" ocr | bet Boy 7 RL ea i Y kW) a ar he ‘ah x
Se es Hh Ady hy . oy eile: cele. ne at) hoon oh naar
Lis
nf
\
| das en t ins bg jis ae Wace a | . ’ , wed
1 : eo = Hy al’ ‘ ae ue > ra : s a Ae Miers ae
A i os tu er Haale ‘eoritaw "
ae he Raynes Bc hc cha a bapa. De ne
Kn i" nie ‘Tot ay ike sis e. a1 ’
a te te ‘ses cacy chats MAG Segal, Cet mt te em
eee Rae AR LL ky pain BS ann Boa ure: bey el Bi he ee
iy & Lees te pnd’! raat Poy nm Jat ify : a sean . ;
ee ae es Riycsh vie ans " edi Sil elie ina A tah ar 3) cee “i uf ee
RAP x ew ‘i wri ea Rev Ma oe hy Wty ot a hye Shee ‘
of i elas aut thal Mee be Bye sui he Nabari Fei. Keele a ate cue
vi A) Ba hh ear, et, a a Oa aun gmbohaiten, Kp bitte pia bia tats Fy oe ri a rr ant at
ne \ we j i\ ” hei ¢ ji A, ' “ | : i Bi fy) ep “Ajetde ‘iw hoes ait 25 sha te Hai aay : my u
m ae A ; Wk hake
Se Ae BRAY RA, oe hh ‘A Suh gal a5 ie hacoge dies, 4 Whaat hil, Chins = saved
"igh gt ely We RSAR aalie Oi is i" oe hil ti: ‘Aigeatnlace, videagrae at ORC AE a oAa Ay,
Ny Wan ae B fealene, bin adenstine ¥ pelea sna bkarg a a, £14 ie
oF acres waleay iti tay “iste! MROROL T2077) Wesel ins s ibaa ah at
ey jes a eae abe VUE sa ey fai Vea Mee gees ne ied
Fics al Coe N OS ak UCINRURN Oa, sit tou ARkrabane ny ie | ae mip’ i whey | oF Psy
. rite: o) ae ra | se heath ge wh rent Hale eng bait ho kan d ee
a aa iia SOC Ppinae w ‘Piaves, te thy
. Cty den vedi ay sly socal pon We My hur iagnyda baad pA the | ye ree a ' i
a HEL) ; A ae is RV ei as ; ev date wal tinge A iin Luck fish 4 a :
, . Me Pours, \ ity Mike a ae Ny vis Ar Voir) rene ao Sage Oy eee. Va he ea. x H haan, ayy tPAi ate
“CaN yr Desi en ae Rana e Wistn u git nia eM Ley $ oink ieee Mie
cis a wee oh tiara: pie es oath rah ea ihn whe poh: a4 avin Ns Ne Sinan, ees
(SEA To eat ily ieee ian) perenne, Hager
Ree Ce wee Ney) REESE rags dat
cee 4 ne nee pee aed ae Ha as nen i
Alea nai pers ea
A aid a : ie i
aes pes
te ee v ifthe my. , ey
‘ ee od i
te ie
Raees iKA power ye ih eon pail . “il
“7 if } aden payats te ana ta
i : » hy ahhh rie it: hiseiaks | sate
ure: ; 1) ane a
oa ey es rags
i ite UA ve a
Wars ptt ab tian
a on 1 a ;
al if ees
MYCOTAXON
Volume LXXIX, pp. 1-6 July-September 2001
MACOWANITES VINACEODORUS SP. NOV., (RUSSULALES) A NEW
GASTEROID FUNGUS FROM COASTAL DUNES OF SPAIN
Francisco D. Calonge’ & Josep Maria Vidal?
'Real Jardin Botanico, C.S.I.C., Plaza de Murillo 2, 28014 Madrid, Spain.
*Depto. Biologia Vegetal, Unitat Botanica, Facultat de Biologia, Univ. Barcelona, Av.
Diagonal 645, 08028 Barcelona, Spain. (Personal address: Massaballs 10. 17118 Sant Sadurni
de I|’Heura, Girona, Spain)
ABSTRACT
Macowanites vinaceodorus is proposed and described as a new species, together with details on
ecology, morphology, anatomy and compared with related taxa.
Key words: Macowanites vinaceodorus, M. americanus, M. olidus, taxonomy, ecology, Iberian
Peninsula.
INTRODUCTION
Only two species of Macowanites have previously been described in Europe: M. krjukowensis
(Buchholz) Singer & A. H. Sm., from Russia, under Populus, Betula and Tilia (BUCHHOLZ,
1901, sub Secotium krjukovensis), and M. messapicoides Llistosella & Vidal, found in Spain,
under Quercus ilex (LLISTOSELLA & VIDAL, 1995).
The type species is M. agaricina Kalchbr. ex Berk., and about 25 species are known actually
(SINGER & SMITH, 1960; SMITH, 1963; MOSER ef al, 1977; CAZARES & TRAPPE, 1991;
LLISTOSELLA & VIDAL, 1995).
As a result of several visits to Portugal and Southern Spain during 1998 and 1999, we have
collected three species of gasteriod Russulales which seem to be undescribed taxa. All have
been found in littoral sand dunes, associated with Pinus pinea. One is being described as M.
ammophilus (VIDAL & CALONGE, 2001), the second one is under study, and the third is being
described here as M. vinaceodorus. For colour terminology we have followed KORNERUP &
WANSCHER (1978).
2
DESCRIPTION
Macowanites vinaceodorus Calonge & Vidal, sp. nov. (figs. 1-3)
Etym.: vinaceodorus, cum odoris vini.
Diagnosis.- Gasterocarpus gregarius, subhypogeus, deinde epigeus, stipitatus. Pileus 3-6(-8.5)
cm latus, convexus vel plano-convexus. Peridium viscidum, pallidum, deinde purpureo-
violaceus, ochraceo- maculatum, 150-250 um crassum, mediopellis gelatinosa, hyphis 1.25-
3.75 um diam, cum pigmentum violaceo-roseum. Stipite-columella cylindrica, percurrentis,
1.5-2.5 (4) x 0.8-2.5 cm, albida. Rhizomorpha presentis. Gleba ochracea, sublamellar-
anastomosa. Odor vinosus. Sporae globosae vel subovoideae, 8-11 x 7-9.5 um ( 9-13.5 x 8.5-
12.5 um) asimetricae, alutaceae, tenuitunicatae, verrucosae vel subreticulatae, amyloideae.
Basidia 30-45 x 1I- 16 ym, late clavata, 2-4-sporigena. Macrocystidia 50-75 x 10-16 ym,
fusiformia vel utriformia, pedicellata. Trama hymenophoralis. heteromera. Sphaerocystis
numerosis vel 50 um latis.
Holotypus: Hispania, provincia Huelva, Mazagon, subter Pinus pinea, 27-XI-1999, legit F. D.
Calonge et J. M. Vidal, MA-Fungi 47416. Isotypus: In herbaria K, PC et BPI.
Basidioma gregarius, subhypogeous when young, epigeous at maturity, stipitate (fig.1la).
Pileus 3-6 (-8.5) cm diam, convex to plano-convex and depressed, expanding, margin involute.
Peridium smooth, viscid, with adherent granules of sand, initially joined to stipe but promptly
separated from it, pallid at the margin, white to pinkish white (K & W 11A2), darker at the
center, violet brown (K & W 11E8), usually maculated in ligh orange (K & W 5A4), specially
at the margin. Stipe-columella percurrent, cylindrical or attenuate at base, 1.5-2.5 (-4) x 0.8-2.5
cm, with a well-developed rhizomorph, white, unchanging when bruished. Context white,
initially solid, then cavernous in the stipe (fig. la). Gleba loculate in the upper zone,
sublamellate in the lower part, initially annexed to the stipe-columella, promptly completely
free and exposing the lower sublamellate chambers (fig. 1a), light orange (K & W 5A4). Spore-
mass in the locules pale orange (K & W 5A3). Odour very surprising and intense, vinaceous in
fresh basidiomata. It reminds the smell present in old fruits before fermentation, or in old
basidiomata of certain fungi such as those of Agrocybe aegerita, reminding a young wine. In
all cases it corresponds to aromatic substances formed as a result of fermenting processes on
organic materials with glucosidic contents. Taste sweetish at first, but remotely acrid after a
few minutes. Chemical reactions are like in Russula, flesh changes to pink when contacting
FeSO4, but does not change in the presence of other reagents such as guayac, NH3, phenol and
KOH.
Spores 7-11 x 6-9.5 um (9-13.5 x 8.5 - 12.5 um) ornamentation included, globose to broadly
ellipsoid (figs. 2-3), heterotropic, with an hilar appendage. Amyloid ornamentation consisting
of isolated warts, crests of a subreticulum, being 0.7-1.5 um high, with a suprahilar plage (figs.
lb-c). Basidia broadly claviform, hyaline in 5% KOH, 30-45 x 11-16 um, fusiform to utriform,
acute, and long pedicellate. Subhimenium cellular. Hymenophoral trama heteromerous, with
large sphaerocysts up to 50 wm diam. Context of pileus and stipe-columella typically
heteromerous. Peridiopellis thin, 150-250 um. Suprapellis an intrincate trichodermis of
redressed hyphae and dermatopseudocystidia 30-75 x 2.5-11 um, cylindrical to claviform
Mediopellis an intricate isocutis made of gelatinized repent hyphae, 1.25-3.75 um diam, with
intracellular violet pinkish pigment. Oleiferous hyphae present. Subpellis an intricate cutis of
non-gelatinized hyphae, 2-6 um diam. Stipitipellis a cutis of repent hyphae, 2-6 um diam, with
some redressed hyphae and dermatopseudicystidia like those of the peridiopellis.
Fig. 1-- Macowanites vinaceodorus (a-c). a: Several gasterocarps in their natural habitat
showing the main characters (MA-Fungi 47416, Holotype). b-c: Spores as seen under
the SEM. Observe the ornamentation mainly warty (MA-Fungi 47416, Holotype).
Holotypus: Spain, Huelva province, Mazagén, abundant fruitbodies were collected
growing in littoral sand dunes under Pinus pinea, at the vicinity of different plants, such as
Corema, Halimium, Helichrysum, etc., 27-X1-1999, leg. F. D. Calonge & J. M. Vidal, MA-
Fungi 47416. Isotypus: In herbaria K, PC and BPI.
DISCUSSION
When first observed this fungus in its natural habitat it looks very much like a typical Russula,
being a species rather alike Russula cessans, for instance. However, this feeling changes after
examining the anastomosed lamellar gleba. It is clear the evolutionary transit between the
typical epigeous forms of Russula to the subhypogeous Macowanites. Regarding the orange
colour of the gleba and the globose, verrucose to subreticulated, ochraceous coloured spores,
and the habitat under conifers, there are several species with similar characters, all them in
North and Central America, in alpine and subalpine forests. The most similar species is M.
americanus Singer & A.H. Sm.(figs. 2 a-b), which presents almost the same microscopy and
colour of the pileus, but with frequent olive tones, which are absent in our material. On the
other hand, the size is smaller, 1-5 cm diam of the pileous and lacks of any distinctive smell,
being associated to Abies, Picea and Pseudotsuga. It grows in mountainous areas of the Pacific
Norwest (SINGER & SMITH, 1960). Another North American similar species is M. olidus
Smith, with pinkish cinnamon peridium, tinged with olive over the disc, showing an aromatic
odour reminding that of Russula laurocerasi (SMITH, 1963), and the spores mostly
subreticulate (figs. 2 c-d).
Macowanites mexicanus Guzman, differs by the reddish to coffee-reddish peridium and
orange-yellowish stipe. The dermatocystidia and the macrocystidia are also different, without
any noticeable smell and grows under Pinus oocarpa and P. montezumae, up to 3000 m
altitude in Mexico (GUZMAN, 1988). In a recent revision of the type material of M mexicanus
HERNANDEZ-HERRERA & KONG-LUZ (1998) considered that this taxon was identical to
Cystangium pineti Singer. However, after the revision of the type material, kindly sent by Dr.
G. Guzman, under the herbarium number XAL. 19492, we think that it really belongs to the
genus Macowanites, since it shows a filamentous pileopellis.
Regarding M. vinaceodorus, there is only one species with the same smell of wine, M.
lymanensis Cazares & Trappe, but this species presents a reduced stipe, being angiocarpic, with
loculate gleba, dull yellowish peridium with brownish tinges on the disc, pallid in the margin,
without violaceous tones, macrocystidia absent. It grows under Abies, at 1700 m (CAZARES &
TRAPPE, 1991).
As a matter of fact, M. vinaceodorus shows a combination of characters, such as smell of
wine, larger size, pinkish to violet brownish peridium, sublamellate, ligh orange gleba, basal
rhizomorphs and habitat in littoral sand dunes under Pinus pinea, which confer this taxon
enough identity to be proposed as a new species.
ACKNOWLEDGEMENTS
We express our gratitude to Mr. Miguel Jerez for his valuable SEM assistance and to Dr. Rober
Fogel, University of Michigan Herbarium, USA, for the loan of the type material of M.
americanus and M. olidus, and to Dr. Gast6n Guzman, Inst. Ecologia A. C., Xalapa, Mexico,
for the loan of the type material of M. mexicanus. To Dr. Gabriel Moreno we acknowledge the
revision of the original manuscript.Thanks are also due to the CSIC and ICCTI for financial
support to afford the travelling to collect material.
Fig. 2- a-b: Macowanites americanus. Spores observed under the SEM showing an
ornamentation from warty to subreticulate (MICH 45032, Holotype). c-d:
Macowanites olidus. Spores observed under the SEM showing an ornamentation
mostly subreticulate (MICH 65876, Holotype).
6
REFERENCES
BUCHHOLZ, F. - 1901.- Hypogaeen aus Russland. Hedwigia 40: 304-322.
CAZARES, E. & TRAPPE, J. M. -1991.- Alpine and subalpine fungi of the Cascade and Olympic
Mountains. 2. Macowanites lymanensis sp. nov. Mycotaxon 42: 333-338.
GUZMAN, G. - 1988.- Dos nuevas especies de Macowanites en México. Rev. Mex. Micol. 4:
115-121.
HERNANDEZ-HERRERA, Y. A. & KONG-LUZ, A. - 1998.- Notas sobre Cystangium pineti y
Macowanites _mexicanus. Res. VII Congr. Latinoamericano Bot. : 260.
KORNERUP, A. & WANSCHER, J. R.- 1978.- Methuen handbook of colour. Third edition. Eyre
Methuen. London.
LLISTOSELLA, J. & VIDAL, J. M. - 1995.- Due nuove specie di Russulales gasteroidi della
regione mediterranea. Riv. Mic. AMB 38: 149-162.
MOSER, M., BINYAMINI, N. & AVIZOHAR-HERSHENZON, Z. -1977.- New and noteworthy
Russulales from Israel. Trans. Br. Mycol. Soc. 68: 371-377.
SINGER, R. & SMITH, A. H. - 1960- Studies on secotiaceous fungi. IX. The Astrogastraceous
series. Mem. Torrey Bot. Club 21: 1-212.
SMITH, A. H. -1963- New Astrogastraceous fungi from the Pacific Northwest. Mycologia 55:
421-441.
VIDAL, J. M. & CALONGE, F. D. - 2001- Macowanites ammophilus, a new combination based
on new evidences. Crypt. Mycol. 22: (in press).
MYCOTAXON
Volume LXXIX, pp. 7-21 July-September 2001
PHYLOGENETIC RELATIONSHIPS OF PANELLUS (AGARICALES) AND
RELATED SPECIES BASED ON MORPHOLOGY AND RIBOSOMAL
LARGE SUBUNIT DNA SEQUENCES
Jiankang Jin, Karen W. Hughes ' & Ronald H. Petersen
Department of Botany, The University of Tennessee
Knoxville, Tennessee 37996-1100 USA
' Corresponding author. email:khughes@utk.edu
Abstract: Panellus, sensu lato has included putatively related taxa with uncertain
affinities. Previous researchers suggested that Dictyopanus, a poroid mushroom, was
closely related to the gilled Panellus, but affinities of Dictyopanus and Panellus to
segregate genera of Tectella, Pleurotopsis and Sarcomyxa remained uncertain.
Representative specimens and isolates of eight species of Panellus s.l. and
Dictyopanus were examined; P. stypticus, P. mitis, P. ringens, P. violaceofulvus, P.
serotinus, P. patellaris, P. longinquus and Dictyopanus pusillus. Phylogenies based
on morphology and ribosomal large subunit DNA sequences were constructed. Both
methods supported five clades: 1) D. pusillus and P. stypticus, 2) P. ringens and P.
violaceofulvus; 3) P. mitis; 4) P. serotinus: and 5) P. patellaris. Inciusion of
sequences for Resinomycena acadiensis, Mycena rutilanthiformis and M. clavicularis
showed that Panellus s.l. was polyphyletic. Generic designations exist for all clades or
terminal taxa except for Panellus mitis which may require new generic placement.
Both P. stypticus and D. pusillus share a homologous Group I Intron at the same
position of the ribosomal large subunit gene, further supporting a close relationship
between Dictyopanus and Panellus.
Key words: Dictyopanus, Pleurotopsis, Ribosomal Large Subunit RNA, Sarcomyxa,
Tectella
INTRODUCTION
The genus name Panellus was proposed by Karsten (1879) with the type
species, P. stypticus (Bull: Fr.) Karst. Two species, P. stypticus and P. farinaceous
(Schum.) Karsten, were originally included in the genus (Karsten, 1879). Murrill
(1915) listed 10 species in this genus, P. stypticus, P. jalapensis Murmill, P.
cantharelloides Montagne, P. subcantharelloides Murmill, P. flabellatus Murmill, P.
eugrammus (Mont.) Murmill, P. dealbatus (Berk.) Murmill, P. haematopus (Berk.)
Murnill, P. ursinus (Fries) Murrill and P. vulpinus (Sow.) Murrill; but most of these
were subsequently transferred to other genera. Smith (1949) included two genera,
Panellus and Tectella, under Tricholomataceae, subfamily Pleurotoideae, but Kiihner
and Romagnesi (1953) included P. (Tectella) patellaris (Fr.) Earle within Panellus
together with P. serotinus (Fr. ex Schrad.) Kithner, P. mitis (Fr.) Kiihner, P. ringens
8
(Fr) Romagnesi, P. violaceofulvus (Batsch ex Fr.) Singer, and P. stypticus. The
Kihner-Romagnesi scheme is still widely used by present-day researchers including
Miller (1970, 1984) who characterized the genus as having a trama of thick-walled
hyphae, even gill edges, a sessile or short-stipitate basidiocarp, cheilocystidia,
lignicolous habitat, and white, smooth, amyloid, allantoid to narrowly elliptical spores.
Spore characters easily separate Panellus from other "pleurotoid" genera including
Pleurotus, Panus, Cheimonophyllum, Pleurocybella, Hohenbuehelia and Resupinatus
(Miller, 1984).
Burdsall and Miller (1975) proposed merging the poroid Dictyopanus into
Panellus, based on similarities spore shape, well-developed stipe and ability of
basidiomata to revive when moistened, and proposed two subgenera under Panellus,
Panellus and Mitellus. The former included P. stypticus, P. pusillus (Pers. ex Lev.)
Burdsall & Miller and P. copelandii (Pat.) Burdsall & Miller. The latter included P.
mitis, P. patellaris (Fr.) Konrad & Maublanc, P. serotinus, P. ringens, and P.
violaceofulvus. Later, Burdsall and Miller (1978) transferred D. orientalis Koboyasi
to Panellus as P. orientalis, with two varieties, D. pusillus var. pseudorhipidium and
D. p. var. sublamellatus. Since D. pusillus (Pers. Ex Lev.) Singer is the type species of
Dictyopanus, the new combination reflected the merger of Dictyopanus into Panellus.
Corner (1986), in agreement with Burdsall and Miller (1978) treated Dictyopanus as a
synonym of Panellus and incorporated 22 new poroid and lamellate species reported
from Malaysia. In his wide circumscription of the genus, Panellus longinquus (Berk. )
Sing. was tentatively placed in this genus. Singer (1975,1986) however, separated
Panellus and Dictyopanus, which together with Tectella were placed in the
Tricholomataceae tribus Panelleae. For Singer, Panellus contained two subgenera,
Panellus and Serotinae. Singer’s arrangement is also widely used today.
Recently, phylogenetic analyses based on 18S nuclear ribosomal DNA (nuc-
SSU) and mitochondrial mbosomal small subunit (mit-SSU) sequences of
homobasidiomycetes have shown that P. stypticus was closely related to P. serotinus
(Hibbett 1996, Hibbett et al 1997), but a single most parsimonious tree based on
mitochondrial rDNA placed P. stypticus and P. serotinus in different clades (Hibbett
and Donoghue 1995).
In this study, we have examined relationships among eight species within this
complex: Panellus stypticus, P. mitis, P. ringens, P. serotinus, P. violaceofulvus, P.
patellaris, P. longinquus and D. pusillus, based on morphology and nuclear ribosomal
large subunit (nLSU) DNA sequences.
METHODS AND MATERIALS
Collections: Collections used in this study are listed in Table 1. CBS391.50 (P.
violaceofulvus) was represented by a culture only. Cultures were obtained and
maintained as discussed by Hughes et al. (1999).
Morphological examination: Exemplars from each species in the genus complex
were selected for morphological examination. For microscopic characters, a
basidioma was supported in Sambucus pith, and sectioned under a dissecting
9
microscope at a magnification of 10 X or 20 X. Some microscopic characters were
observed at 10 X or 20 X magnification. Other micro-characters were observed with a
Wild compound microscope at a magnification of 187- 1875 X (oil immersion).
Measurements were aided by an ocular micrometer, calibrated with a haemocytometer
grid.
Table 1. Collections examined
Collection TENN GenBank Species Country Location Host
Accession Accession
No. Number
2675 48833 Panellus stypticus New Zealand Fjordland Nothofagus
3342 48835 Panellus stypticus Russia Pnmorsk rotten Quercus
4319 50398 (AY014292) Panellus stypticus Switzerland Maggia rotting Anus
6157 52316 Panellus stypticus USA TN, Polk Co, na
8265 54317 (AY014291) Dictyopanus pusillus USA FL, Ocala Nat hardwood
Forest
9408 56382 Dictyopanus pusillus Costa Rica Prov. Alajuena hardwood
9522 56278 Dictyopanus pusillus USA FL oak or cypress
9803 56342 Dictyopanus pusillus Puerto Rico _ El Yunque deciduous
trunk
9808 56347 Dictyopanus pusillus Puerto Rico _ El Yunque rotten log
5644 52389 (AY014288) Panellus mitis USA ID, Bonner Co. conifer twig
7486 53512 Panellus mitis Finland Etela-hame Prov. Pinus bark
7494 53511 Panellus mitis Finland Etelé-hame Prov. Picea bark
6881 53461 (AY014287) Panellus serotinus USA NY, SchuylerCo. na
6894 53450 Panellus serotinus USA NC, Macon Co yellow birch
9992 58324 Panellus serotinus USA NC, Macon Co. na
6711 52365 (AY014290) Panellus ringens USA AK, Turmagain hardwood
Am
9812 58308 Panellus ringens USA NC, Graham Co. unknown bark
CBS391.50 (AF325361) Panellus France na na
(culture violaceofulvus
only)
DAOM 58323 Panellus Canada Quebec, Fonllon fir branch
198753 violaceofulvus Nat. Park
6170 52302 (AF014286) Panellus patellaris USA NC, Macon Co. hardwood
6486 53403 Panellus patellaris USA NY, Dutchess Co. hardwood
6662 53214 (AF014289) Panellus longinquus USA WA, Callam Co. alder
6663 53215 Panellus longinquus USA WA, Grey’s unknown
Harbor
Morphological analyses: Macroscopic and microscopic morphocharacters from Table 2
and Table 3, together with host substrates from which collections were obtained were
incorporated into a data matrix (Table 4). In Table 4, characters are defined as follows: 1.
A. lamellate, B. poroid; 2. A. panelloid, B. pleurotoid but not panelloid, C. pendent / bell-
shaped; [ “‘panelloid’” is a descriptive term for basidioma stature as defined by Comer
(1986). In this study, panelloid refers to a basidioma with a short conspicuous lateral
stipe, which is concolorous or slightly different from the pileus, and clearly is not part of
the pileus. Lamellate or poroid hymenia emerge above the stipe and the pileus is typically
dimidiate.] 3. A. membranous veil absent, B. membranous veil present, 4. A. basidioma
substipitate, B. basidioma sessile or pseudostipitate, 5. A. pileus surface pubescence
absent, B. pileus surface pubescence present, 6. A. lamellae crowded, B. lamellae dense,
C. lamellae subdistant to distant, 7. A. lamellae not equal length, B. equal length; 8. A.
lamellae not forked, B. lamellae forked; 9. A. basidiomata revivable, B. basidiomata not
revivable, 10. hymenium length A. <10 um, B. 10- 20 um, C. > 20 um, 11. A.
pleurocystidia thin-walled, B. pleurocystidia thick-walled; 12. A. extension of
10
a[qeyieae jou = eu
a3ejdtjsopnosd
soA ou yueysip ou ou ‘aIsses ptojomeyd Oye] [OUI] snnbuiguo] ‘q SIZES €999
91e3d1sopnesd
soA ou yuejsip ou ou ‘gTIssos ptojomoyd oye[[oure] snnbu1suo] ‘d PIZes 7999
= ey Se Ba oe i) cae Se oe aye}dtjsopnasd
ou ou osuep sof so ‘gIssos yuopued oyeTpourey suvyajod ‘J COvES 98h9
93e}d1jsopnosd
ou ou gsuap so so ‘a]Issos yuopued oqe]joure] supjjajod ‘gq ZOETS 0L19
juopuad ESL861
ou ou yuejstp soA ou gpissos _ podeys-[Joq ayeypoue, snagnfoaanjois ‘J SZ7ERS WOVd
ayeydtjsopnasd yuopued
ou ou yURsIpqns soA ou ‘apIssas podeys-[joq oye]]oure] suasuu ‘J BOERS Z136
ayeydrjsopnesd yuopuod
ou ou 4jueystpqns so ou ‘gfisses =—-_—s pod eys-]Joq oye [[ourey suasuu ‘g S9ETS LIL9
———on ~~ SAK.~—S~*«&* PMN ou ou ayeqtdrsqns projyomoe] ayeT[OuIe] Snuyosas “q PTERS 7666
ou soA popMmoso ou ou oyestdtysqns projomeyd oye][oure] snuyosas ‘J OSPES +639
proyomeyd
ou ou yueqstp ou ou ayeytdtjsqns ayeyidiysqns oye ]oure] Sym ‘gd LISES PobL
plojomoyd
ou ou yueystp ou ou oyeqtdtjsqns oyeytdtysqns oye] ure] Sym ‘gd ZISES O8bL
projomeyd
ou ou yueystp ou ou oyestdijsqns oyejtdtysqns oye TOUTE] Sym ‘g 68E7S +b9s
eu eu eu ou ou oyestdrjsqns ptoyjoued ptozod snyjisnd ‘q LYeos 8086
eu eu eu ou ou ajestdiysqns ptoyjoued ptosod snjjisnd ‘q ZHE9S £086
eu eu eu ou ou ayeqtdiysqns proyjoued prosod snppisnd ‘q 8LZ9¢ ZZS6
eu eu eu ou ou ayeqidijsqns ployjoued ptorzod sngpisnd ‘q ZENS 8066
eu eu eu ou ou ayeqtdisqns ployjoued prosod sngpisnd ‘q LILES 6978
ou ou asojo ou ou ayeqtdijsqns prorjoued oyeppourey snoydajs ‘q OLEZS LS19
ou ou 9so]o ou ou ayeqtdrjsqns projjoued aye] ure] snoydas ‘J 8605 6LEP
ou ou gso[o ou ou ayeytdtjsqns ployjoued oye][oure] snoydas ‘gd SER8P THEE
ou ou asojo ou ou ayeytdiysqns proyjoued oye][oure] snoydas ‘gq CER8P SLOT
‘ou
poyoy yysusy jenbs Aysusp so0usoseqnd [IA sno ommnyeys WOTSsa0de
Qeyjourey SeTjourey QeT[oure] snopid -ueIquisy\ ods eUTOTpIseg waNTUSUIAY soroods NNA&L ‘00 pista
Xe[dutoo snpjaung uy Ul siejdusexe Jo slopesetpoydiout ordoosobeyyy °Z 2198.1
11
‘9]qe]IeAe JOU = eU ‘popnjour jou Yysus] WintueUIAY ‘unTusUAY puoAeg UoIsuEyxq
peyrem-yory}
plojAure PIEXLES “wosyooseyd quasge IO ['p SyRARIO 9'9-L'¢ SyeARTO 9'€Z snnbuisuo] ‘g SIZES €999
peytea-yory}
projAure PS EX6L'9 ‘uoyyooseyd lv-S 2 OyRARTO Lt-S'Z ayeArpp 9'€Z snnbursuoy ‘J pIZEs Z999
projAure Teoupurjéo peyrem peyreaa
yep oouis 0S IXL6'€ 3u0| €71-8'6 “sory ‘oyearyo 99-E€ -YO} “oyearyo BL supyaiod I E0HES 98r9
pele M-yorny}
projAure Teourpuréo poem TeoupuryAo
ep oouis 10 TX6¢'€ 3u0] CLI-6 1 ~YOn} “oyearpo 6CI-T tl “oyearyo OL siapyjayod ‘J CTOETS OLT9
poTeM-4oryy pore €$L861
projAure 9S TXLE'S proyusTye LS-Tp Ssoomusa ‘oyeAryp Tp-S'Z__ -yoruyy ‘oyearyo 9ST Snajnfoaonjoja ‘gq ezess = WOVd
pee
eu Bu eu lavetie: SyBAepo CEST —ONJ ‘oyearyo T8 sUuasUid B0E8S 7186
pee
projAure 68 TX8o 7 proyueyye LS-TP ‘oyearyo Q'9-E'E —_-OM} ‘oyeaRyo 78 suaBUIA ‘J S9ETS ITL9
TeoupuryAo peTem-yony
‘plojAure yep Cy TX81 7 3u0] SG SYPARTO aA | “ploymeur gs SNUIJOAIS “J VTEBS 7666
proyAure Teoupuyéo
yrep ‘Woouls Or 1Xp9'P uo] 9°9 OJCARIO eu yuasqe BL Snuljosas “gq OSPES 7689
proyAure yeoupurAo erIpysAoopnesd
yep Yoouls LO TX0S'7 Su] eu Jo yuSsqe 99-67 a}eARlO c9 SHIM TIS€s vé6rl
eipysAoopnesd
eu eu eu eu Jo yuasqe LS-EE ayeArpo € Ol SIUM J ZISES O8bL
projAure yeoupuryAo eripysAoopnesd
ep Yoouls 19 TXty'y 3u0] eu Jo Jussqe USS ayeARO 03 SHIM I 68E7S vos
Woouls VS CXbr ¢ esoqoysqns OIp-9r~ oNUpusp “oyearyo SE7-B VI oyeAR[D LS snyisnd ‘q LyE9s 8086
yoouls TS TXOV € esoqoysqns T6b-L' 87 ~—- ONMpuap ‘oyearyo 67-9 ST SN) 39 snyisnd ‘q CEOS £086
oouls 98 IX8L'€ UwWLosToaseyd ¢07-8'6 dNUpusp ‘oyearyo v6 CI-86 oyeAepp T9 snyisnd ‘q 8L79S 77S6
yyoours Ce TXOV'E onde 9VTV9T oNUpusp ‘oyeAarjo VOT-€ Tl oyeaepp T9 snyisnd ‘q T8L9S 8076
Wyoouls €0'7XPO'h _ ULoyTJooseyd O'81_ _ onuUpusp ‘oyearyo 0e7-V 91 SyeArO V9 snyisnd ‘q LIEVs 6978
oouls 98° 1X08" proyusyye OTh-L 87 eyearp Tendo V9I-S TI oyeAP[O y9l snoydAjs “q iS) ESAS LS19
qoouls 68 TXPS't projueyye 9'P7-8'6 SSOOLMUDSA “oJRARIO ¢0¢-7 91 SyeALO OST snoydas ‘gq 86£0S 6lty
oouls CO TXIO'E proyueyye 9beV 91 ayeaeyo TLI-8'°6 SRALTO 6 snoydiys ‘f CE88P wee
qyoouls LVTX79'E projusyye OTr-7'91 SyBALTO (GIMERERS SyeAelo 9ST snoydas J CL88V CLIT
win juin juan wim ydue] Sean
OZIS SSVIOAR odeys UOTSUd]XO edeys UOTSUd}XO odeys QBvIOAR 4 —
“SHOY
olods eIpysAoojieyo eripysAoomeyd ummuSswAY soleds NN@L ‘OU ppt
aT
xo duos snyjaung snus oy) UI siepdwexe Jo slepeleipoydiowl stdoosobI “¢ 21qeL
Table 4. Morphology data matrix for parsimony analysis in Panellus complex’
ttc sit ctatdt Simmmi< si<
ttddi¢ddatacdim Smim mi
tdddicedcatacdic § cic <<
Ittditqcqctccdim Emimm<
tddditeaccact/s & Sim <jm
tdddi/e eects § Sletctitc dim [mooie
Cttetimanamaia < tic ciacicyaaciacc
tatddiledcceadimamal<<|< << ot)
fdddieecaddinomsectinmin |tminm
fdddieedddieacctisminmin inmaic<
OOM My att tis Oh istic lO fe OO
tttdticntat tatiana cain mgcaic [cic
atatd(e S&S Setacditdiccice [c<<imnm
ta<eeqadis S88 lect ctimnmaidt cic [edie
na
C
Cc
C
A
A
C
C
mommisgs es
ttt d[tctct dic ct cic cio m
ttdd(eaeddte die acdc
tid dieddcaddtdicdccinalma mim jam
fatiatatitctctctctimamMmngQoojo |00
~c tana Ola st ist tii a
io
A
mH
a) eS ey ay CES 33 Opie to
sss sSszzS Ess 8 ISS
Raa ho Rie eee ae Pee ol Olicg 3 UU
AAA HR Sf rnp =
aS S Sieusasiarate = Spe tls S |§8s
oy ey et SHES aS, (Se FS SMIES ES ES Se Sal eS EN SY
AA A IOI OPO Alas ies asa Aas eal a
a
DANK ©ONM O]+t 6 TIT Al =rlovo
mr BOO AOCOlT ONIN Al O o|™ 06
OA ANIA FT WM 0 CO} Ht TIO QAI iAlIa +t
AMNTOlLONAAAINE F/O Alo A slo 0
not available
P. longinquus
Character numbers correspond to the those given in the text; na
P. longinquus
6662
6663
13
pleurocystidia beyond the hymenium >10 um, B. extension of pleurocystidia beyond the
hymenum <10 um; 13. A. cheilocystidia present, B. cheilocystidia absent or
pseudocystidiate, 14. A. dendritic cheilocystidia absent, B. dendritic cheilocystidia
present, 15. A. cheilocystidia thin-walled, B. cheilocystidia thick-walled; 16. A.
extension of cheilocystidia beyond the hymenium >10 um, B. extension of cheilocystidia
beyond the hymentum <10 um; 17. A. spores allantoid to phaseoliform, B. spores
cylindrical; 18. A. spores thin-walled, B. spores thick-walled; 19. A. spores amyloid, B.
spores strongly amyloid; 20. A. host hardwood or other, but not conifer, B. host conifer.
Morphological characters were analyzed by parsimony analysis in PAUP, version 4.0
(Swofford 1996) using a branch and bound search. Characters were assumed to be
independent. Characters that were not available were treated as missing data and as a fifth
character in separate analyses. Bootstrap support was estimated by 100 bootstrap
replicates. Trees were examined and manipulated using TreeView (Page 1996).
Molecular techniques and analysis: Techniques for DNA extraction and DNA
sequencing were described by Hughes et al. (1999). For this study, the 5’-end of the
ribosomal LSU gene was amplified for sequencing and intron detection using primers
ITS3 and LR5 (White et al 1990; Vilgalys and Sun 1994). Cycle parameters for PCR
amplification were: 94 C for 3 min followed by 35 repetitions of 94 C for 0.5 min, 50
C for 1 min, and 72 C for 1.5 min. The final cycle was an extension at 72 C for 3 min.
If DNA had been frozen for a long time, it was pre-heated in the PCR reaction mixture
at 94C for 4 min before adding Taq polymerase which enhanced amplification. PCR
products were verified by gel electrophoresis. For sequencing, the PCR product was
purified in a 1.5% low-melt agarose gel (NuSieve GTG Agarose, FMC Bioproducts).
The desired band was excised and purified with a Promega Wizard PCR Purification
Kit following manufacturer’s directions. Sequencing was carried out on an ABI 373
DNA sequencer (ABI Prism Dye Terminator Cycle, Perkin-Elmer Inc.) with primers
ITS3, LR5, LR21 (White et al 1990; Vilgalys and Sun 1994), and NuDNAS5’-371
(AAAAGAACTTTGGAAAGAGAGT). GCG (Genetics Computing Group, 1997)
programs were used for sequence editing and alignment. Sequences were deposited in
GenBank (Table 1).
A BLAST search of GenBank using sequences from this study identified the
closest outgroup to P. stypticus (exemplar 4319) and D. pusillus (exemplar 8265) as
Resinomycena acadiensis AF042638 (Moncalvo et al, 2000). Other closely matching
sequences were: Pleurotopsis longinqua, RV95/47, AF042604 (Moncalvo et al.,
2000); Mycena clavicularis, RV87/6, AF042637 (Moncalvo et al, 2000); Mycena
galericulata, RV87/14.01, AF042636 (Moncalvo et al, 2000); Mycena
rutilanthiformis, JM96/26, AF042606 (Moncalvo et al, 2000); and Hygrocybe
citrinopallida, 930731-1, U66435 (Lutzomi, 1997).
Group I intron sequences were removed from P. stypticus 4319 and D.
pusillus 8265 and the remaining LSU sequences were aligned in Seqlab (Genetics
Computing Group, 1997). Parsimony analysis using the branch and bound search
option as implemented in PAUP 4.0 was used to evaluate relationships between taxa.
Gaps were treated as missing data and as a fifth character in separate analyses.
Bootstrap support was estimated by 100 bootstrap replicates. Phylograms were
displayed in TreeView (Page 1996). The presence of a Group I intron in the nLSU
14
gene was inferred by length differences of PCR products on a 1.5% agarose gel and
confirmed for selected collections by sequencing (Jin 2000).
RESULTS
Morphological comparisons and phylogeny reconstruction: Macroscopically,
basidioma stature of Panellus stypticus and Dictyopanus pusillus could be best
described as panelloid. Panellus mitis is unique in that it fruits always on coniferous
hosts, and basidiomata exhibit a large hymenium-free area near the point of
attachment. Panellus serotinus basidiomata are substipitate, and it is the only species
with crowded lamellae of almost equal length. Lamellae are ochre-orange, smooth,
and deep with entire margins. With thick flesh, basidiomata P. serotinus are not
revivable, unlike other. members of this complex. Basidiomata of P. ringens, P.
violaceofulvus and P. patellaris are sessile or pseudostipitate. In P. ringens,
basidiomata are violaceous or lilac, lamellae are subdistant, dark purple or violaceous,
and occasional anastomoses could be observed between lamellae. The pileus is
covered with fluffy pubescence. Basidiomata of P. violaceofulvus are small (Burdsall
and Miller, 1975); (diameter for DAOM198753 mature basidiomata is 2.5 -4.5 mm).
Pileus color is fawn to cinnamon colored. The inner side of pileus is pale. All other
characters resembled those of P. ringens, though the spores of exemplar collection
DAOM198753 (P. violaceofulvus) are a little larger than those of P. ringens exemplar
6711. Distinctive characters for P. patellaris are the presence of an evanescent
membrane covering lamellae in young basidiomata, rubbery-gelatinous consistency of
pileus tissue, and a pubescent pileus surface. Basidiomata of P. longinquus is
pleurotoid with decurrent lamellae, a gelatinous epicutis, and forked lamellae which
are unique in this genus complex. Dried specimens of all species except P. serotinus
rehydrated with wet paper towels for several hours to overnight. The whole basidioma
of P. mitis becomes very gelatinous when rehydrated. Uniquely, when basidimata of
P. longinquus are rehydrated and revived, they turn to greenish black color.
Panellus stypticus spores are somewhat allantoid, with a relatively weak
amyloid reaction. Cystidia contained or are associated with apparently excreted “oil”
droplets. In D. pusillus, similar oil droplets are observed within and associated with
cystidia. Dendritic cheilocystidia, densely packed at lamella margins, together with
relative short embedded clavate cheilocystidia (gloeocystidia) (Corner 1986) are
present in both species. In P. mitis, lamella margins are characteristic in that interior
hyphae become divergent and gelatinous, forming a swollen margin in which
divergent hymenial hyphae formed. Cheilocystidia are absent. In P. serotinus,
basidiomata of one collection have thick-walled, stout, metulloid pleurocystidia, and
the other collection lacks pleurocystidia. In P. ringens, pleurocystidia are short,
clavate and thick-walled; cheilocystidia are inconspicuous and difficult to find.
Extended clavate hymenial cells are present. In one collection of P. ringens, no
spores were found, consistent with Miller’s (1970) observation that spores in this
species are sparse. In P. violaceofulvus, both pleurocystidia and cheilocystidia are
short, clavate and thick-walled: spores are allantoid, phaseoliform. In exemplar
collection DAOM198753 (M = 5.57 X 2.56 um), spores are a little bigger than those
of P. ringens exemplar 6711 (M = 4.58 X 1.89 um). In P. patellaris, both
15
pleurocystidia and cheilocystidia are conspicuously clavate and thick-walled. In P.
longinquus, spores are large (M = 5.37-6.76 X 3.14-3.54 tm) and thick-walled.
Forty-six most parsimonious trees were obtained from analysis of
morphological characters treating gaps as a fifth character. There was no difference in
topology when gaps were treated as missing data. A 50% majority consensus tree is
shown in Fig. 1. Unexpectedly, Panellus ringens and P. violaceofulvus grouped
together. Panellus stypticus and D. pusillus formed a well-supported clade.
Remaining taxa formed separate clades.
The Ribosomal LSU Group I intron: Electrophoresis of nLSU PCR products
showed that DNA fragments for P. stypticus and D. pusillus were longer than those for
the other six species (Jin, 2000). When sequences of P. stypticus [collections 4319
(Maggia, Switzerland) and 3541 (New South Wales, Australia)] and D. pusillus
[collection 8265 (FL, USA)] were aligned with sequences of other species in this
study, a ca 400 bp insertion was found, at a position corresponding to yeast LSU base
931 (Bayev et al 1981). The insertion was identified as a Group I intron by homology
to Group I intron sequences in GenBank. The P. stypticus collection 4319 intron was
67.95% homologous to a Group I intron identified in a P. stypticus ribosomal SSU
sequence (GenBank No. PSU59090; Hibbett 1996). In contrast, P. stypticus
collections 4319 (Switzerland) and 3541 (Australia) introns were 97% homologous,
and P. stypticus introns were 83-84% homologous to the D. pusillus intron.
The nLSU fragment length was used as an indicator of Group I intron
presence. In P. stypticus, 75 of 76 Northern Hemisphere collections representing
Eastern North America, Pacific North America, the Far East and Europe were ca. 1700
bp in length, suggesting intron presence (Jin, 2000). Only one collection in Eastern
North America was heterozygous for the intron, showing two nLSU bands at ca. 1300
and 1700. In the Southern Hemisphere, six P. stypticus collections from New Zealand
and three collections from Tasmania (Australia) lacked the nLSU intron, while the 3
collections from Australia (New South Wales) harbored the intron (Jin et al., 2001). In
D. pusillus, the nLSU length of eight collections was ca. 1700 bp, but one collection
8733 from Mexico was heterozygous. The nLSU DNAs of six additional collections
of Dictyopanus sp. were ca. 1700 bp long (Jin 2000). Three collections of P. mitis,
three collections of P. serotinus, P. ringens exemplar 6711, P. violaceofulvus
exemplar CBS391.50, and P. longinquus exemplar 6662 were all ca. 1300 bp, and
lacked the intron.
Phylogenetic reconstruction of the Panellus complex based on nLSU sequences:
Parsimony analysis produced two most parsimonious trees treating gaps as a fifth
character. The two trees differed in the relative positions of Mycena rutilanthiformis
and M. clavicularis. Topology of the remaining taxa remained unchanged. Topology
of the taxa was unchanged when gaps were treated as missing data A bootstrap 50%
majority rule consensus tree is shown in Fig. 2. The three Mycena species together
with Resinomycena acadiensis, clustered with the P. stypticus / D. pusillus clade.
Panellus ringens, P. violaceofulvus and Pleurotopsis longinquus formed a well-
supported clade. P. patellaris and P. serotinus appeared on long branches but their
relative positions were poorly supported. Unexpectedly, a sequence deposited as
16
4319 P. stypticus
6517 P. stypticus
8265 D. pusillus
9803 D. pusillus
95
9522 D. pusillus
9408 D. pusillus
m= 9808 D. pusillus
94 7494 P. mitis
60 5644 P. mitis
7486 P. mitts
36 ( 6894 P. serotinus
9992 P. serotinus
6711 P. ringens
28 DAOM 198753 P. violaceofulvus
aE 9812 P. ringens
94
94 | 6170 P. patellaris
6486 P. patellaris
94 | 9562 P. longinguus ai
6663 P. longinguus
Fig. 1. A 50% majority-rule consensus tree based on morphological characters. Numbers
indicate bootstrap support for the clade to the right of the node. All characters (20) were
parsimony-informative. Tree length = 51. Consistency index = 0.67. Homoplasy index = 0.33
Resinomycena acadiensis AF042638
Dicyopanus pusililus AY 014291
Panellus stypticus AY 014292
Mycena galericulata AF042636
Mycena rutilanthiformis AF042606
Mycena clavicularis AF042637
Panellus mitis AY 014288
Panellus serotinus AY 014287
Hyegrocybe citrinopallida U66435
Panellus ringens AY 014290
Panellus violaceofulvus AF325361
Panellus tonginguus AY 014289
70" Panellus longinquus AF042604
Panellus patellaris AY 014286
Fig. 2. A 50% majority-rule consensus tree based on 5’- partial LSU of ribosomal DNA
sequences. Numbers indicate bootstrap support for the clade to the right of the node. Ejighty-
seven characters were parsimony informative. Tree length = 254. Consistency index = 0.772.
Homoplasy index = 0.28. Collections AF042638, af042636, AF042606, AF042637, U66435 and
AF042604 are from Moncalvo et al. (2000). For other collections, see Table 1.
17
Hygrocybe citrinopallida was nested between a clade consisting of P. patellaris and
P. serotinus and a clade consisting of Panellus ringens, P. violaceofulvus and P.
longinguus.
It is obvious that the current genus Panellus, with or without P. patellaris
and P. longinquus included, is polyphyletic. Panellus violaceofulvus CBS391.50 is
remarkably similar to P. longinquus (1 bp difference). Panellus violaceofulvus
CBS391.50 was received as a culture from CBS collection, however, and is not
anchored by a herbarium specimen. We thus cannot vouch for a correct identification.
DISCUSSION
Circumscription of the genus Panellus — recommendations: Panellus has been
circumscribed in a number of different ways by previous researchers. The genus was
established with only two characters, lateral stipe attachment and elliptical spores
(Karsten 1879). However, the spores of P. stypticus are primarily phaseoliform to
allantoid based on observation of world-wide collections in this study (Jin 2000).
Burdsall and Miller (1975), in agreement with findings above, described spores
of Panellus (including Dictyopanus, P. mitis, P. patellaris, P. serotinus, P. ringens,
and P. violaceofulvus) as “allantoid, oblong, ovoid to narrowly ovoid, smooth, hyaline,
amyloid in Melzer’s reagent.” Basidiomata of P. ringens, P. patellaris.and P.
violaceofulvus are sessile, pendent, eccentrically attached to substrate, and are
nonpanelloid. Clearly, those three species do not possess the character of lateral stipe
attachment, which was established for the genus by Karsten (1879). Further, in P.
patellaris, a membranous veil exists in young basidiomata, unique in this group, and
was the basis for describing Tectella as a segregate monotypic genus (Earle 1909).
Miller (1984) noted that Panellus was easily separated from other pleurotoid genera
such as Pleurotus, Panus, Cheimonophyllum, Pleurocybella, Hohenbuehelia and
Resupinatus in that the spores of the genus were amyloid in addition to elliptical and
smooth.
The unexpected grouping of P. ringens, P. violaceofulvus and P. longinquus in
the molecular analysis raised some interesting questions, since the culture used for
LSU sequencing representing P. violaceofulvus was not anchored with a herbarium
specimen. If the culture truly is P. violaceofulvus, then there is a remarkable
morphological divergence between P. longinquus and P. violaceofulvus but little
change in the LSU sequence. Alternately, the culture could represent P. longinquus
but P. longinquus basidiomata have a gelatinous pileocutis, decurrent lamellae, and
turn greenish black when rehydrated. This is quite different from sessile, pendent
basidiomata of P. violaceofulvus. Further, P. longinquus is known from Australia,
New Zealand and New Guinea (Horak, 1983), Pacific North America (Libonati-
Barnes and Redhead 1984), and also from the Pacific coast of South America
(Petersen and McCleneghan 1995, 1997). It is not known from Europe and this CBS
collection from France would be an unexpected range extension.
Vilgalys and Hibbett (1991) stated that a genus should be based on monophyly
and emphasized evolutionary history. In the Panellus complex, only the P. stypticus
18
and D. pusillus clade and the P. ringens, P. violaceofulvus and P. longinquus clade
formed well-supported monophyletic groups. Panellus mitis, P. patellaris, P.
serotinus formed monotypic clades.
Based on the above results, Panellus should include P. stypticus and D.
pusillus only, with the other Panellus species assigned to separate genera. Under this
concept, the genus Panellus could be defined morphologically as having panelloid
stature, a lateral stipitate pileus and smooth amyloid spores. Probably, additional
intersterility groups exist within poroid Dictyopanus (Corner 1986) and, pending
further studies, these may also belong to this clade.
The presence of a Group I intron in both Dictyopanus and Panellus stypticus
with a high level of homology supports the close relationship between these two
groups (Burdsall and Miller 1975, 1978) and suggests that the intron was present in
ancestral taxa prior to the separation of Dictyopanus and Panellus. These two genera
clearly are in the same clade, supported by shared morphological characters, sequence
similarity and presence of anLSU Group | intron. Panellus, based on P. stypticus as
type species, must be used for the Panellus stypticus / Dictyopanus pusillus clade,
which may include additional poroid species.
Most of the remaining species in the Panellus complex have received separate
generic placement: 1) Pleurotopsis (P. Henn.) Earle (1909) was an elevation of
Marasmius subg. Pleurotopsis P. Henn. [type species: PI. spodoleucus (Berk.) Earle].
Horak (1983) transferred Panellus longinquus into Pleurotopsis;, 2) Karsten (1891)
proposed the genus Sarcomyxa [type species: S. serotina (Fr.) Karst.; = Agaricus
serotinus Fr.],; and 3) Earle (1909) proposed the monotypic genus Tectella [type
species: 7. operculatus (B. & C.) Earle; = Panus operculatus B. & C.; = T. patellaris
(Fr.) Murrill, teste Singer (1975)]. Tectella was separated on presence of non-amyloid
spores, pseudostipitate stature, and presence of a veil in early stage of basidiome
development. [Note, however that Miller finds 7. patellaris spores to be weakly
amyloid O. Miller, pers. comm. |]
Our results support these segregate genera. Pleurotopsis for Pleurotopsis
longinqua — Panellus ringens clade, Tectella for Tectella patellaris, Sarcomyxa for
P. serotinus. The transfer of Pleurotopsis longinqua from Panellus is warranted,
based on the genetic distance between the P. stypticus / D. pusilus clade but would
require an additional transfer of P. ringens to maintain the coherence of this clade. The
position of P. violaceofulvus is suspect and requires more evidence from additional
morphological examination and DNA sequences. Tectella patellaris has already been
assigned a separate generic designation (Earle 1909). Panellus serotinus are well-
separated from either of the terminal clades and probably requires separate generic
assignment. Karsten’s (1891) genus Sarcomyxa is typified by P. serotinus would be
the correct name. We suggest that if a generic rank for P. mitis is advisable, Mitellus,
elevated from subgenus status (Burdsall and Miller 1975, 1978), would be an
appropriate name. Pending additional research, this name is not formally proposed
here.
19
Lamellate and poroid hymenium — implications: Basidiomycetes or basidiomycota are
basically divided as Agaricales versus Aphyllophorales (sensu Fries), or Agaricaceae /
Boletaceae versus Polyporaceae sensu Smith (1949). Lamellate versus poroid
hymenphores are typical characters that would dictate placement in an order or family.
Pegler (1983) suggested that the pleurotoid genera Lentinus, Pleurotus and Panus
were derived from polyporoid ancestry (i.e., that pleurotoid fungi and Agaricales were
convergent in the evolution of lamellate hymenophore structure). Conversely, Corner
(1981) considered that monomitic hyphal structure was primitive and thus proposed an
alternate phylogeny in which Panus, Pleurotus and Lentinus were a basal, paraphyletic
group from which the Agaricales and Polyporaceae evolved. Hibbett and co-workers
(Hibbett et al. 1997; Hibbett and Thorn 2001; Hibbett and Vilgalys 1991) placed Panellus
and Pleurotus in the euagarics, and Panus and Lentinus in the polyporoid clade. Thom et
al. (2000), based on molecular data, further concluded that Pleurotus and Hohenbuehelia
formed a monophyletic clade within the agaricales.
In the Panellus complex, a phylogeny based on the 5’-partial LSU gene
revealed that P. stypticus and D. pusillus were nested in Mycena and Resinomycena
clades. Hygrocybe was nested between a clade consisting of P. mitis, S. serotinus,
- Tectella patellaris and P. ringens and a clade consisting of P. violaceofulvus and
Pleurotopsis longinqua. Thus, lamellate and poroid species, pleurotoid and
nonpleurotoid genera are nested together. These results indicate that divergence of
poroid and lamellate hymenophores has occurred repeatedly and often. Since poroid
D. pusillus was nested within lamellate Mycena and Resinomycena clades, the poroid
hymenium of Dictyopanus may be a derived character.
Inclusion of "panelloid" basidiome stature in a clade with distinctly centrally
stipitate agaricoid stature (Mycena, Resinomycena) also suggests that basidiome
stature is not plesiomorphic, but repeatedly derived. Considering the large number of
taxa generally accepted in Mycena, it could be concluded that the "panelloid" stature is
a derived state, perhaps linked to horizontal position on rotting wood, in which a long
stipe as support for a pileus could be counter-productive. The other major clade of
putative Panellus species (P. ringens, etc.) includes uniformly laterally to
pseudostipitate basidiomata, and cannot be subjected to equal conjecture.
Considering other disparate groups of lamellate basidiomata in which presence
or absence of stipe, and orientation and stature of the stipe appear to be repeatedly
derived characters (i.e. Pleurotus albidus - P. djamor, Lentinellus omphalodes - L.
ursinus, Paxillus vs. Tapinella, Phylloporus vs. Boletaceae, etc.), the situation in the
Panellus complex is not unique, but because our analysis includes phenetic and
molecular phylogenetic reconstructions, we think the point is worth emphasizing.
ACKNOWLEDGEMENTS
We express our sincere gratitude to Dr Nils Hallenberg of The University of Goteborg,
Sweden for translating Karsten’s work into English. We are also indebted to Dr. Scott
Redhead of Eastern Cereal and Oilseed Research Center, Canada, for providing a
20
specimen of Panellus violaceofulvus and to Dr. Orson Miller for reviewing the
manuscript.
LITERATURE CITED
Bayev A, Georgiev OI, Hadjiolov AA, Nikolaev N, Skryabin KG, Zakharyev VM.
1981. The structure of the yeast ribosomal RNA genes. 3. Precise mapping
of the 18s and 25s rRNA genes and structure of the adjacent regions.
Nucleic Acids Research 9: 789-799.
Burdsall BH, Miller OK. 1975. A reevaluation of Panellus and Dictyopanus
(Agaricales). Beih. Nova Hedwigia 51: 79-91.
Burdsall BH, Miller OK. 1978. Notes on the genus Panellus. Mycotaxon 7: 511-514.
Corner EJH. 1981. The agaric genera Lentinus, Panus, and Pleurotus with particular
reference to Malaysian species. Beih Nova Hedwigia 69: 1-169.
Corner EJH. 1986. The Agaric genus Panellus Karst. (including Dictyopanus Pat.) in
Malaysia. Gard Bull Sing 39: 103-147.
Earle FS. 1909. The genera of the North American gill fungi. Bulletin of New York
Botanical Garden 5: 373.
GCG. 1997. Genetics Computer Group. Version 9.1. Oxford Molecular Group, Inc.
Hibbett DS. 1996. Phylogenetic evidence for horizontal transmission of group I introns
in the nuclear ribosomal DNA of mushroom-forming fungi. Mol Biol Evol
13: 903-917.
Hibbett DS, Donoghue MJ. 1995. Progress toward a phylogenetic classification of the
Polyporaceae through parsimony analyses of mitochondrial ribosomal DNA
sequences. Can J Bot 73: S853-S861.
Hibbett DS, Pine EM, Langer EE, Langer G, Donoghue MJ. 1997. Evolution of giiled
mushrooms and puffballs inferred from ribosomal DNA sequences. Proc
Nat Acad Sci USA 94: 12002-12006.
Hibbett DS, Thorn RG. 2001. Basidiomycota: Homobasidiomycetes. Pp 121-168. in,
McLaughlin D, McLaughlin E, Lemke P Eds. The Mycota Part B.
Systematics and Evolution. Springer-Verlag Berlin, Heidelberg.
Hibbett DS, Vilgalys R. 1991. Evolutionary relationships of Lentinus to the
Polyporaceae: evidence from restriction analysis of enzymatically amplified
ribosomal DNA. Mycologia 83: 425-439.
Horak E. 1983. Mycogeography in the South Pacific region: Agaricales, Boletales.
Austral J Bot Suppl Ser 10: 1-41.
Hughes KW, McGhee LL, Methven AS, J. Johnson, Petersen RH. 1999. Patterns of
geographic speciation in the genus Flammulina based on sequences of the
ribosomal ITS1-5.8S-ITS2 area. Mycologia 91: 978-986.
Jin J-K. 2000. Studies in Panellus and the genus Panellus complex. Dissertation, the
University of Tennessee, Knoxville, p 201.
Jin J-K, Hughes KW, Petersen RH. 2001. Buiogeographical patterns in Panellus
stypticus. Mycologia 93: 308-315
Karsten PA. 1879. Rysslands, Finnlands och den Skandinaviska Halfons Halisvampar.
Finska Letteratur-Sallskapets Tryckeri, Helsinki 32: 1-255.
Karsten PA. 1891. Symbolae ad Mycologiam Fennicam. Societas pro Fauna et Flora
Fennica 18:61-68
21
Kihner R, Romagnesi H . 1953. Flore analytique des champignons superieurs. Masson
et Cie, Paris, 556pp.
Libonati-Barnes SD, Redhead SA. 1984. Panellus longinquus subsp. pacificus, anew
west coast North American agaric associated with red alder. Mycotaxon 20:
205-212.
Lutzoni FM. 1997. Phylogeny of lichen- and non lichen-forming omphalinoid
mushrooms and the utility of testing for combinability among multiple data
sets. Syst Biol 1997: 373-406.
Miller OK. 1970. The genus Panellus in North America. Michigan Bot 1970: 17--30.
Miller OK. 1984. New concepts in our understanding of Pleurotus, Hohenbuehelia
and their allies. Korean J Mycol 84: 189.
Moncalvo J-M, Lutzoni FM, Rehner SA, Johnson J, Vilgalys R. 2000. Phylogenetic
relationships of agaric fungi based on nuclear large subunit mnbosomal DNA
sequences. Syst Biol 49: 278-305.
Murnill WA. 1915. North American Flora 9: 201-296.
Page, R. D. M. 1996. TREEVIEW: An application to display phylogenetic trees on
personal computers. Computer Applications in the Biosciences 12: 357-358.
Pegler D. 1983. The genus Lentinus, a world monograph. Kew Bull 10: 1-281.
Petersen RH, McCleneghan SC. 1995. Mating systems of antipodal agarics: an
unreported taxon and range extensions. New Zealand J Bot 33: 93-98.
Petersen RH, McCleneghan SC. 1997. Reports on long-distance sexual compatibility
in Agaricales. Nordic J Bot 17: 419-432.
Singer R. 1975. The Agaricales in Modern Taxonomy. Edition III. J. Cramer, Chicago.
Singer R. 1986. The Agaricales in Modern taxonomy. Edition IV. Koeltz Scientific
Books, Koenigstein.
Smith A. 1949. Mushrooms in their Natural Habitats. Sawyer's Inc., Portland, p 626.
Swofford DL. 1996. PAUP 4.0. Phylogenetic analysis using parsimony, version d34.
Laboratory of Molecular Systematics, Smithsonian Institution, Washington
DC
Thorn GR, Moncalvo J-M, Reddy CA, Vilgalys R. 2000. Phylogenetic analyses and
the distribution of nematophagy support a monotypic Pleurotaceae within
the polyphyletic pleurotoid-lentinoid fungi. Mycologia 92:241-252.
Vilgalys R, Hibbett DS. 1991. Phylogenetic implications of generic concepts in fungal
taxonomy: the impact of molecular systematic studies. p 73-91. A Herbette
Symposium in Lausanne, Lausanne, France.
Vilgalys R, Sun BL. 1994. Assessment of species distributions in Pleurotus based on
trapping of airborne basidiospores. Mycologia 86: 270-274.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. p 315-322 in Innis MA,
Gelfand DH, Sninsky JJ, White TJ, eds. PCR Protocols, A Guide to Methods
and Applications. Academic Press, San Diego.
eae
: ms
a
rs rs pacts
Note rents
47) ney
ici
; wh iv ee
‘ - if Lvos “ ‘
as ne a i, + ni emai 2 ES w
| pete thal, 019 8 “aby son ee
waealy id -
A? Les iy aes i nang K piel
i A te Bee |e 4
Beare Fe
= al >b 3 '
' ih ’
on ian ld ‘.% i > ~~» * : ‘ ct . sith & Mow be
v beh ey Ayan pera e¥y ye Bes iad ‘ a i ate a 7
mt oareric (ks ian Meehan pies Ripe ianeg, Ss
: “ a tit ee AP 4 wi |"
bast (TRG 7 ae ae a om mh sien Ob RAED
ies TO fa nee Oe ee) i.
bh ake amit alls “venta cateaiinr: ween seit bad Ni Ree
aa esi’ og ve ee ad
‘at ta gare My at Mart . i i
‘ pre Th » . ats ‘ is
, Beene ate we: een i. i.
i i é
: 4g : : ‘ st be st
orn 4
y - .
: i oe UR >
f Phe wh am ie mn atu ia PM yh
ny ar
if lend : ened dy
4 ‘ha ; aye Mes nha wel
‘ Sle ft eae ih ey j ]
ni sheds Bene 7 dirs ays sabi ~
YY A 7 eo Ss 7 i ea
: Mm Ma a Cae vd 1
; ‘3? ‘ SP hi Mee IRAT LAP vit K BAbY anne iy, iu Fy rae
; hy a ‘s
Mei gat ME an Aas AT an 4 ah) es
Non " 1 : , ey ih , “ ug’ of etl i Ww? he ? oad
yey: fi oe seein Bike Bile eta oe |
) a oe ahi siieiae
aft ae
| ae
MYCOTAXON
Volume LXXIX, pp. 23-27 July-September 2001
TYPIFICATION OF HYPOGYMNIA HYPOTRYPA AND H. SINICA
Bruce McCune
Department of Botany and Plant Pathology, Oregon State University, Corvallis, OR
97331-2902 U.S. A. e-mail: mccuneb@bcc.orst.edu
Walter Obermayer
Institut fiir Botanik, Karl-Franzens-Universitat Graz, Holteigasse 6, A-8010 Graz,
Austria; e-mail: walter.obermayer@kfunigraz.ac.at
Abstract. Hypogymnia hypotrypella is reduced to synonymy with H. hypotrypa.
Hypogymnia flavida is described as a new species of lichenized fungi from east Asia,
the esorediate counterpart of H. hypotrypa. Hypogymnia sinica is resurrected from
synonymy with H. pseudohypotrypa.
Keywords. Ascomycota, Asia, Hypogymnia, lichens.
Examining the type material for Hypogymnia hypotrypa (herbarium BM) and H. sinica
(herbarium HMAS) revealed that both are sorediate, but neither had been recognized as such. This
resulted in a need for nomenclatural changes. Because the Hypogymnia hypotrypa group is so
conspicuous and frequently collected in eastern Asia, we chose to publish these results now, rather
than postponing the changes until more detailed studies of Asian Hypogymnia taxa are published.
Asahina (1950) segregated Parmelia hypotrypella as almost identical to Parmelia hypotrypa
Nyl. but sorediate. The type material of P. hypotrypa is, however, sorediate. Therefore H.
hypotrypella (Asahina) Rass. must be reduced to synonymy. No names are available for H.
hypotrypa (Nyl.) Rassad in the sense of Asahina, necessitating a new name. Hypogymnia flavida
McCune & Obermayer is thus described as a new species of lichenized fungi from east Asia. It is
characterized by the presence of usnic acid rather than atranorin, absence of isidia and soredia, dark
lobe cavities, large perforations in the lower surface, absence of physodic acid, and presence of
physodalic and protocetraric acids by TLC. It forms the fertile counterpart in a species pair with H.
hypotrypa. ) 3
Similarly, subtle soredia were previously overlooked on the type material of
Hypogymnia sinica J.C. Wei & J. M. Jiang. The result in this case, however, is resurrection of H.
sinica from synonymy with the esorediate species H. pseudohypotrypa (Asahina) A. Singh.
Hypogymnia sinica and H. pseudohypotrypa appear related to H. hypotrypa and H. flavida,
because of predominantly dichotomous branching, large perforations in the lower surface, dark
cavities, and broad blunt lobes, but contain atranorin and physodic acid instead of usnic and
physodalic acids.
Hypogymnia hypotrypa (Nyl.) Rass., Novosti sistematiki nizshikh rastenitui 1967:297. (Notul.
System. e Sect. Cryptog. Inst. Bot. nomine V. L. Komarovii Acad. Sci. URSS) 1967.
Parmelia hypotrypa Nyl., Synopsis Lich. 1:403. 1860.
Parmelia hypotrypella Asahina, Acta Phytotax. Geobot. 14:34. 1950.
Hypogymnia hypotrypella (Asahina) Rass., Bot. Mater. Otd. Sporov. Rast. Bot. Inst. Komarova
Akad. Nauk. S.S.S.R. 13:23. 1960.
The type material of Hypogymnia hypotrypa is sorediate. In BM are four specimens
mounted on a sheet and every specimen has small soredia, including one that Awasthi annotated as
lectotype in 1984 (see photo in Awasthi 1984). The label data match those on the specimen of H.
hypotrypa in H-NYL.
24
The specimen in H-NYL (No. 34197) is labeled "Parmelia hypotrypa Ny|l.
Himalaya, Sikkim, reg. alpina J. D. Hooker, K -" as in the original description. No collection
numbers are cited by Nylander. According to Orvo Vitikainen, the specimen “consists of three
fragments (ends of lobes, ca. 2 cm long pieces); two of them are non-sorediate, smooth above
and more or less brownish tanned, the third one looks paler and has a wrinkled and eroded-
sorediate upper side up to the lobe tips.” Because esorediate lobe tips are frequent, even in the
sorediate species, we conclude that all of this material probably belongs to the sorediate species,
in accordance with the lectotype and other specimens of Hooker’s collection from Sikkim in
BM.
Unfortunately this results in H. hypotrypella being a synonym of H. hypotrypa,
because H. hypotrypella was differentiated primarily on the basis of the presence of soredia. It
also means that the esorediate species needs a new name.
Awasthi (1984) correctly selected a lectotype from the general collection in BM
(derived from Hooker's collection), rather than one of the fragments in H-NYL, because the
original text of Nylander (Syn.Lich.403) says: "P. hypotrypa Nyl. in hb. Hooker." The material
from Hooker’s collection in BM and that in H-NYL represent the same taxon from the same
region (Sikkim), and are perhaps duplicates from the same collection.
Awasthi’s application of “H. hypotrypa” is ambiguous. Awasthi (1984, 1988) said
H. hypotrypa \acks soredia and isidia, but his lectotypification of H. hypotrypa is on clearly
sorediate material. Awasthi’s (2000) most recent list for India includes only H. hypotrypa.
Based on the available specimens, the sorediate species is much more common in India than the
esorediate species. So historically Awasthi correctly applied H. hypotrypa to the sorediate
material, even though his description stated that it is esorediate. Awasthi (1988) stated that H.
pseudohypotrypa is fertile and contains usnic acid, so it is probable that he applied this name to
H. flavida. Hypogymnia pseudohypotrypa, however, contains atranorin and not usnic acid
(Nuno 1964; see below).
Other authors (e.g. Rassadina 1960, 1967, 1971; Wei 1991; Nuno 1964) followed
Asahina (1950). They applied “H. hypotrypa” to the esorediate species and “H. hypotrypella”
to the sorediate species.
Sorediate (e.g. Kurokawa Lich.Rar.Crit.Exs. 223) and non-sorediate thalli of yellow
Asian Hypogymnia are mostly rather easy to separate. But sometimes the development of
soredia in H. hypotrypa is somewhat inhibited. Typically short, irregular cracks develop in the
upper cortex, then flakes of the cortex and algal layer begin to detach from the medulla. These
flakes are often marginally sorediate. Fertile specimens of H. hypotrypa are very rare (e.g.
Obermayer 6934).
The chemistry of both H. hypotrypa and its esorediate counterpart H. flavida (see
below) is fairly uniform, containing usnic and physodalic acids as major substances,
protocetraric acid as a minor substance, and 3-hydroxyphysodic acid as an infrequent accessory.
Other minor unknowns are present.
Hypogymnia hypotrypa has a broader geographic range than H. flavida. While H.
flavida is known from the Himalayas, SW China, and Taiwan (locations below), H. hypotrypa is
also known from Japan and Far East Russia.
HYPOGYMNIA FLAVIDA McCune & Obermayer, sp. nov. Fig. lA
Thallus laxe adnatus vel imbricatus, ad 20 cm latus; lobis linearibus, libris, flavidi
vel subviridibus, (1)3-6(10) mm latis; subtus niger, foraminibus magnis; sorediis isidiisque
destitutis; apothecia brunnea; sporae 4.5-6 x 4-4.5 um. Cortex K-, KC+ flavescens; medulla K-,
C-, KC-, P+ rubra.
Thallus loosely appressed to imbricate, to 20 cm or more broad or long, often
confluent into mats; texture cartilaginous; branching mostly isotomic dichotomous, budding
absent or rare; upper surface pale yellowish green, sometimes brownish toward the lobe tips,
often with transverse black stripes or mottles, smooth, epruinose; lobes separate, black border
sometimes visible from above; lobe profile even to + nodulose; lobe width (1)3-6(10) mm; lobe
width/height ratio 1-5; lobe tips often perforate, lower surface with conspicuous, large
perforations; medulla hollow, ceiling and floor of cavity dark brown to black except near the
lobe tips; soredia none, isidia none, lobules none.
25
flavida —
holotype
Hypogymnia sinica
holotype
FIGURE 1. A. Habit of type specimen of Hypogymnia flavida. B. Habit of type specimen of
Hypogymnia sinica.
26
Apothecia common, substipitate to stipitate, to 17 mm diameter or more; receptacle
urn-shaped; stipe hollow, without septum; disk brown to reddish brown, spores subspherical,
about 5.5 x 5.0 ym; hymenium about 27-30 um thick; epihymenium clear brown; subhymenium
5-12 um thick, of horizontally aligned hyphae, subtended by a hyaline, more parenchyma-like
tissue (hypothecium) 25-30 um thick, with scattered yellowish birefringent granules; pycnidia
(spermagonia) frequent, spermatia rod shaped to weakly bifusiform, 5.0-5.5 x 0.5-0.8 um.
Chemistry— Spot tests: cortex P-, K-, C-, KC+ yellow; medulla P+ orange-red, K-,
C-, KC-. Lichen substances by TLC: usnic and physodalic acid constant (major), protocetraric
acid constant (minor), 3-hydroxyphysodic acid infrequently present.
Type— CHINA: YUNNAN PROVINCE: Luquan County, Jiao Zi Mountains north of
Kunming, forest of Abies georgei and Rhododendron, upper slopes of mountain, 26° 06'N 102°
52'E, 3700 m, on Abies, September 2000, McCune 25622 (holotype, OSC; isotypes, CANB,
GZU, M, NY, UPS distributed in "Dupla Graecensia Lichenum").
Paratypes— CHINA. SICHUAN PROVINCE. Muli County: in monte Gibboh, 3550
m, Rock s.n., Crypt.exs. 3575 (LAM, US); Ludiang Co., Gongga Shan, Hai-luo-gou, 29° 25'N
101° 40'E, 2800 m, Wang L.-s. 16916 (HKAS); Xiangchen County, Da-xue Mt., 30° 30'N 101°
30'E, 3900 m, Wang L.-s. 2286 (HKAS). TIBET (XIZANG PROVINCE). Ri-dong, 28° 35'N 98°
10'E, 3500 m, Zang M. 10313 (HKAS); 40 km SW of Mainling, 29° 03'N 93° 56'E, 4000 m,
Obermayer 6109 (GZU); Nyaingentanglha Shan, 360 km E of Lhasa, bend of Tsangpo River,
29° 55'N 94° 52.5'E, 3350 m, Obermayer 7344 (GZU). YUNNAN PROVINCE. Lijiang, in
silvis montis Ndaza Ko, 4000 m, Rock, s.n., Zahlbruckner, Lich.Rar.Exs. 278b and 312 (US);
Yulong Shan Mts, 30 km E Lijiang, 4000 m, Sojak, s.n., Vézda, Lich.sel.Exs.2449 sub H.
hypotrypella (BM, US); NEPAL. Mewa Khola, path near Topke Thola, 3350 m, Norkett 9318
(BM). TAIWAN: Chiayi Co, Mt. Alishan, Wang- Yang s.n. (US); Hwalien Co. Mt.
Hohuanshan, 3200 m, on Abies, Yoshida 7000, Kashiwadani, Lich.Minus Cogn. Exs. 68 (BM,
US); Nantou Co., Mt. Morrison, Payun Hostel to the peak, 23° 56'N 120° 40'E, 3700 m, Lai
10426 (US).
Ecology and substrate— Hypogymnia flavida occurs on bark and wood, usually on
conifers, but frequently also on Rhododendron, less often on Quercus and other hardwoods,
occasional on mossy rocks. The species is found in mesic coniferous and Rhododendron forests,
mainly in the mountains of southwestern China.
Variation— Both H. flavida and H. hypotrypa are highly variable in thallus size and
lobe width and length. Hypogymnia flavida particularly has a broad morphological range. Some
specimens have very long, rather narrow, and sparsely branched lobes. This form also develops
black transverse stripes formed by the confluent pigmented areas associated with pycnidia
(spermagonia). Nylander named this "forma ba/teata" in reference to the black belts or stripes
(e.g. Obermayer 6025; Vezda, Lich.Sel.Exs. 115; Cryptog.Exs. Vindobon. 3575).
At the other extreme are specimens of H. flavida with rather broad, richly branched
thalli, often apotheciate (e.g. Vezda, Lich.Sel.Exs. 2449; Kashiwadani, Lich.Min.Cogn. 68).
Although one might regard these extremes as different taxa, intermediates are fairly common
(e.g. Obermayer 6118; 6024). Perhaps production of apothecia is developmentally linked to
broader lobes, but some specimens of “f. balteata" are fertile.
Hypogymnia sinica J.C. Wei & J. M. Jiang, Acta Phytotax. Sin. 18:386. 1980. Type in HMAS!
See discussion under H. pseudohypotrypa.
Hypogymnia pseudohypotrypa (Asahina) A. Singh Lichenol. Ind. Subcontinent 1966-1977.
Eco. Bot. Inform. Serv. Nat. Bot. Res. Inst. Lucknow 2. 1980. (Superfluous
combination later made by Wei, Enum. Lich. China p. 117. 1991.) :
Parmelia pseudohypotrypa Asahina apud Nuno, J. Jap. Bot. 39:99. 1964. Type presumably in
TNAS (not seen).
The type material of H. sinica has some small, poorly developed yet distinct soredia,
similar in form to those in H. hypotrypa. This was mentioned in protologue: “...interdum pro
Aa
parte corticibus fragilibus vel subsorediosis ...” Specimens of H. sinica collected in Yunnan by
Wang Li-song and the senior author have more clearly developed soredia. The presence of
soredia leads us to reject Wei's (1991) conclusion that H. sinica is a synonym of H.
pseudohypotrypa. The latter has abundant large apothecia, as shown in Nuno’s (1964) photo of
the type specimen. Hypogymnia sinica appears to be a good species, presently known from SW
China. The type of H. sinica has atranorin and physodic acid.
Unfortunately we have not seen the type for H. pseudohypotrypa. Nuno (1964) in the
original description of P. pseudohypotrypa said it contains atranorin and physodic acid, rather
than usnic and physodalic acids. Inexplicably, Awasthi (1988, p. 236) stated usnic and
physodic acid as lichen substances for H. pseudohypotrypa, although Awasthi (1984) reported
atranorin and physodic acid.
Because of the confusion regarding H. pseudohypotrypa and H. sinica, the
distribution of these species remain uncertain. Further work delimiting H. pseudohypotrypa
from other esorediate species in southern Asia is needed.
Hypogymnia sinica, on the other hand, is easily distinguished from other
Hypogymnia species except for H. pseudophysodes. The form of the soralia is similar in H.
sinica and H. pseudophysodes, but the latter has narrower lobes (typically 1-2 mm vs. 2-5 mm
for H. sinica) with tapered lobe tips, and is distributed mainly in northeastern Asia.
ACKNOWLEDGMENTS
We thank Orvo Vitikainen for checking the Nylander herbarium in Helsinki for us.
The curators of BM, H, HKAS, HMAS, LAM, and US kindly cooperated with our studies.
Thanks to Theodore Esslinger and Svetlana Tchabanenko for comments on the manuscript.
Christian Scheuer assisted with the Latin. Special thanks to Wang Li-song for facilitating field
work and Wei Jiang-chun for lending Chinese type specimens. An expedition of the second
author to SE-Tibet in 1994 was supported by the Austrian Science Fund, Project Number
P09663-BI0.
LITERATURE CITED
Asahina, Y. 1950. Lichenes Japoniae novae vel minus cognitae. Acta Phytotax. Geobot. 14: 33-
Bo:
Awasthi, D. D. 1984. The lichen genera Hypogymnia and Menegazzia from India and Nepal.
Kavaka 12(2): 87-97.
Awasthi, D. D. 1988. A key to the macrolichens of India and Nepal. J. Hattori Bot. Lab. 65:
207-302.
Awasthi, D. D. 2000. A Hand Book of Lichens. Bishen Singh Mahendra Pal Singh, Dehra Dun,
India.
Nuno, M. 1964. Chemism of Parmelia subgenus Hypogymnia Nyl. J. Jap. Bot. 39: 97-103.
Rassadina, K. A. 1960. Species Parmeliae et Hypogymniae URSS novae et curiosae. Bot.
Mater. Otd. Sporov. Rast. Bot. Inst. Komarova Akad. Nauk. S.S.S.R. 13: 20-25.
Rassadina, K. A. 1967. Species et formae Hypogymniae novae et curiosae. Novosti Sist. Nizsh.
Rast. [Novitates Systematicae Plantarum non Vascularium. Acad. Sci. URSS, Inst. Bot.
nomine V. L. Komarovii] [Leningrad] 1967: 289-300.
Rassadina, K. A. 1971. Hypogymnia, pp. 285-301. In E. G. Kopaczevskaja, M. F. Makarevicz,
A. N. Oxner, & K. A. Rassadina, Handbook of the Lichens of the U.S.S.R. 1.
Pertusariaceae, Lecanoraceae and Parmeliaceae. Nauka. Leningrad.
Wei, J.-c. and Y.-m. Jiang. 1980. [Species novae lichenum e Parmeliaceis in regione
xizangensi]. Acta Phytotax. Sin. 18(3): 386-388.
Wei, J.-c. 1991. An Enumeration of Lichens in China. International Academic Publishers,
Beijing.
| Pera n! a
Nyy a ; Mi yA cg nid ine La
ite mu it ay nes a ‘i
ove .
‘ <3 : .
yi ¥- 9 tke a et
4 an | 1 Py
eee bol sh ae nage
af Eat: ied oak a He She Hy PS eae es | .
Wi Aga! A 5 “aH ae , " fy mes tins a uh y nt vr
a) } \ i us "y ae ay bi Perey Z, i] pote 7 en a AG “ et i bi
--@ J Ae.
hi aaah aynyasenly, wil het, Hie ye Mheva ei abt a
| ee ae raha Lin Ree ie A batt ee whe tape af by ay oar, (it Giaiy ol a fe fe "
1 a aye - } rs as
Pe me i ‘aes or prin teey ries reteset oh iNRNBIE ! 5 OF
vi Are ays ay % ae te ea gas hal a fe, fen ae ae AOA ae np =p *
1 er ; Epes ay tits SW full eal) Ny), ae ee ah a } paw one iy eG. pres ie § i
¥ x + a ¢ vee a ( ¥ ; A 9s oe wy é a) bie te; ey *
it iaae ia ‘spies a i aes af es a ue an Me yee ie 4 ie ban Sasa p ier ud g. Bl nae i are
SN tw Cha Mahe hulp a Re He BANU Hy 88
Wier ak A) ae Ep of a :
Pty e< cs ; : re ey
af f 1 | | i ; v) .. a ce ™ 4 a> > 7, Pa) ri ah Li a igs A hi Aiea it
AAS AL TS PAL Sad Maer Le, oa mii it dais oa Ya eae a ‘at ~—' iaty ie) Oe AS kOe a
. ratte ag i hie ai uaa it Wee :
OE er Nee a | ; ¥ Y Ants i we 2 eT a ae ab ' ,° “
ae Uy v, a aay ra ‘ad te We BA hl ; hae We + i; ure ¥: tae Late, pe st py * on ea ate my GY aoe Seat Me
' Ls iw oye ie dur I aN Bh A $ se "i ‘as ' enh ee 7 J
' em £ oe? ) ( . dna cs 2 we ah egehine +6 Het at © ts ps Shy seit ee a i +) ‘aie gpa SKA 7 ne ‘ srdieah lie 7 ae _
an ae my si Avan ee sik Rs pons ans 8 Ae ey ae O70 Mere. Vs Berwin & \ “une ee ae
Aare j k -f ¥ \ 1}
2 NCS Naa ie Asal ‘aie ile sel iene iain naper ith at. Won) ae sais hae inser LES ip
A | Ply ‘i 43 soi Ny Why pha Nits ‘ ree yay hy nd eo ty ta, iC Toe iy ca Me sg - Pon ese oe iv. . one ¥ -
ia ee reoery ra at srt paar OS igo ech aorta teat Sekt we (Mine oa i ey
i
stig aaa MAREN SRG Bude ical NBC at Oe AMOI IE Sn 12
? ‘ ed Ant te pre Aue vd y wily il peat Dp pat eget pene andi, Ly nea ahs it} fn wie. bi 7 ‘ak
NAiaA sit Soot use Pit otate lead ae AN! ae Sra 4 as jamity ae ee thi
Hs Se api a a ana pty, ey ewe ened Ai apical aera aa meer siacndd * s) ne Ady
: ays): ' cere on Fiee una —- tid ey Hae eee ie TCAs WA ery hae site i geomet a
pi ah f: ” Ape al : , vey eR hes 23 tus ve Peat Ascii Perea tee so) hey ret aM? ee y iT ae ee teh
*) 7 ree pine = A. ee ae ate Bike Nene duh Wes AND So Sion po geh asain Previa ye eden aie nd : piieenlh Z aa a
Auer a bhi esl " om etl ‘onatadlneniny ees iohcshohal aeegae ain | Rotate ets tees
eeeia i) nee * sa fadigeny A NY CR Se: bets aaah nee SEN ANS id | Sly biter nea Nin as
5 ON Sppatead Ne pide shat AGA Ele et Dicey pain ri a
ESN RY ee sl er ee a Ue ; ot } hag eh
| PMA a ine Si) Wik 9 aber
| nies “i Bid pee ae pipe ae ,
| ik cat Care ae
i sie i pti
Oe ae
MYCOTAXON
Volume LXXIX, pp. 29-41 July-September 2001
CALOPLACA NASHITI SP. NOV.
(TELOSCHISTACEAE, LICHENES), A NORTH-
AMERICAN SPECIES OF THE C. LACTEA-GROUP
GROWING IN CALICHE
P. Navarro-Rosinés*, E. Gaya* and N.L. Hladun*
* Departament de Biologia vegetal (Botanica), Facultat de Biologia,
Universitat de Barcelona, Diagonal 645, E—08028 BARCELONA.
E-mail adress : pnavarro@porthos.bio.ub.es
Abstract : Description is provided of Caloplaca nashii sp. nov., a
saxicolous-calcicolous lichen growing on caliche in arid regions of Baja
California (Mexico). It is related to the C. lactea group by its poorly
developed thallus, lacking anthraquinones, and spores with short wall
thickening (isthmus) less than 3 pm. However, it differs from the known
species of this group by having shorter and narrower ellipsoid spores,
(10)11.5-16(19.5) x (4)4.5-6 pm. Caloplaca lactea var. americana is
considered as a probable synonym of C. holocarpa.
Key words: Caloplaca, taxonomy, new species, Baja California, Mexico.
Resumen: Descripcion de Caloplaca nashii sp. nov., un liquen saxicolo-
calcicola que crece sobre caliche en las zonas aridas de Baja California
(Mexico). C. mashii) por'tener el talo escasamente desarrolado, sin
antraquinonas, y esporas provistas de un engrosamiento ecuatorial de la
_ pared corto, de menos de 3 pm, esta relacionada con las especies del grupo
de C. lactea, pero se diferencia de las especies conocidas de este grupo por
tener esporas cortas y mas eschechamente elipsoidales, de (10)11,5-
16(19,5) x (4)4,5-6 pm. Caloplaca lactea var. americana es considerada un
posible sinonimo de C. holocarpa.
Palabras clave: Caloplaca, taxonomia, especie nueva, Baja California,
México.
30
Resumo : Priskribo de Caloplaca nashii sp. nov., petrologa likeno, kiu
keskas sur malgrandaj kalkStonoj (“caliche”) de la dezertaj regionoj de
Malalta Kalifornio (Meksikio). C. nashii parencas al la specioj de la grupo de
C. lactea pro talo malbone videbla, senantrakinona, kaj sporoj kun ekvatora
dikajo mallonga (nur gis 3 pm), sed bone diferencas de la konataj specioj de
tiu grupo pro mallongaj sporoj, pli maldike elipsoidaj, nur (10)11,5-
16(19,5) x (4)4,5-6 pm. Rimarko pri Caloplaca lactea var. americana, ebla
sinonimo de C. holocarpa .
Slosilvortoj: Caloplaca, taksonomio, nova specio, Malalta Kalifornio,
Meksiko.
Introduction
During the field trip to the Sonora and Baja California deserts
(Mexico), organized by Professor T. H. Nash III in February 1993, the
first author collected from different localities lichens growing on slabs
or small carbonated pebbles, which were result of the alteration of
calcium carbonate zones (caliche). Caliche is a term applied in SW
U.S.A. to a calcareus material of a secondary accumulation, commonly
found in layers on or near the surface of stony soils of arid and semi-
arid regions. It is composed largely of crusts of soluble calcium salts in
addition to such material as gravel, sand, silt and clay. The cementing
material is essentially calcium carbonate (BATES & JACKSON 1987).
Among those lichens there was a Caloplaca characterized by an
inapparent or poorly developed thallus and spores with a very reduced
equatorial wall thickening, less than 3 pm wide, that was related to the
taxa of the C. lactea group. However, it did not match to any of the
treated species in the review of this group (NAVARRO-ROSINES & HLADUN
1996). After consulting the main bibliography referred to this genera in
North America (Arup 1992 a-b, 1993 a-b, 1994, 1995 a-b, 1997, 1998;
KARNEFELT 1998; Nimis et al. 1994; WEBER 1989; WETMORE 1994, 1996,
1999; WETMORE & KARNEFELT 1998, 1999), and the most important keys
based on Caloplaca (CLAUZADE & Roux 1985, EGEA 1984, HANSEN et al.
1987, LAUNDON in Purvis et al. 1992, Nimis 1992, PoELT 1969, POELT &
HINTEREGGER 1993, RYAN 1998, WaDE 1965), we considered that the
studied Caloplaca belongs to a hitherto unpublished species.
The new taxon is named in honour of Professor Thomas H. Nash III
(Arizona State University, Phoenix), lichenologist who, in order to
promote the study of lichens from the arid regions of western North
America, organized several field trips.
Material and methods
In order to study the different specimens of Caloplaca, hand-made
sections of the thallus and apothecia were examined with the light
microscope (up to xX 1000). These sections were mounted in water or,
to increase the contrast, in lactophenol-—cotton blue. All measurements
were made in water. In the spore size, the range (given in non-italics
and outside parenthesis) was calculated after rejecting 10% of the
highest and the lowest values. The averages are in italics, and the
extremes are given in parenthesis. A drawing tube fitted to the
microscope was used to make the drawings.
Caloplaca nashii Nav.-Ros., Gaya et Hladun sp. nov.
Thallus crustaceus, endolithicus aut parum epilithicus, parum vel
non distinctus, albidus vel albidus flavescens, K -. Alga
protococcoidea, cum cellulis 12-22 jum. Apothecia 0.2-0.4(0.5) mm,
aurantia, K+ (purpureum), primum in thallo immersa, deinde
sessilia ; discus primum concavus, deinde planus ; margo concolor
disco, primum crassa et eminens, deinde tenuis et parum eminens.
Epithecium bruneum aurantiacum, K+ (purpureum). Hymenium 70-
80 wm altum. Hypothecium sine colore. Parathecium cum cortice
epithecio simili et medula sine colore, prosoplectenchymaticum, clare
distincte radiantibus hyphis constitutum. Amphithecium in inferiore
apothecii parte minutum. Paraphyses clare septatae, non aut tantum
in summa parte ramosae, cum base 1.5-2 wm et summa parte 2.5-
4 um pm crassa. Asci (50)57-63 xX 10-13 um, typo familiae
Teloschistaceae, octospori, raro tetraspori. Ascosporae polariloculares,
hyalinae, longe ellipsoideae, (10)11.5-16(19.5) x (4)4.5—6 ym, cum
media densatione (1)1.5-2.5(3) wm longa.
Typus: México, Baja California Norte, 6 km north of El Rosario, along
route 1 to San Quintin, 30 7’ 0” N, 115 46’ 0” W, 300 m alt., carbonated
slabs and small stones of the ground (caliche), 23.11.1993, P. Navarro-
Rosinés (BCC-lich. 13459- Holotypus, 13460 to 13466- poe ASU,
~ GZU, MIN, MARSSJ, -Isotypi).
Description
Thallus endolithic, not or scarcely distinct, or crustose and in part
epilithic, granular or forming a thin, continuous thallus, rarely cracked
or weakly cracked areolate; mainly white but, in some specimens, it
can be slightly yellowish, K-. Photobiont protococcoid, with individual
52
globose, cells 12-22 ym diam.
Ascomata apothecia, 0.2-0.4(0.5) mm diam., abundant, scattered or
confluent in groups, crowded or even contiguous, orangish, K+
(purple), rounded, but deformed by mutual compression when
grouping, sessile at maturity, immersed in the thallus only at the
beginning. Disc orange, finely rugose, concave when young but
becoming flat when mature, with scarce concolorous pruina. Margin of
the same colour as disc, smooth, entire, at first somewhat thick and
prominent, becoming thinner and not prominent at maturity (at the
same level as disc).
Epihymenium brownish yellow, K+ (purple), with irregular surface,
7-10 pm thick.
Hymenium 70-80 pm thick, hyaline.
Subhymenium and hypothecium distinct from each other and
hyaline. The former thick, rich in oil droplets Ginspersed), the latter
thin, extending by the parathecium, with a structure intermediate
between para- and prosoplectenchymatous and rounded or somewhat
elongated cells, 2.5-5.5 * 1-2(2.5) pm diam.
Parathecium relatively thin, (40)60-100 pm _ thick,
prosoplectenchymatous, composed of radiating hyphae with elongated
cells, (5)7-13(16) x (0.5)1-2 um, with very narrow cell lumina. Only in
the outer zone, in contact with the pigmented area, showing more
distended cells, 2-4 ym thick.
Amphithecium hardly distinct, persisting on the basal part of
apothecia margin, where some packed algal cells are distinguished.
Paraphyses septate, not or scarcely branched, 1.5-2 m wide at the
base and 2.5-4 ym wide at the apices, with 1-2 apical cells covered with
anthraquinone crystals, K+ (purple).
Asci (50)57-63 x 10-13 um, clavate, of Theloschistes-type, 8-spored,
occasionally 4-spored.
Ascospores colourless, polarilocular, narrowly ellipsoid or faintly
cylindrical-fusiform, (10)11.5-73.716(19.5) x (4)4.5-5.0-6 ym, with an
equatorial wall thickening Gisthmus), (1)1.5-2.7-2.5(3) um wide, with a
length/width quotient: (1.7)2.2-2.8-3.5(3.9), and length/equatorial wall
thickening quotient: (4)5- 7. 1-10(17), (7 = 50).
Discussion and affinities
Caloplaca nashii belongs to the C. lactea group (Massal.) Zahlbr.
(NAVARRO-ROSINES & HLADUN 1996), with which it shares habitat and the
spore’s shape. Caloplaca lactea group includes taxa occurring on
calcareous rocks and it is characterized by spores with a short
33
20 um
Fig. 1. Caloplaca nashii. A.- cross-section of an apothecium, (semi-
schematic). B.- cross-section of a parathecium (LPCB).
35
equatorial wall thickening of less than 3 pm length. Amongst other
characters, C. nashii differs from the known species of the C. lactea
group (see Tab. 1) by having narrower spores.
C. nashii occurs on small calcareous stones situated on the ground,
This habitat is shared by some species of the C. lactea group, with
which C. nashii should be compared in more detail. These species are:
C. lactea (Massal.) Zahlbr., C. lacteoides Nav.-Ros. et Hladun and C.
marmorata (Bagl.) Jatta (NAVARRO-ROSINES & HLADUN 1996).
C.. lacteoides is characterized by its yellowish-toned apothecia, by
being the species of the group with the longest spores, which have a
long ellipsoid or subfusiform shape, and by having paraphyses tips
strongly capitated at the end of their development, with apical cells 5-9
ium wide. C. marmorata is easy to recognize by its reddish coloured
apothecia and by having abundant apically or subapically branched
paraphyses.
C. nashii is more closely related to C. lactea than the other species
mentioned due to its typical orange colour. However, both taxa are
readily distinguished by the shape as well as by the dimensions of the
spores. C. lactea has wider ellipsoid spores than C. nashii, with its 11-
14(16) x 6-8.5(9.5) pm.
The well-developed thalli of C. nashii may also look similar in habit
to those of C. navasiana, a Caloplaca from the C. velana-group which
grows on blocks or wide ledges of calcareous rock in the
Mediterranean littoral zone (NAVARRO-ROSINES & Roux 1994). In both
taxa the thallus is practically always lacking anthraquinones, with
white-ochre or very occasionally slightly yellowish tonality in some
part of the thallus. They are also characterized by orangish apothecia
and a faintly pruinose disc. These taxa clearly differ in their habitat and
in the characteristics of the spores, which in the case of C. navasiana
shows an equatorial wall-thickening that has a length of about 1/3 or
more of the spore.
Distribution and habitat
C. nashii is only known in the desert zones of the Baja California
region (Mexico), where it occurs on calcareous stones and rock slabs
situated on the ground. These stones are detached from the underlying
superficial deposit of carbonates (caliche).
The number of lichen species occurring upon these substrata is very
scarce, among them, the most abundant taxa is always C. nashii. It is
the only lichen able to developing on the smallest pebbles with a
diameter less than 3 cm. Other small thalli from other lichens grow
when the stones are bigger. Among these we identified: Buellia sequax
36
(Nyl.) Zahlbr., Lecanora crenulata (Dicks.) Hook., Lecania turicensis
(Hepp) Mull. Arg., Rinodina bischoffii (Hepp) Massal., Verrucaria
calciseda DC. and Verrucaria macrostoma Duf. ex DC. f. furfuracea B.
de Lesd. The latter is rarely fruited, but it is easily recognizable by the
small isidia occurring on the margin of the areoles.
A part from the lichens mentioned above, on these stones it has been
observed that the greater part of the substratum can be colonized by an
endolithic lichen which does not fruit. On its thallus occurs
Polycoccum opulentum (Th. Fr. et Almq.) Arnold, a lichenicolous
fungus which grows on endolithic thalli of diverse calcicolous
Verrucaria (NAVARRO-ROSINES & ROUX 1990). The presence of this
fungus makes us suppose that it may correspond to Verrucaria
calciseda.
Further, two lichenicolous fungi are located growing on Caloplaca
nashii: an Opegrapha of the rupestis-group, characterized by small
ascomata, and a new species of Lichenochora, described as L. epinashi
Nav.-Ros. et Etayo in other paper (NAVARRO-ROSINES & ETAyO, in press)
Additional specimens examined
¢ México: Baja California (N), 6 km N of El Rosarito along Hwy 1, on
top of mesa, 30° 7’ N, 115° 46’ W, 280 m alt., caliche, 23.I1.1993, C. M.
Wetmore 72361, 72363 and 72387 (MIN).
e México: Baja California (N), 13 km S of Rosarito in arroyo leading to
Oceane 283 5U 120 Nl 14033756) W225 mialt caliche sl; D@1998 5 Ge.
Wetmore 79795, 72363 and 72387 (MIN).
eMéxico: Baja California Sur, Santa Rosalia to Gerrero Negro,
Desierto de Vizcaino, Llano El Angel, N of San Ignacio, 3.5 km from
highway 1 along road to Punta Abreojos, 27° 15’ N, 113° 11’ W, 60-260
m alt., caliche, 21.11.1993, P. Navarro-Rosinés (BCC-lich. 13533-13540).
¢ México: Baja California Sur, La Paz to Constitucion, 76 km WNW of
LajPaz alonevroute he 24°o2 beNe 11 er LO LOumeaite. caltche-
17.11.1993, P. Navarro-Rosinés (BCC-lich. 13541).
Other taxa studied for comparison features
Caloplaca lactea var. americana B. de Lesdain
Annal. Cryptog. Exot. 5(2) :124 (1932)
Typus : USA, New Mexico, Las Vegas, Thunderbird Ranch, 1890 m alt.,
silic. rock, 04.11.1929, G. Arséne Brouard (US-68075) [lectotype selected
here]. —
The study of the typus of Caloplaca lactea var. americana B. de
37
win (G‘Z)e-L
win J-G'G(S) x (SZ) 2-91
WuoyIsny(qns)
JO piosdijja AjBuo|
paJods-g
‘wn OZ-91 x 02-09
@ win 6-S
‘gunyew UsUM syelideo AjHuos
ing ‘BunoA uayM ua|j|OMs jou
peo} Ajeues ‘Speyoueiqun
@ wn OL-9
‘yeAR| JeEUI9}XO OU} Ul PepuUNOI
‘rl Z x pL-OL(Z)
‘wed Jeuu! eu}
Ul S]]2O MOWeU pue peyeHuoje
‘yaAe] jeule]xe
snoyeuAyoue}oe|desed
e UlIM Inq ‘Wed JeUuuU!
eu} Ul SNoYeEWAYoUE}0e|dcsold
WNOZ | 0}
umojg UsiHueIO O} ‘SNOesYOO
MO|J@A ‘MOI|9A BUI|OHA
WW G'0-¢'0
Jae] YSiyyIM
uly} e HuUIWO} JO OIY}}OPUE
seploejoe| ‘9
wu €-2( 1)
win (8)2-S x (LZ)6L-S'EL (ZL)
plosdijje
__ peiods-g(p-2)
wn QZ-91 X O2-09
@ wn J-G
‘s]ja0 yeoide pebuelue p-|
snuEpunde
jeoideqns pue -jeolde
lun G-¢ x 6-9
‘SSOUYOIY] BJOUM 9u}
Ul OZIS JUBJSUOD UIIM S||8O
‘snoyewAyoue}09|dosoid
lurl OSZ-OS}
POJUOI]|IWWOA
JoysnJ ‘uMolg ysiBuelo
WW G°0-¢2'0
uoneijnues6 yeloyedns
SWOS Ajeses YIM JO ‘OlyOpUE
P]EJOWUJeCU OC)
wun (S'g)e-2(L)
wun (G‘6)S‘8-9 x (QL )HL-LL
PlosdijjaAjapim
poods-g
‘wn J |-EL x G9-SS
@ wn g oj} dn ‘pebiejue
Anubis Ajuo |ja0 yeoide
PSO}
Ajese1 esOW ‘peyoueiqun
@ wr s-¢ yim ‘pebsejue e10wW
S||9O JEUIO}X9 BUWOS YIM ING
‘wi (Z)G L-L x 6-9(S)
‘SSOUMOIU} SU} [IE Ul
QZIS JUCJSUOD F UIIM SI|9O
‘snoyewAyous}oe|dosoijd
‘wn OL L-O2
e6ueso
WW €°O0-1'O
uoneinuesb yeroledns
SWOS UUM JO OIY|OPUS
win (€)S'Z-G‘L(L)
WH g-G‘p(y) x (6L)9L-S'LL(OL)
jeoupul|Ao(qns)
Jo plosdijja AjmMouweu
pesods-g(r)
‘win €,-OL xX €9-29(0S)
@ wil p-c'z ‘pebie|
-ue Ajpsey JO 4OU |J99 yeolde
peyoueiqun
@ wl p-Z ym ‘pebie|
-U9 BJOW S|J9O [eEUIE}X9 UIIM
‘unl Z-1(S'0) x (QL)EL-2(S)
‘s]]a0 MOWeU PUue PeyeHuoje
‘snoyewAyous}99e|dosoid
‘wn OOL-09(0F)
a6bueso
WwW (S'0)7'0-2'0
S0eLINS
uo eyeINSsly 10 FEjnueIBH
Ajases JOU JO OIUj|OpUE
Bulueyo1y}
fem jeuoyenby
azIS
edeys
seliodsoosy
Burjjams jeoidy
Hulyouelg
seshydeled
ainjonds
SSOUYOIU |
wniosuyesed
INOJOD OSIq
JE}OWeIG
wunioeujody
snyfeuL
Table 1. The main distinguishing characters for the related species of
the Caloplaca lactea group growing on slabs or small carbonated
pebbles.
38
Lesdain (1932), revealed that this infraspecific taxon is not related to
the Caloplaca lactea group. The mature spores measure 12-73.0-14 x
6- 7.0-7.5(-8) pm, and show an equatorial wall thickening of 3.5-4.5 um,
which is approximately 1/3 of the length of the spore. Thus, this
equatorial wall thickening is longer than the maximum of 3 pm that
reach most of the species of the C. /actea group.
If we try to determine this specimen with the main Caloplaca keys
(see introduction), we find a number of characters that match with the
concept of Caloplaca holocarpa (Hoffm.) Wade, in the sense adopted
by CLAUZADE & Roux (1985) and WIRTH (1995). The main concordances
are in the size and features of the spores (as mentioned above), the
thallus nearly absent and, in the apothecia, the presence of a distinct
proper margin, concolorous with orange disc, and the thalline margin
scarcely apparent, reduced and located to the base of apothecia,
coloured in orangish grey or orangish green.
It should be pointed out that C. holocarpa is an unclear taxon which
has been regarded differently, as different authors indicate, e.g. NIMIs
(1993). Actually it seems that this taxon has become a jumble of
Fig. 3.- Caloplaca lactea var. americana. A.- Paraphyses.
B.- Ascospores (LPCB).
39
different things in many floras. Therefore, it has been included in C.
holocarpa both epiphytic and saxicolous specimens and, in the latter
case, calcicolous as well as silicicolous (see for example: PURVIS 1992,
CLAUZADE & Roux 1985, WADE 1965 and WIRTH 1995).
Acknowledgments.— The authors are grateful to C. M. WETMORE
(Minessota), C. Roux (Marseille) and X. LLIMONA (Barcelona) for critical
comments on the manuscript, to Th. H. NAsH III (Phoenix), for
organizing the lichenological expedition to Sonora and Baja California
(Mexico), and to the Herbarium of United States National Museum
(Washington) for placing at our disposal the tipe material of C. lactea
var. americana. This work was carried out within the project DGESIC
(PR96-1115. C04. 02), Spain.
References
Arup U. (1992 a) : Caloplaca marina and C. rosei, two difficult species
in North America. The Bryologist 95: 148-160.
Arup U. (1992 b) : Caloplaca stantonii sp. nov. and its relationship to
Caloplaca bolacina and other lobate to squamulose species in
North America. The Bryologist 95: 449-457.
Arup U. (1993 a) : Caloplaca luteominia and C. bolanderi in western
North America. The Bryologist 96: 463-470.
Arup U (1993 b) : Caloplaca flavogranulosa sp. nov. and C. citrina,
two sorediate species on seashore rocks in western North America.
The Bryologist 96: 598-603.
Arup U (1994) : The genus Caloplaca on seashore rocks in eastern
North America. The Bryologist 97: 377-392.
Arup U. (1995 a) : Eight species of Caloplaca in coastal western North
America. The Bryologist 98: 92-111.
Arup U. (1995 b) : Littoral species of Caloplaca in North America: a
summary and key. The Bryologist 98: 129-140.
Arup U (1998) : Correction of reports of two Caloplaca species from
North America. The Bryologist 100: 5106.
Bates R. L. & Jackson J. A., edit.1987) : Glossary of Geology. Third
Edition. American Geological Institut. Alexandria. Virginia. 788 p.
~ Bouly de Lesdain M. (1932) : Lichens de |’Etat de New Mexico (U.S.A.)
recueillis par le frére G. Arséne Brouard. Annal. Cryptog. Exot.
5(2) : 89-139.
Clauzade G. & C. Roux (1985) : Likenoj de Okcidenta Etrropo. Ilustrita
determinlibro. Bull. Soc:tbot.s Centre-Quest, nwspecs 7, SIB:G,.0.
édit., Royan, 893 + 2 p.
4()
Clauzade-Gi"& Ci _Rouxi(1937) @ Likeno) ,devOkcidentasEuropo,
Suplemento 2a. Bull. Soc. Bot. Centre-Ouest, nov. sér., 18 : 177-214.
Clauzade G. & Gr Roux (1989) = Likenoj ‘der Okcidenta Europo:
Suplemento 3a. Bull. Soc. Linn. Provence 40 : 73-110.
Egea J. M. (1984) : Contribucion al conocimiento del genero Caloplaca
Th. Fr. en Espafia: especies saxicolas. Collectanea Botanica 15:
173-204.
Hansen Eis spePoelt"& U? sechting (1987) “Diem rlechtensattung
Caloplaca in Gronland. Meddelelser om Gronland, Bioscience 25:
1-52
Karnefelt E. I. (1998) : Problems related to the marine lobate and
subfruticose species of Caloplaca. Folia Cryptog. Estonica 32: 27-
OD:
Navarro-Rosinés P. & J. Etayo Cin press) : Lichenochora epinashii sp.
nov. y L. sinapispermae sp. nov. (Phyllachorales, Ascomicetes), dos
nuevos hongos liquenicolas sobre Caloplaca. Cryptogamie,
Mycologie.
Navarro-Rosinés, P. & C. Roux (1993) : Caloplaca tavaresiana Nav.-
Ros. et Roux sp. nov., espéce nouvelle de lichen du littoral de la
région méditerranéenne. Nova Hedwigia 57 : 109-177.
Navarro-Rosinés P. & C. Roux (1994) : Caloplacetum tavaresianae
Roux et Nav.-Ros. ass. nov., une association lichénique saxicole-
calcicole, halophile. Nova Hedwigia 59 : 255-204.
Navarro-Rosinés P. & N. L. Hladun (1996) : Las especies saxicolo-
calcicolas del grupo de Caloplaca lactea (Teloschistales, liquenes)
en las regiones mediterranea y medioeuropea. Bull. Soc. Linn.
Provence 47 : 139-1060.
Nimis P. L. (1992) : Chiavi analitiche del genere Caloplaca Th. Fr. in
Italia. Notiziario della Societa Lichenologica Italiana 5: 9-28.
Nimis P. L., M. Tretiach & J. Poelt. (1994) : Caloplaca wetmorei, a new
lichen species from western North America. The Bryologist 97: 182-
t25:
Nimis P. L. (1993) : The Lichens of Italy. Museo Regionale di Scienze
Naturali, Torino. 897 pp.
Purvis OD WeeyBal Coppins, Date rawksworh Paw. James *D Me
Moore, (eds.) (1992) : The Lichen Flora of Great Britain and
Ireland. Natural History Museum Publications & British Lichen
Society, London. 710 pp.
Poelt J. (1969) : Bestimmungsschlissel europdischer Flechten. Cramer
editswLehfe/Vaduzisis1 +5757 ‘p:
Poelti|y cain terésver*G1993) MabeltragerzurWenninistder
Flechtenflora des Himalaya. VII. Die Gattungen Caloplaca,
4]
Fulgensia und Ioplaca (mit englischem Bestimmungsschlussel).
Bibliotheca Lichenologica 50 : 1-247.
Ryan B. [on line] : Table of contents Sonora Lichens Keys. Caloplaca
[01.vii.1998]. Department of Plant Biology, Arizona State University.
<http://mgd.macse.org/Arizona/Lichenkeys/CALOPL-S.HTM
[consult: 19.v.2000].
Wade A. E. (1965) : The genus Caloplaca Th. Fr. in the British Isles.
Lichenologist 3 : 1-28.
Weber W.A. (1989) : A new species of Caloplaca (Section Gasparrinia)
from California with notes on some other American Caloplaca.
Graphis Scripta 2(4): 168-170.
Wetmore C. M. (1994) : The lichen genus Caloplaca in North and
Central America with brown or black apothecia. Mycologia 86: 813-
838.
Wetmore C. M. (1996) : The Caloplaca sideritis group in North and
Central America. The Bryologist 99: 292-314.
Wetmore C. M. (1997) : The typification of Caloplaca chlorina. The
Bryologist 100: 170.
Wetmore C.M. (1999) : Four new species of Caloplaca from Mexico.
The Bryologist 102: 99-103.
Wetmore C. M. & E. I. Karnefelt. (1998) : The lobate and subfruticose
species of Caloplaca in North and Central America. The Bryologist
101: 230-255.
Wetmore C.M. & Karnefelt, E.I. (1999) : What is Caloplaca cinnabarina?.
The Bryologist 102: 683-691.
a tay f | tae re
See ne baer a
we
&
aa fh
‘a a eae ‘i %! hoe
ay i iN see ety ie
; : oe al fae ee i ty
Ett GRE) ARM RSE NEES aah Kin
i. FG seh ne beat HAL: nay Seah Pini it Re
A tea ae A SELON LBC the coin ated
shot ki ON, ste ah LFRGU NEO AY ON Nt lanes bynes in ae
: - Lait § ny ed my ee hl
‘ a bee a ti part Bm yy ve i , ip i ts eet Lami ws Ren A Hi pay hel ‘t ait ni z a ie f mee i ,
r , ; od ii - an 4 7 ‘ i My + , ha f Ie ‘ ie, Daca et SN by an i 0G wa) v Pad aR ipa
Eriag /otg are aaa eS itt "oie Aes) whi en pis rm eyed a
TON acta ape on vi rane Hettea Tea ores + iat babs Peroni hea
eG te Tae Ah ‘ ‘¢ 1. Sy een Bea) ) :
oghit Me ditsayiaey 'e a: ae Ae , Hiyetit ete: 4) WHEY; ae mat ia ad ih els ve A he nei
ine
Sn
7 cee ¥ Ae rs big i uy 4 at hea Lat ; By e ns , t tone 4 : Wee ios he Pata re - oh i basins eP : Ne < *¥ *
uP as | eal i KO Pea val ‘bene Suse Le eH cage i i ply pee ig Rene k fe i den The at ee . a
Ne Um Er hc kee nia ae, grat m
, a ® SN | yas ’ te! ae ite cat 1 als Pr agit “en saa ARE: ioe’ me rh "7 ™ ae ny
ry ; - = : i Ure: Rives }
bY a iat iq Dh AEM, WR i aii my) lie ae a etn eal ie ete oe wfc My me h, oh a
Uae ee Ta aa MP on ate Tanhued nay ae 1 ite? ay at ‘yy ate WE 7 toes SOR! By s, “
i
wel idl rere he - tee ye ki sil ake ceo ‘Hey Keay? “ways, es panne” ee):
See ‘
Se MEE AS AG NE AEE A SOMERS REL a a magne sap aren > a ,
f ee ar Nia A wale tls fi i Hib ai etude ei or 4 i‘ eeifay: is laine - ss} Ly he
Ree ro Name hs Ad : Macy Ug te gk i seit sd hl A m baal Lge
a hs shai’ e ia EMA ssa " if ioe ait nk nike ia ny chaste es i pave eae
| eleva A iv F Paes ag ry * ih aes yi e. Imad 4 ese Gi , a ennai st enh a ake :
Woe i dy } : Fal Tah aa hank a a0 mee ie ba fies ki oy a ue Rat
“PaaS | th Soe oat hg ‘Ashe ths ut ot ip ae: ha ae
hort as | er bie ia rth mt - ae rk * eee ae
“ne | was
| ‘P f ak tt a) hgh y Le ah v é 45 i " ck é ro id a. ;
i Ane ae ia . se VRB NL |
fl eds3i8 *
oe ny
. ar
j f; ae
{ ee NE ag A jaa tye
Ee a) ay Res 4 y
ee ate MV a eee
A ACL Ti ee
f - ee ae ea
oe
MYCOTAXON
Volume LXXIX, pp. 43-49 July-September 2001
ASPIDOTHELIUM GEMMIFERUM SP. NOV.,
FROM PAPUA NEW GUINEA
(LICHENIZED ASCOMYCETES)
EMMANUEL SERUSIAUX
Department of Botany, University of Liege, Sart Tilman, B-4000 Liége, Belgium —
E.Serusiaux@ulg.ac.be
ROBERT LUCKING
Lehrstuhl fiir Pflanzensystematik, Universitat Bayreuth, D-95440 Bayreuth, Germany —
rlucking @hotmail.com
Abstract: The foliicolous lichen Aspidothelium gemmiferum is
described from lowland rainforest along the northern coast of Papua
New Guinea; it is easily distinguished by the production of disc-like
isidia on the prothallus. A key to all known species of Aspidothelium
is provided.
Key Words: Foliicolous lichens — Thelenellaceae — disc-like isidia
— Australasia
Foliicolous lichens are very diverse in Papua New Guinea and include
several fascinating genera and species, such as Byssoloma gahavisukanum with
sporodochia, Hippocrepidea nigra with horseshoe-shaped hyphophores,
Musaespora coccinea with bright orange perithecia and campylidia, Phyllocratera
papuana with large flattened perithecia and muriform ascospores, and
Sporopodiopsis mortimeriana with complex conidiomata (APTROOT et al. 1997,
SERUSIAUX 1997). Amongst the large collections gathered by the first author in
that country during two expeditions in 1992 and 1995, a new foliicolous
species of Aspidothelium has been found and is described in this paper.
The genus Aspidothelium Vain. is characterized by the following features:
ascomata perithecioid, usually with disc-like or verruciform protuberances,
asci clavate, fissitunicate, with very thick walls and a small but distinct ocular
chamber, paraphyses simple, occurrence of periphyses, ascospores fusiform to
ellipsoid, transversely septate or muriform, and a chlorococcoid photobiont.
44
Eleven species (incl. the one described in this paper) occur on living leaves but
only two [A. fugiens (Miill. Arg.) R. Sant. and the recently segregated A. scutel-
licarpum Liicking] are rather common and pantropical. Since the outstanding
monograph of SANTESSON (1952), new foliicolous species of Aspidothelium have
been described in SERUSIAUX (1978) and LUCKING (1999a), or mentioned as
‘ined.’ in LUCKING (1999b) and LUCKING & KALB (2000).
In his most remarkable taxonomical survey of the pyrenolichens, HARRIS
(1995: 160-167) suggested that Aspidothelium belongs to the Thelenellaceae and
should be reduced into synonymy with Thelenella Nyl. LUCKING (1998)
discussed this concept and reached the conclusion that Aspidothelium and
Thelenella feature a number of differences that support their separation at
generic level: perithecia exposed vs immersed in thalline verrucae, structure
of asci and paraphyses (see contradictory findings by ERIKSSON, 1981 and
HARRIS, 1995) and different ascospore types, those of Aspidothelium being
unmistakable. This view was confirmed by H. Mayrhofer (pers. comm. 1997).
Aspidothelium gemmiferum Sérus. & Liicking sp. nov.
Species foliicola ab omnibus aliis generis Aspidothelit valde distincta scutellis
discoideis umbilicatisque, 0.15-0.2 mm diam., in prothallo copiose instructo.
Perithecia c. 0.6 mm diam., basi distincte constricta, pallide aurantiaca. Ascosporae
fusiformes, 13-15-septatae, 61-70 x 14-16 um.
Type: Papua New Guinea, Madang prov., S side of Ramu river, Brahman
Mission, c. 8-10 km W of Brahman Mission, 5°45’S 145°20’E, 100 m, logging site
in forest remnant, 29 X 1995, E. Sérusiaux 15704 (LG, holotype).
Description: Thallus foliicolous, rounded or irregular, up to 1.5 cm in diam.,
made of scattered algiferous patches with a rather wrinkled surface, and a
distinct, albeit pale grey and almost translucent, rather shiny prothallus. Disc-
like isidia rather abundant (max. 40-45/cm2), present only on the prothallus,
rarely contiguous, 0.15-0.2 mm in diam., translucent to pale greyish, at first
adnate on the thallus surface and when mature typically discoid and
um bilicate, with a slightly dissected margin, containing no algal cells or very
few near its centre, made of long, transversely septate hyphae radiating from
the central part of the disc and with a fringe of individual hyphae protruding
out of the disc and usually with a hooked tip (easily seen under SEM).
Perithecia few, at first seen as hemispherical, pale orange verrucae; when
mature sessile, c. 0.6 mm in diam. and c. 0.45 mm high, distinctly constricted at
the base, pale orange, with a few dark orange spots, especially near the
ostiole, with the outer surface rather irregular; ostiole central, in a slight
depression. Outer perithecial wall 150-200 um _ thick, _ typically
paraplectenchymatous, with rounded cells 6-12 um in diam. and some up to 16
um in diam., many dead and empty and thus forming a _ lacunose
plectenchyma; inner perithecial wall thin, prosoplectenchymatous; paraphyses
abundant, long and simple, c. 1.5 ym thick; periphyses abundant, simple, c. 1.5
Fig. 1-3. Aspidothelium gemmiferum (holotype): SEM views of the disc-like isidia.
Scale bars: 100 pm for 1-2 and 10 um for 3.
46
um thick; asci clavate, with very thick walls and a small but distinct ocular
chamber; ascospores 2-4 per ascus, fusiform, with rather acute ends, 13-15-
septate, 61-70 x 14-16 pm. Photobiont a species of the Chlorococcaceae, most
probably Trebouxia.
Notes: Aspidothelium gemmiferum can easily be distinguished by the typical and
numerous disc-like isidia occuring on its prothallus. No other species in the
genus has such an asexual mean of dispersal. The other species with trans-
versely septate ascospores can be identified with the key provided below.
The perithecia of Aspidothelium gemmiferum somewhat resemble those of
the type material of Phylloporina macrospora Mill. Arg. from Brazil, so far
considered a synonym of A. fugiens (SANTESSON 1952) but most probably
belonging to another species (LUCKING 1999a). This material lacks any disc-
like isidia and is otherwise well-developed: its genuine identity remains to be
established.
Disc-like, and sometimes umbilicate, asexual diaspores can be found in
several species of foliicolous lichens belonging to completely different
groups: Phylloblastia dolichospora Vain. (incertae sedis), Chroodiscus mirificus
(Krempelh.) R. Sant. (Thelotremataceae), Coenogonium isidiferum (Liicking)
Liicking (Gyalectaceae), Echinoplaca gemmifera Liicking (Gomphillaceae), and
several species of Porina, e.g. the species producing the Phyllophiale disc-like
‘isidia’ (Trichotheliaceae). The total number of species involved in the
production of such diaspores is quite low when referred to the number of
strictly foliicolous species but is nevertheless important when compared to
corticolous or saxicolous species known to produce them. Indeed, in the
Tropics and to our knowledge, only a few, poorly known, corticolous repre-
sentatives of the Thelotremataceae also form such diaspores. The recently
described Myriotrema parvidiscum Sipman (SIPMAN 1994: 157) produces disc-like
diaspores (here referred to as schizidia), as well as the monotypic and sterile
Byssophytym album Groenh. (recorded from Indonesia/Java and Papua New
Guinea) which most probably also belongs to the Thelotremataceae. In Papua
New Guinea, three different chemistries are associated with thalli producing
such diaspores, and their taxonomy is currently under study by H. J. M.
Sipman (pers. comm.). A corticolous collection so far identified as Bacidina
scutellifera (Vezda) Vezda is known from the Philippines (Luzon, Laguna prov.,
Los Banos, Mt Makiling Forest reserve, 370 m, 31 VII 1994, P. Diederich 13174,
hb. Diederich): it produces the disc-like isidia typical of B. scutellifera but the
absence of apothecia precludes any final decision on its identity. The selection
pressure to produce such diaspores in foliicolous species is thus quite
important and is otherwise also observed in foliicolous liverworts (LUCKING
& LUCKING 1998).
A similar phenomenon is observed with the production of a byssoid
thallus in tropical corticolous species and genera. Indeed, the thallus of the
following taxa appears to be very similar although they belong to completely
47
different groups: Sagenidiopsis merrotsi R. W. Rogers & Hafellner
(Opegraphales), Dimerella chiodectonoides Kalb (Gyalectaceae), Thelopsis byssoidea
Diederich (Ostropales, ? Stictidaceae), Tania lanosa Egea et al. (Arthoniales),
Tibellia dimerelloides Hafellner & Vezda (Bacidiaceae), etc. (see further examples
in HAFELLNER & VEZDA 1992).
Distribution and ecology: Aspidothelium gemmiferum is so far known only from
the type locality, a little-disturbed area of lowland rainforest along the
northern coast of Papua New Guinea, where it grows on living leaves of an
unidentified dicotyledon in the understory. The locality is extremely rich in
foliicolous lichens and several further new species have been discovered in
the large collections gathered.
Key to the known foliicolous species of Aspidothelium
VaieeeASCOSPOLES transSVCISOLV: SCDLALS pacar hi Mle isscp tn teuretoes Matisibel testes nett eerste coeds es Z
TDRMASCOSPOFES MAUMOTIN Omer eres cere e ort ssceeanclecteeys Mite cates ete eure net. ocMocr este: 8
2a Thallus with abundant disc-like isidia on the prothallus (Papua New
KSTING a rece ty teak aes eoluee cise inamenstan eget et A. gemmiferum Sérus. & Liicking
2Damet Nall US WALNOUL SUCIIASTCL AR stares stuse, hoi naa se vedeSteestanah cai eee sscer echo nsgudaata 3
3a Perithecial wall paraplectenchymatous, externally with a fine spongioid
cover (lropicalyAmerica)sqvay gie panty. tekst Ge Colen estes A. ornatum Liicking
3b —s«- Perithecial wall formed by densely intricate hyphae, smooth or with
irregular appendages, setae or a disc-like expansion on apical parts......... 4
A AMY CTILNECIAISUTO OU ameter tres ttsrirssloctts lest ecsticeecersbep sant eetstelisiestorarscetiareretens 5
4b Perithecia with irregular appendages, setae or a disc-like expansion on
APICals Parts was. Ses nede Ml Man Mise sites eptsssemecsssessubecudsosedeesibasesutansetssaseesa vestwltetreddee 6
5a Perithecia egg-shaped or papilliform, pale yellowish; ascospores 80-140
unilong. (Tropicals America yarnrisss.syts.csrs tts A. papillicarpum Liicking ined.
5b Perithecia hemispherical to wart-shaped or subglobose, dark grey;
ascospores 50-100 wm long (Tropical America).........cceesescseesscesssessceeseeseceees
ee ANE a lel Tee ota eA ta 2 Ok ARUN Nn oA eit k A. geminicarpum (Malme) R. Sant.
6a Perithecia with a disc-like expansion with smooth or minutely dentate
margins, whitish to pinkish or pale grey (pantropical) 0... ieee ceees
PA RRR, Rec AERO: MEM Nec Lotaaget oPesh cass oveapPeseenes vents A. scutellicarpum Liicking
6b Perithecia with short appendages or setae, pale yellowish to brownish
WTEC oo ie caes tase ese sutcuopoupoechepasvinstsovieecsasgunsetesuiepesecbaersdecsconase teeing Seekrees ime cesmitenstredetrs 7:
7a Perithecia with up to 0.3 mm long setae; ascospores with the two median
cells often slightly enlarged (Tropical America) ................:scssssesssssscssessceseees
PIMC see ics cseee te tseet pwcta deere Cattees etrctvhous Sasscycgatee A. arachnoideum Liicking ined.
48
7b Perithecia with short, up to 0.1 mm long, irregular appendages;
ascospores with the two median cells not enlarged (pantropical)................
PAT UCR Sh ia telins ony teeth oe ao Reeetee emo os AM eee teres A. fugiens (Malme) R. Sant.
8a Ascospores with the median cell large and simple (Tropical
Americay Bodador) Vitis actrees eetele ters Le og sree tens A. mirabile Liicking
Shit Ascospores regularly m UrilOrmn sy vets sweverstares csteessateedhsety sister teste meets os ieee 9
9a _ _Perithecia with up to 0.2 mm long setae (Tropical America and Africa) .....
SPs H SCAG cnt bas aves Reangtacestadeateten geese een Atta t A. trichothelioides Sérus. & Vezda
Ob )-Peritheciaiwith adisc-like expansion nrng)...swetare. neta eocstt oe eerste 10
10a Thallus verrucose; ascospores 35-65 x 13-20 um (Tropical Asia and
Australia) cry cate ete ere etre ee Reiner A. verruculosum R. Sant.
10b Thallus smooth; ascospores 40-80 x 15-25 um (pantropical) «0... eee
Mee titeantosee tenets tunes pestetcvbabcantconeapetst tats ection sceetetnaeterencs wevroteedeess A. cinerascens Vain.
Acknowledgements
We wish to thank very much the following colleagues for their precious help in the
preparation of the ms: Prof./Dr. B. J. Coppins, P. Diederich, J. Lambinon and H.
Sipman. H. Sipman kindly provided detailed information on the Thelotremataceae
producing ‘schizidia’. We are also very much indebted to Ido Cremasco of the
Department of Botany in Liege for his help in preparing the material for SEM
microscopy and to Prof. Gérard Goffinet and his group of the Department of Zoology
in Liege for their advice in using the SEM microscope and equipment in their care.
André Aptroot, Peter Lambley and Harrie Sipman were great companions to the first
author during the 1995 expedition to Papua New Guinea. Finally the first author
wishes to thank very warmly Mr. J. M. Ouin, manager of the biological station at
Laing Island, as well as his staff, for their cheer hospitality and efficient assistance
during the expeditions in such a wonderful country.
Literature cited
APTROOT, A., DIEDERICH, P. SERUSIAUX, E. & SIPMAN, H. J. M. 1997. Lichens and
Lichenicolous Fungi from New Guinea. — Bibliotheca Lichenologica 64,
220 p
ERIKSSON, O. E. 1981. The families of bitunicate ascomycetes. — Opera Bot. 60:
1-209.
HAFELLNER, J. & VEZDA, A. 1992. Tibellia, eine neue Gattung der Bacidiaceae
mit byssoidem Thallus (lichenisierte Ascomycetes, pecanorales): — Nova
Hedwigia 55: 183-193.
HARRIS, R. C. 1995. More Florida Lichens, including the 10 c tour of the
pyrenolichens. Published by the author, Bronx, N. Y., 192 p.
LUCKING, A. & LUCKING R. 1998. Anpassungen und Konvergenzen in der
Phyllosphare am Beispiel epiphyller Moose, Flechten und Insekten. —
Mitt. Bundesforsch. anstalt Forst. Holzwirtsch. 190: 115-119.
49
LUCKING, R. 1998. Foliicolous lichens and their lichenicolous fungi collected
during the Smithsonian International Cryptogamic Expedition to
Guyana 1996. — Trop. Bryol. 15: 45-76.
LUCKING, R. 1999a. Foliicolous lichens and their lichenicolous fungi from
Ecuador, with a comparison of lowland and montane rain forest. —
Willdenowia 29: 299-335.
LUCKING, R. 1999b. Liquenes folicolas de la Estacié6n Biolégica La Selva, Costa
Rica: Inventario, comunidades y comparacién floristica de tipos de
vegetacion. — Revista de Biologia Tropical 47: 287-308.
LUCKING, R. & KALB K. 2000. Foliikole Flechten aus Brasilien (vornehmlich
Amazonien), inklusive einer Checkliste und Bemerkungen zu
Coenogonium und Dimerella (Gyalectaceae). — Bot. Jahrb. Syst. 122: 1-61.
SANTESSON, R. 1952. Foliicolous lichens I. A revision of the taxonomy of the
obligately foliicolous, lichenized fungi. — Symb. Bot. Upsal. 12(1), 590 p.
SERUSIAUX, E. 1978. Contribution 4 l’étude des lichens du Kivu (Zaire), du
Rwanda et du Burundi. II. Especes nouvelles de lichens foliicoles. —
Lejeunia N. S. 90, 18 p.
SERUSIAUX, E. 1997. Sporopodiopsis, a new lichen genus (Ectolechiaceae) from S-
E Asia. — Abstracta Botanica 21: 145-152.
SIPMAN, H. J. M. 1994. New Graphidales (lichenized Ascomycotina) from the
Guianas and nearby areas. — Acta Bot. Fennica 150: 165-172.
¥ '
ee
; '
. i. ory
vo>e ts i Serpe ths Tt 8:
i [ we _ = - i 2 oy
my Ak » be i TY DA he } 7 ’ F D if
é ah =) . 4 rn, Abd ir) ety ae 7
i
‘4
Pat a me Psi Paap
ont a he gid Mins on ah
A? panne
‘ ud essen) oe iy tate eae
0 at cf
Suis pildena beak: oaaleoiae a oe
nye “ve ra Medea pair anes so |
i
ut ‘ “if 5
' ‘cae aan oes respecte et
' me fy A rt set ith yeepuas 2 cattle ies siajenctane feces
ato ’ Ant NRG ey Veber
; ern TE hare Sahay floes iv
| + Es ; - eh Eyal Mia een ‘i wie ciate
i>! : he « F ' e 1) mis feas- fe
silty he 7 cimeiasi i i
thes fey W
<i
Fhe a, oe ty ‘
‘ Wl
‘ a) te} i
ae oe eae bir ye ieee
Ki ag \ Rae Seat, a pete 7 a i
ms F vinaeane, a A 7h tie
one ‘eka PA hc ty Be as hue
Be ANA tgs ray aad A OF hatha oa: ee ae ate
a. je ay ean ai rae ue ’ es r Shey i
“igh dea asin, i BUA | es ireunuc’s oi gee pew) - a * as ul
it a AS ee a piel ONS A
‘i ae £ oe t 4 ny i, bi att chat be as [ a Re he Piecou A i if ag my At
a ‘ eis ae ay , i | Palas ae he Pie
pe, ‘Ade Bet oat zi ey on ee i : cif ‘ ; Gnade ira Gy’ f
Pa ah 7h) at te sh i, iat i a ir hag wth ae oe srt Ke hie Sen AO naw fats na es Je ;
ay ai eh ine yee Hie ne PTR, sent, eRe Mm aa
4 e NE ie ; : alee cd op ir ihe Ig Haha A 3 iin Fi dT Ny ae Mid ede on
yt oy M Ue es K A he ‘Dyer : ul al * y oar Vices 3 ‘ae , : 7 tot (ai tea oe are a} iat
ee i . a fy ee " APE IER tit . sue rae Sls a \ iieg? ter’ pis ne ae y ary:
ate Saal op Mans aes Ne | esi ey “ander hitag= Aik! TERN Sta ae ite :
: ‘a MS ERGs } + ihe an | eyo iy i at Pi Wr AL he ah ry ; { sie i oad MA ae hom t: ,
‘ tits 1 Lan opt ; : pA tet Wed Oren A LA? : Dates Ti by ‘ hos " re | 7 oo ge
4 vile f Ue oe Ag’ ons ne Or os 1 tl ae : halos een aN. iia tye ie pis? q ' cl
¥ ee hy LN aay bht, Laat ay f eo Saft! SECLUAN © \ 7 pe ee
Ae NA Me Mu ia 1 eh t im ode eye m ree Sth AP We aL
‘| Gari) SU Ere dr take eae tune Maa ity, ae TE pun ee vy ‘ae r ey ad, e! og . Tie 1"
Pi ee reer | re ae a eS Ee ck ah “paeie ere ae ect eet eile. is i
ni it mnie y 1 Ae i : te bas Eth Je naa ay ih vie iy ry yi at =) a ylAe be |
A eet rat TPF) Pa EL Dee, 4a hee Iv mi ” yi spare a oir
J j Satins , ad ny W vee ad ,
) ae way «| roe 7) ‘. hy ae Patey pay ‘ated’ ay Si te Phe nen?
; ai , - ' ‘< A My 7 rei ry via bey 493 16 ie ge i re ae aoa oy | by’ at 4 ote
j A a i ‘ Viel (2 i A it , , tA en ee yas F ; A +
‘ Oe VE ety To oe Sets Btianig Ae rah eke ry i
; ( , Nae be ik af ee) AM ii nh ha ra oy here
Hae ee or i NS ites Ait Nal Te ipa ee
} | : mn : he if oo Se oh ae
~ ¥ a Li 89g ‘ i ae er
| Weaver etc et Poke A abtiiatired
} f 9 | A he ' Lr nt yay ny ar Sgn me
i iy y Ata ae ie 4 Ml
f ae fa ar he Sikes +
aT oy aU ies a 4 aes intial gs ext ’
' Ee) eee eae a
rh ‘i i : ha & as 7 ne) . ', t Nf ae. te ; ae a 7) ;
4 yrs ie. iF j ely ai Per i hed ms Vv
; iv Vi ee ts
eed Sea a Sip CEO ani ibs) Sahm EL ha
as a 4 ‘% i Dhue oP ban cA
ete et aa
r gy eh UR ri ve by, a BY epg eet A 7 j ua
eee aR, Wa ant Gee
/ ‘4 ‘ n f. ‘ we) yt ot
WV by wi ;
‘ ‘ c ha
Bet ee be ak |
HAs Pian es a
; ay Crist ses: ge Prears,
ite | Le lava ne Wy, ;
ah Fak 7 ad ae 74 j Mi
MYCOTAXON
Volume LXXIX, pp.51-56 July-September 2001
PULVINELLA, A NEW GENUS
WITH PROSENCHYMATOUS PROPAGULES
Annette W. Ramaley
7 Animas Place
Durango, Colorado 81301
Abstract: Pulvinella, a new genus in the Agonomycetales, is described from dead leaves of
Nolina, a member of the Agavaceae. The fungus produces caducous, prosenchymatous
propagules that are multihyphal in origin. Neither a sexual phase nor an alternative asexual
phase is known from nature or from culture.
Key Words: Agonomycetales, Nolina, systematics, Verdipulvinus
INTRODUCTION
Nolina Michx., a member of the Agavaceae, is a perennial plant with
long, fibrous, narrowly linear leaves growing from a thick, often subterranean
caudex. Dead, decomposing leaves may remain attached to the caudex for
several years. In transection, the leaves have several vascular bundles in each of
numerous strands of fibers each of which reach from the upper to the lower
epidermis. The fiber strands alternate with strips of parenchyma which
surround epidermal clefts in which stomata are located. Firm, greenish,
cushion-shaped, fungal structures were discovered on decomposing leaves of
Nolina micrantha I. M, Johnst. These structures, found on leaf parts where
decomposition had progressed considerably, were produced on the surface of
mycelium exposed by rupture of the epidermis near stomatal clefts of affected
leaves.
MATERIALS AND METHODS
Cultures were obtained by rinsing the cushion-shaped structures 3 times
in sterile tap water and placing them on the surface of commerical potato
dextrose agar (PDA, Difco) in 100 mm diam Petri plates. Cultures were grown
at room temperature. For structural study, freehand sections of the mycelium
bearing the pulvinate structures were stained in lactophenol-cotton blue.
D2
TAXONOMY
Pulvinella A. W. Ramaley gen. nov.
Genus ad Agonomycetales pertinens. Mycelium in contertetbus plantarum immersum.
Ab propagulibus caducis, prosenchymatis, origine multihypha denuo generens. Propagula in
superficie mycelio exposito dispersa, loci cupulat: reproductive nulls.
Species typica. Pulvinella nolinae A. W. Ramaley
Member of the Agonomycetales. Mycelium immersed in plant tissues.
Reproducing by caducous, prosenchymatous propagules of multihyphal origin.
Propagules scattered on exposed surface of mycelium, cupulate reproductive loci
lacking.
Pulvinella nolinae A. W. Ramaley sp. nov. FIG, 1-3.
Propagula viridula, sphaeroidea, 50-100 (-125) ptm diam, pigmentum viridulum extra
involucre cellularum; in vicinia ad maturitatem isberata.
Ex foliis emortuis Nolina micrantha I. M. Johnst. "U.S.A. NEW MEXICO: Lincoln Co.,
Valley of Fires. 27 May 1997, Annette Ramaley 9705A.” holotypus UC, 1512945; tsotypus
BPI, 747286.
Propagules (FIG. 1, 2) greenish, sphaeroid, 50-100 (-125) wm diam, the
green pigment external to the cellular envelope (FIG. 3); released to the environ-
ment when mature. Distinguishable rind and medullary regions lacking (FIG.
3) though peripheral cells may be closer together than cells in the middle of a
propagule.
Propagules are produced on exposed mycelium at the ruptured leaf
surface, As with many fungi on Nolina, this fungus is visible in the parenchyma _
around and below the stomatal cleft. The fungus consists only of the mycelium
and propagules. The propagule surface usually appears darker than the interior
(FIG. 1, 2) because cells at the surface are usually closer together, there may be
more pigment surrounding surface cells, and, surface cells die, but the cellular
envelopes and pigment remain attached and accumulate at the surface. Neither
an alternative asexual phase nor spore production by an associated perfect form
has been observed. It is not known how commonly the fungus occurs, or
whether it inhabits the caudex as well as decomposing leaf tissue.
Pulvinella cultures grow slowly and the irregularly shaped colonies never
reach the diameter of the 100 mm Petri plate. Pigmentation is variable. Some
colonies may appear orange, some may appear purple, or more often, the
colonies have areas with both colors. Agar surrounding the colonies is at first
bright orange but later becomes purplish orange. A culture has been deposited
in the American Type Culture Collection, MY A-771.
a
DISCUSSION
When Pulvinella was first noted it was considered a possible alternative
reproductive structure of Verdipulvinus (A. W. Ramaley 1999) produced in
response to different but undetermined environmental conditions. Propagules of
both genera are caducous, discoid to sphaeroid, prosenchymatous, colored green
by a pigment that accumulates outside the cell envelope, and of multihyphal
origin. Both fungi reproduce in leaves at similar stages of decomposition and
sometimes may be found very close to one another. Two differences noted on
the host are: (i) Verdipulvinus propagules are produced sequentially in cupules
at distinct and active reproductive loci. Pulvinella lacks cupules, the propagules
apparently forming anywhere on the exposed mycelial surface, and (ii) the
frequent superposition of Pulvinella on other fungal structures--commonly on old
ascomata of a Mycosphaerella(?) species which extends for great lengths along
the stomatal cleft, but also on individual old conidiomata of Piptarthron. No
such association of Verdipulvinus has been noted. However, differences such as
these might be expected if the propagules represented alternative imperfect
states of the fungus.
Cultures of Pulvinella and Verdipulvinus derived from propagules formed
at nearby sites (< 1 mm distant) on 4 different leaves show some differences.
Pulvinella propagules germinate within 24 hours of placement on PDA whereas
pieces of Verdipulvinus discs, similarly treated, require 48 hours for germination.
Propagules have never been produced by any Pulvinella colonies grown on PDA
whereas most Verdipulvinus colonies eventually produce stacks of propagules at
specialized sites. Cultures of both genera grow at approximately the same rate
and attain approximately the same size, but older colonies of Pulvinella usually
appear purplish, at least in some areas, whereas Verdipulvinus colonies are
orange. Orange pigment is also present in Pulvinella colonies, but is often more
or less hidden by the later-appearing purple coloration. These differences under
the same growing conditions allowed separation of the genera.
Subicularium Farr & Goos, which §. J. Hughes believed to be synonymous
with Hermatomyces Speg. (R. D. Goos, personal communication), is a ligni-
colous tropical genus producing multicellular propagules which may approach
the dimensions of the smallest Pulvinella propagules. Whereas Hermatomyces
propagules originate from single hyphae (Hughes 1950), limited material made
it impossible to ascertain whether propagules of the specimen described as
Subicularium were of multihyphal origin or were born as typical conidia on single
hyphae. In either case, the genus can be separated from Pulvinella. Subicularium
has mostly superficial mycelium composed of branched, anastomosed hyphae
forming a reticulum. Mature propagules are dark brown and composed of more
or less isodiametric cells whose outer walls are often thick and blackened.
Young propagules are globose to broadly ellipsoid and are pale brown (Farr and
Goos 1989). The propagules lack septa in early stages making it unlikely they
are of multihyphal origin. None of these conditions is found in Pulvinella.
54
FIGS. 1, 2. Pulvinella nolinae. Fig. 1. Stained vertical section of a nearly
mature prosenchymatous propagule. Scale bar = 17 ym. Fig. 2. Stained
vertical section of a developing propagule. Several hyphae contributing to its
formation still connect it to the mycelium. Scale bar = 17 pm.
55
FIG. 3. Pulvinella nolinae. Detail of edge of a stained propagule in vertical
section. No pseudoparenchymatous rind is present. The pigment (<) lies
exterior to the cellular envelope. Dead or dying cells (d) show the cellular
envelope and pigment still attached to the propagule. Scale bar = 6 pm.
Pulvinella propagules can neither be termed conidia nor can they be
comfortably placed in any category of vegetative reproductive structures as
presently described. Conidia secede by fracture of a single cell or by splitting of
a septum. The multihyphal origin of Pulvinella propagules renders conidium an
inappropriate designation. Use of the term gemma has been rejected in the
fungi (Kendrick and Watling 1979). Other existing terms that are possible
names for the propagules are bulbil, sclerotium, and sclerotioid body. Weresub
and LeClair (1971) distinguished bulbils from sclerotia by: (i) structure:
differentiation into rind and medulla in sclerotia and no such differentiation in
bulbils; (11) origin: a gradual gradation from mycelium to sclerotium versus
formation of an immediately distinctive unit, a bulbil. Pulvinella propagules
lack both these characteristics of sclerotia, but like bulbils, the propagules are
immediately distinctive units at the surface of the mycelium. However, the
structure of mature bulbils is pseudoparenchymatous whereas this tissue is
entirely absent in Pulvinella propagules. A_ sclerotioid body (Kendrick and
Watling 1979) consists of any ‘multicellular resting structures...which can-
not...be categorized as bulbils, papulospores or sclerotia.’ Such prosenchyma-
tous bodies lack a differentiated rind. I believe these authors tried to keep
sclerotioid body an open, catchall term to prevent structures, like those of
Pulvinella, being forced into some other unsuitable category. Pulvinella
56
propagules conform to this negatively defined category structurally, but the
designation ignores the possible differences in origin of the bodies in question
and restricts the function to that of ‘resting’ structures. Whereas sclerotia are
often considered to be formed to allow survival under conditions inimical to
fungal growth, Pulvinella propagules cannot be restricted to this function.
Unless the mycelium itself is very resistant, Pulvinella propagules may well be
‘resting’ structures. In addition, since no other reproductive structure is known
for this fungus, the structures produced must function directly in reproduction
and dispersal as well as resistance to harsh environmental conditions.
Although ‘bulbil’ and ‘sclerotium’ are now fairly narrowly defined
(Hawksworth et a/ 1995), ‘conidium’ includes diverse developmental and
structural configurations. The major limitation to using this term for Pulvinella
propagules is the restriction that a conidium be the product of a single cell or
hypha. If it is necessary to categorize structures such as Pulvinella propagules, it
may be best to expand the concept of conidium to include caducous repro-
ductive structures of multihyphal origin. This idea was suggested to me by Dr.
Bryce Kendrick in reference to Verdipulvinus. Although Pulvinella does not
produce sequential propagules at specific cup-shaped sites as does Verdipulvinus,
the characteristics these genera do share would seem to merit their being placed
together in whatever category is eventually found suitable.
ACKNOWLEDGEMENTS
My thanks to Dr. Roger Goos for reviewing the manuscript. His helpful
suggestions and comments improved the content and are much appreciated. I
also thank Dr. Bryce Kendrick for suggesting that prosenchymatous propagules
of multihyphal origin might best be considered conidia. The idea was intriguing
when it was suggested for propagles of Verdipulvinus and even more attractive
with the discovery of Pulvinella.
REFERENCES
Farr, M. L., and Goos, R. D. 1989. Subicularium reticulatum gen. et sp. nov., an unusual
fungus from Venezuela. Mem. New York Bot. Garden 49: 66-69.
Hawksworth, D. L., Kirk, P. M., Sutton, B. C., and Pegler, D. N. 1995. Ainsworth &
Bisby’s dictionary of the fungi, 8th ed. Wallingford, UK: International Mycological
Institute, CAB International.
Hughes, S. J. 1953. Fungi from the Gold Coast. II. CMI Mycol. Paper 50.
Kendrick, B., and Watling, R. 1979. Mitospores in Basidiomycetes In: The whole fungus.
Edited by B. Kendrick. Ottawa: National Museum of Natural Sciences, National
Museums of Canada, and the Kananaskis Foundation. pp. 473-545.
Ramaley, A. W. 1999. Verdipulvinus, a new aconidial genus with prosenchymatous
propagules. Mycologia 91: 132-135.
Weresub, L. K., and LeClair, P. M. 1971. On Papulospora and bulbilliferous Basidiomycetes
Burgoa and Minimedusa. Can. Jour. Bot. 49: 2203-2213.
MYCOTAXKON
Volume LXXIX, pp. 57-66 July-September 2001
A NEW ANTRODIA SPECIES (CORIOLACEAE,
BASIDIOMYCETES)
Annarosa Bernicchia
Istituto di Patologia Vegetale, Universita degli Studi di
Bologna, Via Filippo Re 8, I-40126 Bologna, Italy
E-mail: abernicc@dns.agrsci.unibo.it
and
Leif Ryvarden
Botany Dep., Biological Institute, University of Oslo,
Box 1045, Blindern, N-0316 Oslo, Norway
E-mail: leifryvarden@bio.uio.no
SUMMARY: Antrodia sandaliae is described as new, based on
collections from Sardinia, Italy, growing on Arbutus unedo. A key
to the European species of Antrodia is provided.
Key words: brown-rot polypore, Sardinia.
INTRODUCTION
The genus Antrodia P. Karst includes polypores with a
dimitic hyphal system, including clamped generative hyphae and
hyaline skeletal hyphae and producing a brown rot in the attacked
wood. Most species are resupinate with a few being effused
58
reflexed. Currently 26 species are known from Europe (Ryvarden
& Gilbertson 1993, Henrici & Ryvarden 1997). Sardinia has
remarkably many endemic and rare polypores such as
Neolentiporus squamosellus (Bernicchia & Ryvarden) Bernicchia
& Ryvarden, Phellinus juniperinus Bernicchia & Curreli,
Phellinus rosmarini Bernicchia and Lenzitella malenconii
Ryvarden to mention a few. Never the less it came as a surprise
when an Antrodia specimen from the island did not fit with the
description of any of the European species. A search in other
available literature (Gilbertson & Ryvarden 1983, Nunez &
Ryvarden 2000) gave no clue to its identity and below it is
described as a new species.
Antrodia sandaliae Bernicchia et Ryvarden sp. nov.
Etymology: from Sandalia, one of the old Latin names referring to
Sardinia, deriving from the shape of the island that resembles a
sandalum, the footwear of Roman people.
Carposomata annua, effusa, usque ad aliqua cm lata, resupinata,
nodulosa vel aliquando pileata, albicante colore sed paulo post
differentia rosei coloris exigua; superficies superior rugosa,
margine albo, pubescente. Pori plus minusve rotundi, 3-5 pro mm,
dissepimentis pubescentibus. Contextus tenue, concolore cum
superficie poroidea; tubuli unistratosi. :
Systema hypharum dimiticum: hyphae generativae numerosae,
hyalinae, fibulatae, ramosae, 2.0-3.0 um latae, tunicis plus
minusve tenuibus; hyphae skeletales frequentia pocula, 2.0-5.0
um latae. Basidiosporae hyalinae, leves, cylindraceae vel
subcylindraceae (7.5) 8.0-10.0 x (1.8) 2.0-2.8 (3.0) um.
Cariem brunneam in ligno Arbuti producet.
Holotypus: Italy, Sardinia, Montarbu Forest (Nuoro), m 900 a.s.1.,
on Arbutus unedo, coll. Bernicchia & Ryvarden, 04.XII.2000,
herb. HUBO 7348, isotypus in O.
Basidiocarps annual, resupinate to more rarely effused reflexed,
1.5-8.0 x 0.5-3.0 cm wide, soft when fresh; upper surface white
59
when fresh, cottony soft and azonate, margins sterile, floccose,
cottony, white. Pore surface whitish with some pinkish shade,
unchanging upon dry; pores round to roundish with some larger
ones, 3-5 per mm; dissepiments entire, thick and pubescent.
Context very thin and about the same colour as the pore surface.
Hyphal system dimitic: generative hyphae septate, clamped, thin-
walled or slightly thick-walled, hyaline, branched, smooth or
incrusted, 2.0-5.0 um in diam, strongly gelatinizing in KOH,
exuding an oily floating substance that masks the microscopic
observation (the use of Melzer’s reagent is suggested), very
numerous and dominating in the subhymenium, tubes and context.
Some thick-walled hyphae are inflated with a diam of 7.0 um or
have capitate-fusoid ends. Skeletal hyphae very rare, apparently
absent, thick-walled, straight, refractive, 2.0-5.5 um in diam.
Cystidia absent but fusoid cystidioles present.
Basidia clavate, with two to four sterigmata and a basal clamp,
18-20 x 5.0-7.0 um.
Basidiospores hyaline, thin-walled, smooth, inamyloid and
indextrinoid, mostly cylindrical but some having a depression
close to the apiculus while a few have a double depression, one
close to the proximal end and the other one at the distal part, (7.5)
8.0-10.0 x (1.8) 2.0-2.8 (3.0) um (Figure 1).
Remarks: Antrodia sandaliae resembles Antrodia infirma
Renvall & Niemela, a species known only from the boreal North
Europe and collected only on dead trunks of Pinus sylvestris. Both
species have an almost monomitic hyphal system with a
dominance of generative hyphae throughout the basidiocarps and
both have cylindrical basidiospores. However, those of A.
sandaliae are longer than the spores of A. infirma (Figure 2).
While 4. sandaliae may develop a pileate basidiocarp, this is
never the case with A. infirma.
A. primaeva Renvall & Niemela, another boreal species
known only from Pinus sylvestris, macroscopically resembles A.
sandaliae as they both may be pileate. However, in A. sandaliae
the pileus is white and cottony, in A. primaeva it becomes brown
60
and discoloured almost to bay with age. The latter has a trimitic
hyphal system with numerous skeletal hyphae and scattered
binding hyphae in contrast to the almost monomitic system seen
in A. sandaliae. Furthermore, the basidiospores of A. primaeva are
smaller and vary from ellipsoid to subfusiform, while they are
cylindrical in A. sandaliae (see table 2).
Figure 1 - Microscopical characters for A. sandaliae.
Oligoporus rancidus (Bres.) Gilb. & Ryvarden is
macroscopically reminiscent of A. sandaliae too, but has a
monomitic hyphal system and shorter basidiospores.
Specimens examined:
Antrodia sandaliae: Bernicchia (HUBO) 7338, 7339,
7340, 7348, 7350, 7352 from the same locality and substratum.
61
Antrodia infirma: Finland, Pohjois-Karjala: Lieksa,
Patvinsuo National Park, Autiovaara, isotype (O) coll. Reijo
Penttila 1235, 14.[X.1989, on fallen trunk of Pinus sylvestris;
Finland, Koillismaa prov., Taivalkoski, Metsakyla, on Pinus
sylvestris, 17.VIII.1994, coll. J. Nissinen 125; Pera-Pohjola prov.,
Tervola, Pisavaara Nat. Park, on Pinus sylvestris, 29.VII.1979,
coll. T. Niemela 1533 and H. Kotiranta.
Antrodia primaeva: Finland, Kuusamo, Salla, Varrio strict
Nature Reserve, 2. Aug. 1988, on dead Pinus sylvestris, T. & P.
Renvall 316 (O — paratype).
a b
QU0GU MODE
5 um d
C
(O00) QOD
Figure 2: Composite drawing of basidiospores for related
species, a) Antrodia primaeva, b) Antrodia infirma, c) Antrodia
serialis, d) Antrodia sandaliae.
62
KEY TO EUROPEAN SPECIES OF ANTRODIA AND
DIPLOMITOPORUS
Description of A. pseudosinuosa can be found in Henrici &
Ryvarden 1997, and all the other European species in Ryvarden
& Gilbertson (1993). The letter A refers to Antrodia, D to
Diplomitoporus; a species resembling Skeletocutis lenis has
been added to the key.
1. Spores generally longer than 7 xm; all species with pores wider
than 1 mm key out here 2
1. Spores generally shorter than 7 um be
2. Spores up to 10 ym long 3
2. Spores in average longer than 10 ym i
3. Pore surface pale brown A. malicola
3. Pore surface white, cream to pinkish +
4. Hyphal system almost monomitic, skeletal hyphae few;
basidiocarp fragile 5
4. Hyphal system distinctly dimitic, skeletal hyphae common;
basidiocarp tough Om
5. Basidiocarps effused reflexed, pileus white and cottony;
basidiospores 8-10 um long; Mediterranean species found only on
Arbutus unedo A. sandaliae
5. Basidiocarps strictly resupinate; basidiospores 6.3-8.5 1m;
boreal species found only on Pinus sylvestris A. infirma
6. On gymnosperms; pores 2-3 per mm; basidiospores fusiform;
common species A. serialis
6. On Populus or Salix; pores irregular, 1-2 mm wide; spores
ellipsoid to subcylindrical; rare boreal species A. mellita
63
7. On deciduous trees 8
7. On gymnosperms 10
8. Spores 9-12 wm long; pores round to angular 2-3 per mm,
usually on Salix or Populus A. macra
8. Spores 10-18 wm long; pores angular, 0.5 to 1 mm wide, or
sinuous to lamellate and larger; on all types of hardwoods 9
9. Spores 14-18 ym long; basidiocarps resupinate; rare southern
species A. macrospora
9. Spores 10-14 (-16) um long; basidiocarps resupinate to pileate;
widespread species A. albida
10. Parasitic on living Juniperus sp.; very rare Mediterranean to
tropical species A. juniperina
10. Saprotrophic on other gymnosperms 11
11. Pore surface pale to cinnamon brown A. variiformis
11. Pore surface white to cream 12
12. Pores 2-4 per mm; basidiospores 6-10 x 2.5-3.3 ym
A. primaeva
12. Pores 1-2 per mm; basidiospores 9-11 x 45-5 um
A. ramentacea
13. Spores ellipsoid to subcylindrical 14
13. Spores cylindrical to allantoid 19
14. Basidiocarps brittle when dry; pore surface pale sordid brown
to yellow when dry; rhizomorphs usually present 15
14. Basidiocarps hard to soft and cottony when dry; pore surface
cream to white when dry; rhizomorphs absent 18
15. Pore surface whitish to pale sordid brown; trama monomitic;
spores 5-6 um long 16
64
15. Pore surface yellowish; trama dimitic; spores 6-7.5 wm long
A. radiculosa
16. Context and older tubes disintegrated to a white amorphous
and crumbly mass 17
16. Context and tubes distinct, easily distinguished 18
17. On Salicaceae, especially Populus; cystidioles absent or very
few A. pulvinascens
17. On gymnosperms; pointed cystidioles abundantly present in
the hymenium A. crassa
18. On Hippophaé; pores 3-4 per mm; spores 5-6 x 2-3 wm
A. hippophaés
18. On Populus tremula or Fagus; pores ca. 1 per mm; spores 5.5-
7x 2.8-4 ym A. mellita
19. Skeletal hyphae strongly to slightly amyloid 20
19. Skeletal hyphae non-amyloid 22
20. Spores allantoid, 1-1.5 wm wide; pore surface white to citric
yellow, often cracked in polygons A. xantha
20. Spores allantoid to cylindrical; pore surface grey, cream to:
pale sordid brown, not cracked 21
21. Pore surface greyish; skeletal hyphae dissolving in KOH;
causing a white rot; pores 3-5 per mm D. lindbladii
21. Pore surface white or cream to pale sordid brown; skeletal
hyphae unchanged in KOH; causing brown rot; pores 5-7 per mm
A. sitchensis
22. Spores 2-3 wm wide 3 23
22. Spores 1-2 wm wide 25
23. Spores 4-5 wm long; pore surface bright lemon to citric
65
yellow, purplish red when touched with KOH; known from the
Alps A. alpina
23. Spores 5-7 um long; pore surface pale cinnamon to straw-
coloured, no red colour with KOH; widespread species 24
24. Basidiocarps resupinate, pore surface cracked, on Picea
D. crustulinus
24. Basidiocarps resupinate to reflexed, pore surface even, on
Pinus D. flavescens
25. Pores 1-3 per mm, irregular, sinuous; dissepiments lacerate 26
25. Pores 3-7 per mm, angular to round; dissepiments entire 27
26. On gymnosperms, basidiocarps resupinate, common species
A. sinuosa
26. On deciduous trees; basidiocarps pileate, rare species
A. pseudosinuosa
27. Spores 1.5-2 wm wide 28
27. Spores 1-1.5 wm wide 30
28. Pore surface creamy white to pale sordid brown; skeletal
hyphae unchanged in KOH; species with brown rot; usually on
Pinus 29
28. Pore surface greyish, skeletal hyphae dissolving in KOH and
weakly amyloid; widespread species causing a white rot on both
hardwoods and conifers D. lindbladii
29. Spores allantoid, 5-7 wm long; context distinct and cottony
A. albobrunnea
29. Spores cylindrical, 4-5 wm long; context indistinct and
crumbly A. sordida
30. Pore surface cream to citric yellow when fresh, often cracked;
spores allantoid; skeletal hyphae weakly amyloid A.xantha
66
30. Pore surface white, soft and even; spores lunate; skeletal
hyphae non-amyloid Skeletocutis lenis
ACNOWLEDGEMENT
We would like to thank Prof. T. Niemela for critically reviewing
the manuscript and Dr. C. Losi for the drawing.
REFERENCES
Gilbertson, R. L. & Ryvarden, L. 1986: North American polypores, vol 1:1-433,
Fungiflora, Oslo, Norway.
Henrici, A. & Ryvarden, L. 1997: Antrodia pseudosinuosa. Sp. Nov.
Mycologist 11: 152-153.
Niiiez, M. & Ryvarden, L. 2000: East Asian polypores, Synopsis Fung. 13:1-
168.
Renvall, P. & Niemela, T. 1992: Basidiomycetes at the timberline in Lapland 3.
Two new boreal polypores with intricate hyphal systems. Karstenia 32:29-42.
Ryvarden, L. & Gilbertson R. L. 1993: European polypores vol 1, Synopsis
Fung. 6:1-387.
MY COTAXON
Volume LXXIX, pp. 67-79 July-September 2001
MUSCODOR ALBUS ANAM. GEN. ET SP. NOV., AN
ENDOPHYTE FROM CINNAMOMUM ZEYLANICUM.
Jeerapun Worapong,' Gary Strobel,’ Eugene J. Ford,' J.Y Li,’ Gary Baird,” and
W.M. Hess”
'Department of Plant Sciences, Montana State University, Bozeman, Montana,
59717.
“Department of Botany and Range Science, Brigham Young University, Provo,
Utah, 84602.
ABSTRACT
Muscodor albus, anam. gen. et sp. nov., is described as a deuteromycetous
(mycelia sterilia) endophytic species bearing molecular relatedness to the
ascomyceteous group Xylaria. The fungus is characterized by producing a whitish
felt-like mycelium on PDA and other media. Commonly, cultures develop 6-12
erumpent pie shaped sectors radiating from the center of the culture at the original
point of inoculation after 4-6 weeks. The hyphae (1.1-1.7 um dia) grow via right
angle branching and commonly intertwine to make rope like strands (3.0-5.0 um
dia) and these can intertwine to make more complex structures. Small mycelial
protuberances (1-5 mm in height) arising from older cultures may be pre-stromatal
structures bearing no spores. The fungus is related to Xylariaceae by virtue of 96-
98% homology of its 18S rDNA (2089 bp) to representative members of this group.
Furthermore, ITS1, 5.8S, and ITS2 sequences (652 bp) of M. albus showed close
relatedness to several Xylaria spp. including X. arbuscula, X. longipes, and X. mali
at the 89-92% level. Under many cultural conditions a musty odor is produced by
this fungus.
Keywords: Xylaria, mycelia sterilia, 18S rDNA, musty odor
INTRODUCTION
It is estimated that up to 95% of the world’s fungi are unknown to science
(Hawksworth, 1991; Hawksworth and Rossman, 1997). One of the most likely,
relatively unexplored, habitats of novel fungi are the world’s rainforests. Fungi can
not only be found inhabiting surfaces, but within the organs and tissues of plants.
Fungi that exist within the tissues are known as endophytes. However, many
endophytes are not reported because most of them produce neither sexual nor
asexual reproductive structures in culture including sclerotia and chlamydospores.
To some degree this taxonomic problem is now being approached using a novel
68
technology termed “Phylogenetic Character Mapping” (Mitchell et al., 1995; Guarro
et al., 1999; Taylor et al., 1999). The phylogenetic character mapping method
involves combining molecular and morphological data with statistical support to
assist in fungal identification. The rDNA genes are frequently targeted for fungal
taxonomy (Bruns et al., 1991; Guarro et al., 1999; Mitchell et al., 1995) because
they are highly conserved regions of molecular information. In addition, the rDNA
genes are found in all organisms with a common function evolutionary origin.
Finally, the rDNA genes are a non-protein-coding region, and they represent a single
nuclear copy that is easy to amplify by PCR techniques. Moreover, several variable
regions including spacers between genes evolve at different rates to a point that it is
possible to recognize taxa at different ranks (Seifert et al., 1995; Bruns et al., 1991).
For example, the nuclear small subunit 18S region has sufficient statistical
divergences for studying relationships at or above generic levels whereas the
internal transcribed spacers, ITS1 and ITS2, are useful to discriminate relationships
near the species level.
In addition to the taxonomic problems associated with fungi that make no
fruiting structures is the obvious question as to how such fungi are dispersed from
one plant to another. It appears that vertical or seed borne transmission of inoculum
can occur from one generation to the next via the germ line, so the need for spore
production by the endophyte may not be strictly necessary for maintaining the
species (Bayman et al., 1998). Thus, some fungal species may have lost the genetic
features essential for spore production since other mechanisms have evolved that
allow for the continuation of the species. Certainly, precedence exists for this
approach from the work done on many amplified DNA’s from ectomycorrhizal
fungi from plants that do not match any sequences from fruiting bodies collected at
the study site (Reynolds and Taylor, 1993). Therefore, naming DNA-only fungi can
be achieved under the present code of Botanical Nomenclature (Reynolds and
Taylor, 1993).
In an attempt to find new natural products that have biological activities, we
have visited many of the world’s rainforests to find endophytic fungi and the
products associated with them. In one case we isolated an endophyte that fits the
description outlined above; that is, under no conditions in culture has it ever been
possible to find any reproductive structures that can serve as tools for a taxonomic
description. In a study of the endophytes of a cinnamon tree (Cinnamomum
zeylanicum), that had been introduced to an area about 30 miles west of La Ceiba,
Honduras, in the earlier part of the last century, a sterile endophytic fungus was
isolated. Cinnamon, among other plant species, was initially placed in this region of
the world in an attempt to find suitable plants to establish an agricultural enterprise
in this area of Central America. Eventually, the needed information was obtained
and the test area eventually became a park for which fees are now collected for
entry. Many of the world’s palms, bamboos, bananas, tropical fruit and nut trees are
located here. It was in this area that several lower limb pieces of the park’s
cinnamon tree were sampled and a number of endophytic fungi were obtained.
Among these was an extremely musty, odoriferous, whitish, strictly mycelial type
fungus. It was of biological and biochemical interest, but it defied a standard
taxonomic description. Thus, the objective of this report is to apply both molecular
techniques and morphological data to show the evolutionary relationships of this
fungus to other fungi and to provide it with a scientific binominal.
69
MATERIALS AND METHODS
Fungal Isolation
Several small limbs of a mature C. zeylanicum tree located 20 miles west of
La Ceiba, Honduras, were removed and immediately transported back to Montana
State University for processing in the fall of 1997. Small pieces of inner bark,
sapwood and outer xylem tissues of the limbs were aseptically removed and placed
on Petri plates containing water agar (Strobel et al., 1996). After incubation for
several days, hyphal tips of developing fungi were asepticlly removed and placed on
potato dextrose agar (PDA). In addition, after 7 days, fungal colonies were
transferred to gamma irradiated carnation leaves (0.5 x 0.5 cm) to encourage spore
production. Of several fungi that were isolated the one of great interest, because of
its musty odor, was an isolate designated — “620.”
Scanning Electron Microscopy
In order to do scanning electron microscopy of isolate 620, agar pieces, leaves
and other plant parts supporting fungal growth were placed into distilled water with
Triton X 100 (wetting agent) and aspirated for 5 min (Strobel et al., 2000). The
fungal preparation was then placed into 2% glutaraldehyde in 0.1 M sodium
cacodylate buffer (pH 7.2-7.4) and left overnight. The next day they were washed in
six 15 min changes of water buffer, followed by three 15 min changes in 10%
ethanol, four 15 min changes of 30% ethanol, five 15 min changes of 50% ethanol
and left for two days in 70% ethanol. They were then rinsed in five 15 min changes
of 95% ethanol and then five 15 min changes in 100% ethanol. The dehydration
process was slowly done to discourage the process of hyphal shriveling which
occurs during rapid dehydration. Ultimately, the fungal material was critically point
dried, gold sputter coated and examined with a JEOL 6100 scanning electron
microscope (SEM).
Fungal Growth and Storage
The fungus was also grown on a number of different media including Tryptic
Soy Broth Agar (TSBA), Corn Meal Agar (CMA), Malt Agar (MA), Potato
Dextrose Agar (PDA) (Difco, Laboratories, Detroit, Mich.). Also the fungus was
inoculated on to Petri plates containing water agar with individual samples of small
wood shavings of western white pine (Pinus monticola), black walnut (Juglans
nigra), and maple (Acer saccharum) as well as bark pieces of C. zeylanicum in order
to encourage spore production.
In order to determine how to best store isolate 620, several conditions were
tried. The fungus was grown on sterilized Whatmann No. | filter paper discs that
were placed on to the surface of PDA in Petri Plates. The fungus was inoculated as
an agar plug in the middle of the filter paper disc on the PDA plate. The plate was
incubated for 14 days at 22°C. The paper disc was then removed and placed in a
laminar flow hood under sterile conditions for 1 day, or until the paper with its
fungal mycelium was dry. The paper disc was then cut into many pieces and stored
under various conditions. Also, agar plugs containing the fungus were placed in
sterile distilled water and stored at 4°C. In another set of test conditions, mycelial
pieces growing on agar were placed in 15% glycerol and stored at -70°C. In each
70
test, fungal viability was determined by placing the mycelial fragments on to a PDA
plate and examining it for fungal growth after 3-4 days.
Fungal DNA Isolation.
For DNA isolation, all fungi were grown in PD broth in 1.5 ml for 18 to 24h
at 23°C. The mycelium was harvested by centrifugation and washed twice with
sterile ddH,O. Total genomic DNA was extracted by the methods of Lee and Taylor
(1990).
Amplification of 18S ribosomal DNA.
Partial nucleotide base pair fragments of the 18S rDNA gene from each
fungus was amplified via the polymerase chain reaction (PCR) as a single fragment
with the primer UK4F (5' CYGGTTGATCCTGCCRG) and UREV
(5°GYTACCTTGACGAACTT). PCR was performed in a 50 wl reaction vial
containing 0.1 pg genomic DNA, 0.4 uM each primer, 0.16 mM four dNTPs and 5u
Taq polymerase (Promega) in a buffer of 10 mM tris-HCl (pH 9.0 at 25°C), 50 mM
KCl, 3 mM MgCh, 0.1% Triton X-100. Amplification was for 30 cycles (45 s at
94.5°C, 45 s at 53.5°C, 90 at 72.5°C).
Amplification of Internal Transcribed Space sequences (ITS) and 5.8S rDNA.
The ITS regions of the test fungus was amplified using PCR and the universal
ITS primers ITSS (5' GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5'
TCCTCCGCTTATTGATATGC) (White et al., 1990). PCR was performed in a 50
ul reaction containing 0.1 pg genomic DNA, 0.4 uM each primer, 0.16 mM four
dNTPs and Su Taq polymerase (Promega) in a buffer of 10 mM tris-HClI (pH 9.0 at
25°C), 50 mM KCI, 3 mM MgCl, and 0.1% Triton X-100. PCR cycling conditions
consisted of denaturation at 94°C for 1.5 min, annealing at 55°C for 2.5 min, and
extension at 72°C for 3 min for 40 cycles, with a final extension at 72°C for 10 min
(Willits and Sherwood, 1999). The PCR products were gel purified and desalted
using the QuickStep PCR purification kit (Edge Biosystems).
Cycle Sequencing 18S ribosomal DNA, ITS Regions and 5.8S rDNA.
PCR product (10-40 ng) was sequenced using ABI prism BigDye terminator
chemistry (Perkin-Elmer) and the primers shown in Table 1. Sequencing conditions
were 25 cycles of 96 for 10 sec, 50 for 5 sec and 60 for 4 min. Isopropanol
precipitation was used to purify extension products (Protocol ABI Prism BigDye
Terminator Cycle Sequencing Ready Reaction Kit, 1998). The reactions were
resolved on an ABI prism 310 Genetic Analyzer (Perkin-Elmer). Nucleotide
sequences were determined on both strands with a Sequencer program (Gene Codes
Corporation, Inc., 1995).
71
Table 1. Primers used for determining 18S rDNA and ITS and 5.8S nucleotide
sequences of isolation # 620
ITS4
Searching and Comparison 18S rDNA and ITS1-2 sequences.
Both 18S rDNA and ITS1-2 sequences of culture collection #620 were
submitted to GenBank with serial numbers AF324337 and AF324336, respectively.
These sequences were also were searched or compared with other fungal sequences
under BLAST 2.1 and a_ search of NCBI at the web _ site
http://www.ncbi.nlm.nih.gov/BLAST. Comparison and alignment sequences were
done by using Clustal W version 1.7 (Thomson and Gibson, 1997), and manually
aligned afterward.
Maximum parsimony bootstrap method (Felsenstein, 1985) with heuristic
search and maximum parsimonious consensus heuristic search were performed
using PAUP* (Swofford, 1999). The bootstrap analysis was set as the following:
100 replications, tree bisection-reconnection branch swapping, and random sequence
addition. All characters were weighted equally. Reference taxa were Taphrinales:
Protomyces inouyei (GenBank serial number D11377), Taphrina_ wiesneri
(D12531), T. deformans (U00971) and T. pruni-subcordatae (AB000957).
RESULTS AND DISCUSSION
Fungal Taxonomy
Muscodor albus Worapong, Strobel, and W.M. Hess, anam. gen. et sp. nov.
Fungus in natura Cinnamomo zeylanico consociatus et est deuteromycete
myceliis sterilibus pertinens. Coloniae fungales albidae mediis omnibus temptatis,
augmen in scobibus ligni specierum aliquot arborum includens, et sic perpetuo
manentes. Mycelium in PDA in 3-4 hebdomadibus patellam tegens et odorem
a2
mucidum validum proprie producens. Culturae vetiores sectionibus cuneiformibus
erumpentibus 6-12 loco originis radiantibus et protuberationibus mycelialibus
pusillis (l1-5 mm alto). Hyphae (1.1-1.7 m dia.) ramificatione in angulis 90°
plerumque crescentes, convolubiles et fila funiformia efficientes (3.0-5.0 m dia.).
Telomorphe hujus fungi in Xylariaceis inveniri possit, ob homologiam 96-98%
ordinis geneae 18S rDNA (2089 bp) inter hanc speciem et illas familiam in base
GenBankea datorum. Data ordia regionis ITS (ITS, 5.88, et ITS2) Muscordoris albi
affinitatem speciebus pluribus Xylariae suggerunt.
Fungus in nature associated with Cinnamomum zeylanicum and is a
deuteromycete belonging to mycelia sterilia. Fungal colonies whitish on all media
tested, including growth on wood shavings of several tree species, and remaining so
perpetually. Mycelium on PDA covering the plate in 3-4 weeks and
characteristically producing a strong musty odor. Older cultures with 6-12
erumpent, pie-shaped sectors radiating from the point of inoculation, and with small
mycelial protuberances (1-5 mm in height). Hyphae (1.1-1.7 m dia.) commonly
growing by 90° angle branching, intertwining and making rope-like strands (3.0-5.0
m dia.).
The telomorph of this fungus may be found in the Xylariaceae, on account of
the 96-98% homology of the 18S rDNA gene sequence (2089 bp) between this
species and that family in the GenBank data base. Sequence data of the ITS region
(ITSI, 5.88, ITS2) of Muscodor albus suggest a relationship to several Xylaria
species.
Holotype: Endophytic on Cinnamomum zeylanicum. Collections were made about
30 miles west of La Ceiba near La Masica, Honduras, in the botanical garden in this
region. The holotype comes from only one C. zeylanicum tree. Collected in
October, 1997 by Gary Strobel. Dried culture deposited in the Montana State
University herbarium (MONT) as Muscodor albus isolate 620, 11/20/2000. A living
culture is also deposited as Muscodor albus in the living MSU mycological
collection as acqusition-2082. Both 18S rDNA and IT IS-2 sequences of M. albus
have been submitted to GenBank with the assigned serial numbers AF324337 and
AF 324336, respectively.
Telomorph: unknown
Etymology: The genus name, Muscodor, for this fungus is taken from the Latin
which means musty. This is consistent with the nature of the odor that is produced
by cultures of this fungus. The species name is the Latin - albus, for white, the
common color of this organism in culture.
Fungal Biology
The fungus produced a white mycelium on the wood chips on numerous plant
species and the bark of C. zeylanicum as well on agar based media (Fig. 1). Small
(1-5 mm) stromata-like protuberances eventually arose, especially in PDA, after 5-6
weeks of incubation (Figs. 2-3). These never developed into true fruiting bodies.
Otherwise, no fruiting structures or spores of any kind have been found when the
fungus has been incubated on multiple synthetic and natural media containing plant
B
if
it
Hf
|
Fig. 1. A 5 week old culture of M. albus grown on PDA.
Fig. 2. Scanning electron micrograph of the macroscopically visible protuberance
arising from a culture of M. albus. Bar=100 pm.
Fig. 3. Top of the protuberance shown in Figure 2. The hyphae appear to have
secreted a substance that has cemented the intertwining hyphae together. Bar=10
um.
if
r Hi
Fig. 4. Scanning electron micrograph of hyphae and mycelium of M. albus 1736.
Please note numerous examples of right or nearly right angle branching (arrows).
Bar=10 um.
Fig. 5. Scanning electron micrograph showing the twisted strands of the hyphae of
M. albus that have further intertwined to make a mycelial mat that is tightly
compressed. Bar=10 pm.
75
extracts or the wood shavings of various plant species for extended periods (4-6
months). Hyphae tended to tightly intertwine making structures that appeared rope
or cable-like. Hyphal branching mostly seemed to occur at right angles (Fig. 4) and
tends to have twisting strands of hyphae in older cultures (Fig. 5). The fungus
remained viable for at least 5 months having been originally grown on filter paper
discs and then placed under storage conditions eg. 22°C, 4°C, 0°C and -70°C. The
fungus also remained viable, but to a reduced degree when stored at 4°C in distilled
water blanks for up to three years. It also remained viable in 15% glycerol/water
when stored at 70°C. There appears to be few of the common characteristics used in
fungal morphology to distinguish this fungus from others. Therefore, other
molecular characters have been studied.
The unique musty odor of the cultures becomes apparent after 1-2 weeks of
incubation. Then, as the mycelium spreads to the entire plate, the odor diminishes.
This may occur as the fungus exhausts the nutrients available to it. Although other
fungi produce low concentrations of volatile substances, some of the volatile
substances of M. albus may occur in other fungi (Bjurman and Kristensson, 1992).
On the other hand, other compounds seem to be unique for one species (Schniirer et
al., 1999). It is typical that the volatile compounds produced by a fungus may be
responsible for a distinctive odor, such as a garlic, spicy, musty, or an unpleasant
smell (Rapior et al., 2000). The volatile compounds produced by a fungus can be
analyzed by GC/MS. Comparisons with the mass spectrum and retention times to
authentic reference materials may help with the identification of the responsible
compound (Schniirer et al., 1999). In a recent study, Aspergillus versicolor was
isolated from several mold affected houses and the gas produced by the fungus was
analyzed by GC/MS. It was learned that Aspergillus versicolor produced
ethylhexanol that correlated with the pungent odor in the cultures (Bjurman and
Kristensson, 1992). Another study reported that the fenugreek odor of Lactarius
helvus was due to a volatile furanone derivative, sotolon (Rapior et al., 2000). In the
case of the musty odor of M. albus, initial GC/MS data have shown the presence of
at least 26 volatile compounds and their identities and biological activities will be
reported elsewhere.
Molecular Biology of Muscodor albus
It has been well demonstrated that the molecular characteristics of an
organism are unique to it and it can be used to help in classification. One of the
most conserved and yet molecularly distinguishing features of an organism is its 18S
rDNA and the IT IS-1&2 sequences. These partial sequences were obtained from M.
albus and compared with data in Genbank. After searching partial 18S rDNA
sequences, 2089 bp of MZ. albus were submitted to an advanced blast search. The
_ results showed 97, 97, 98, 97, 96 and 96% identities with 3032 bp of Xylaria
polymorpha (AB014043), 1773 bp. of Hypoxylon fragiforme (ABO14046), 1715 bp.
Poronia punctata (AF064052), 2590 bp. of Rosellinia necatrix, 2590 bp. of X.
carpophila, and Daldinia concentrica (DCU32402), respectively.
Comparative analysis of the partial ITS 1&2 and 5.88 rDNA sequences of M.
albus hit ITS 1 and 2 of X. arbuscula CBS 452.63 (AF163029) and CBS 454.63
(AF163028), X. Jongipes CBS 148.73 (AF163038), X. mali CBS 385.35
(AF163040), X. cornu-damae CBS 724.69 (Af163031), X. hypoxylon 499.80
76
Protomyces inouyei
Taphrina wiesneri
Sis
T. deformans
T. pruni-subcordatae
Pestalosphaeria hansenii
Discostroma tncellular
Amphisphaeria sp.
Daldinia concentrica
Hypoxylon fragiforme
Muscodor albus
Xylaria sp.
X. carpophila
Poronia punctata
X. curta
X. hypoxylon
X. polymorpha
Rosellinia necatrix
Fig. 6. Strict consensus of 6 equally most parsimonious heurisitc search cladograms
containing 13 taxa of Xylariales (1) and 4 taxa of Taphrinales (2). The designated
outgroup is Taphrinales.
ay
Protomyces inouyei
2
2 Taphrina wiesneri
T. deformans
Be 62
T. pruni-subcordatae
Pestalosphaena hansenii
99
Discostroma tricellular
97
66 Amphisphaenia sp.
ie Daldinia concentrica
| 84
Hypoxylon fragiforme
100
Muscodor albus
Xylaria sp.
a8 X. carpophila
1
Poronia punctata
69 x. curta
X. hypoxylon
X. polymorpha
Rosellinia necatrix
Fig. 7. Maximum Parsimony phenogram of 18S rDNA sequences of Xylariales (1)
and Taphrinales (2) as an outgroup. Bootstrap confidence measures greater than
50% from 100 replications are indicated at internodes.
78
(AF 163035) at 92, 91, 91, 91, 90 and 89% homologies, respectively. No total
identities were found.
Overall it appears, based on phylogenetic analysis and comparisons of 18S
rDNA sequences of M. albus to sequences of Xylariales in the Genbank that it is
more closely related to the Xylariaceae eg. Xylaria, Poronia and Rosellinia than
Amphishaeriaceae eg. Pestalosphaeria hansenii, Discostroma tricellular and
Amphisphaeria sp. with bootstrap confidence measured at greater than 50% from
100 replications (Figs. 6 & 7). Also, given the fact that the both the 18S rDNA and
the ITS 1&2 5.8 S rDNA are unique, this may be added molecular justification that
M. albus should be considered a taxonomically distinct genus and species. Although,
Reynolds and Taylor (1993) suggest that, given the strength of molecular
technology. it should be possible to name a DNA-only fungus on the basis of its
closest neighbor on the genetic tree. Convention, however, may dictate that such a
practice may not be acceptable since its usurps an accepted name without providing
a proper morphological basis for use of the same name. Therefore, even though
isolate 620 best fits the molecular profile of the Xylariales, science may be better
served by the placement of a totally new binominal on this organism, thus--
Muscodor albus. Further chemical and spectral analyses of the volatile gasses
produced by this fungus should provide added evidence for its uniqueness.
ACKNOWLEDGEMENTS
The authors appreciate the helpful discussions and assistance provided by Dr.
Jack Rogers of Washington State University. Also, Dr. John Taylor of the
University of California, Berkeley, kindly consulted with us on this project. Ms.
Mary Bateson, of the MSU sequencing lab provided all sequence data shown in this
report. Financial help was provided by the Montana Agricultural Experiment
Station, and a fellowship to J.W. by the Government of Thailand and P.E.O.
scholarship.
REFERENCES
Bayman, P., Angulo-Sandoval, P., Baez-Ortiz, Z., and Lodge, D.J. 1998.
Distribution and dispersal of Xylaria endophytes in two tree species in Puerto
Rico. Mycol. Res. 102: 944- 948.
Bjurman, J. & Kristensson, J. 1992. Volatile production by Aspergillus versicolor
as a possible cause of odor in houses affected by fungi. Mycopathologia. 118:
173-78.
Bruns, T. D., White, T.J., and Taylor, J. W. 1991. Fungal molecular systematics.
Annu. Rev. Ecol. Syst. 22: 525-564.
Felsenstein, J. 1985. Confidence intervals on phylogenies: an approach using the
bootstrap. Evolution. 39: 783-791.
Guarro, J., Gene, J., and Stchigel ALM. 1999. Developments in Fungal Taxonomy.
Clinical Microbiology Reviews. 12: 454-500.
Hawksworth, D.L. 1991. The fungal dimension of biodiversity: magnitude,
significance, and conservation. Mycol. Res. 95: 641-655.
any
REFERENCES
Bayman, P., Angulo-Sandoval, P., Baez-Ortiz, Z., and Lodge, DJ. 1998.
Distribution and dispersal of Xylaria endophytes in two tree species in Puerto
Rico. Mycol. Res. 102: 944- 948.
Bjurman, J. & Kristensson, J. 1992. Volatile production by Aspergillus versicolor
as a possible cause of odor in houses affected by fungi. Mycopathologia. 118:
173-78.
Bruns, T. D., White, T.J., and Taylor, J. W. 1991. Fungal molecular systematics.
Annu. Rev. Ecol. Syst. 22: 525-564.
Felsenstein, J. 1985. Confidence intervals on phylogenies: an approach using the
bootstrap. Evolution. 39: 783-791.
Guarro, J., Gene, J., and Stchigel ALM. 1999. Developments in Fungal Taxonomy.
Clinical Microbiology Reviews. 12: 454-500.
Hawksworth, D.L. 1991. The fungal dimension of biodiversity: magnitude,
significance, and conservation. Mycol. Res. 95: 641-655.
Hawksworth, D.L. and Rossman, A.Y. 1997. Where are all of the undescribed fungi.
Phytopath. 87: 888-891.
Lee, S. B. and Taylor, J. W. 1990. Isolation of DNA from fungal mycelia and single
spores. In: PCR Protocols: A guide to Methods and Applications. Edited by
Innis, M. A., Gelfand, D. H., Sninsky J. J., White, T. J. Academic press, Inc.,
California: 282-287.
Mitchell, J. I., Roberts, P. J. and Moss, S. T. 1995. Sequence or Structure? A Short
Review on The application of Nucleic Acid Sequence Information to Fungal
Taxonomy. Mycologist. 9: 67-75.
Rapior, S., Fons, F., and Bessiére, J. 2000. The fenugreek odor of Lactarius helvus.
Mycologia. 92: 305-308.
Reynolds, J., and Taylor, J.W. 1993. The Fungal Holomorph: Mitotic, Meiotic, and
Pleomorphic Speciation in Fungal Systematics. Proceedings of an
International Symposium Wallingford: C.A.B International.
Schniirer, J., Olsson, J., and Borjesson, T. 1999. Fungal volatiles as indicators of
food and feeds spoilage. Fungal Genetics and Biology. 27: 209-217.
Seifert, K. A., Wingfield, B. D. and Wingfield, M. J. 1995. A Critique of DNA
Sequence Analysis in the Taxonomy of Filamentous Ascomycetes and
Ascomycetous Anamorphs. Can. J. Bot. 73(Suppl. 1): 760-767.
Strobel, G. A., Yang, X., Sears, J., Kramer, R., Sidhu, R. S. and Hess, W. M. 1996.
Taxol from Pestalotiopsis microspora, an endophytic fungus of Taxus
walliachiana. Microbiology. 142: 435-440.
Strobel, G.A., Ford, E., Worapong, J., and Hess, W.M. 2000. Pestalotiopsis jesterii
sp. nov. an endophyte from Fragraea bodeni from the southern highlands of
Papua New Guinea. Mycotaxon. 76: 257-266.
Swofford, D. L. 1999. Phylogenetic Analysis Using parsimony (*and Other
Methods). Version 4.0d64. Sunderland, MA: Sinauer Associates.
Taylor, J. W., Jacobson, D. J. and Fisher, M. C. 1999. The Evolution of Asexual
fungi: Reproduction, Speciation and Classification. Annu. Rev. Phytopathol.
37: 197-246.
a
*
me
ue we bd
a
yy
iw "
Mh, ;
~
~
io
’ A
oe
a
ra,
- a>
a We fede
mY
‘oh wu *e A J ihe
Sy
a ads neal iH & a
(ty reas
Hobs ar
j ww
—
eal eo ae .
r see * 2 cee, Le
His Mie je Lay ce. st My 4
ale me r¥ b f ee k
SSE hah r ae Oy: AS soike Me
Ms pay rs iad oat Re Ra) vt wie te
ane i ‘it iif song eit, oh ie
| gil iy . Mee :
la :
MYCOTAXON
Volume LXXIX, pp. 81-86 July-September 2001
HISTERIDOMYCES TISHECHKINII SP. NOV., A NEW
SPECIES OF LABOULBENIALES (ASCOMYCETES)
FROM NEW ZEALAND
Alex Weir
Faculty of Environmental & Forest Biology,
SUNY College of Environmental Science & Forestry,
350 Illick Hall, 1 Forestry Drive, Syracuse, NY 13210, USA
Abstract: A new species of the genus Histeridomyces, H. tishechkinii, is formally described
and illustrated. Thalli were found on various body parts of Parepierus sp. (Coleoptera,
Histeridae, Tribalinae) from New Zealand. The new species is compared to other known species
of Histeridomyces on the basis of morphology, host relationships, and geographical distribution.
Keywords: fungi, Histeridae, New Zealand
Introduction
Beetles belonging to the family Histeridae are usually readily recognizable by the strongly-
convex, oval bodies and the hard, generally shiny, exoskeleton of the adult stage. Histerids are
probably all carnivores, preying on mites, insect larvae, and primitive insects inhabiting dung,
carrion, decaying vegetable matter and sub-cortical microhabitats.
The Laboulbeniales known to parasitize beetles belonging to this family are few in number. To
date representatives of only four genera of these ascomycete fungi; Histeridomyces Thaxt.,
(Thaxter, 1931); Homaromyces R. K. Benj., (Benjamin, 1955); Laboulbenia Mont. & C. P.
Rob., (Robin, 1853); and Rhipidiomyces Thaxt., (Thaxter, 1931), have been reported on hosts
belonging to the genera Aeletes(as Acritus), (Abraeinae, Acritini) Epierus, (Tribalinae)
Eubrachium, (Abraeinae, Plegaderini), Plagiogramma (as Epierus) (Tribalinae), and
Sternocoelopsis, (Hetaeriinae), with an additional, doubtful, report on Margarinotus (Histerinae,
Histerini)(Stadelmann & Poelt, 1962).
Histeridomyces, the subject of this study, includes five described species: H. acriti Thaxt.
described on Aeletes (as Acritus) sp. nr. simpliculus de Marseul from Barro Colorado Island,
Panama (Thaxter, 1931); H. europaeus W. Rossi described on Eubrachium hispidulus (Bremi-
82
Wolf) (as E. pusillus Rossi) from Italy (Rossi, 1980); H. flagelliferus Thaxt. described on
Plagiogramma incas de Marseul from Venezuela (Thaxter, 1931); H. ramosus Thaxt. described
on Epierus lucidulus Erichson and another undetermined species of Epierus from Venezuela
(Thaxter, 1931); and H. venezolanus Thaxt. described on P. incas (as Epierus) from Venezuela
(Thaxter, 1931). None of these species have been re-collected following their initial description.
The purpose of this study is to describe a new species of Histeridumyces, H. tishechkinii found
parasitizing a species in the genus Parepierus H. Bickhardt (Tribalinae) from New Zealand.
This collection greatly expands the known distribution of the genus Histeridomyces as all
previous reports have been from tropical Central and South America, and Southern Europe.
Materials and Methods
Host insects were collected using standard entomological techniques by R.A.B. Leschen (New
Zealand Arthropod Collection- NZAC), and C. E. Carlton (Louisiana State Arthropod
Museum). Collected insects were stored in 70% ethanol for transport to the laboratory. For
making microscopic observations, fungi were mounted in glycerol in accordance with the
techniques outlined by Benjamin (1971, 1986). The holotype of the newly described species is
deposited in the New Zealand Fungus Collection (PDD) with isotypes in the Mycological
Herbarium at the institutional address of the author (SYRF).
Taxonomy and Results
Histeridomyces tishechkinii A.Weir sp. nov.
Fungus hyalinus, repens ac expansus. Longitudo a pede usque ad perithecii apicem 135-195 um.
Receptaculi basalis cellula longior quam latior, ad rotundatum pedem decrescens. Cellula II
quadriangula aut latior quarn longior; cellula IIT quadriangula aut applanata, primum axem et
duos oppositos, secundarios axes sufferens. Primus axes 4-5 superpositis cellulis gradatim
longioribus ac tenuioribus constans. Secundarii axes elongati, divergentes, repetite divisi.
Perithecium singulum, aequale, ellipticum aut ovoideum, contracto apice 4 brevibus labiis
praedito; perithecii stirps 4-5 superpositis quadriangulis cellulis constans. Antheridia solitaria,
ampulliformia, ex secundariis appendicis orientia. Parasitus Parepieri sp. in Nova Zeelandia.
Ascoma hyaline, with generally repent, spreading, habit. Total length from foot to tip of
perithecium 135-195 um. Receptacle basal cell (1) 15-20 x 10 um, longer than broad, tapering
below to the inflated, circular, black foot. In many specimens the foot appears to be intercalary
with resultant. axes arising in 2 directions. Cell I] 10 x 5-8 um quadrate to broader than long,
giving way distally to a third, quadrate to flattened, superposed cell that typically forms
secondary axes branching left and right, in addition to supporting the erect primary axis. In
some specimens there may be repeated divisions of cell II forming a lower receptacle of
Fig. |. Immature stage with well developed foot cell and outgrowth from cell II
initiating the secondary receptacle 2. Antheridial branch with distinct flask shaped
antheridium 3. Immature thallus with developing perithecium (per) and primary
appendage (pa) 4. Immature thallus lacking perithecial development 5. Immature
thallus with developing perithecium (per) and antheridia (an) 6-7 Mature thalli with
antheridial scars (an) Scale Bars = 20 um. Figs 1, 2 = Scale Bar A; Figs 3-7 = Scale
Bar B.
83
84
superposed cells. Primary axis usually consisting of 4-5 additional, superposed cells, which
become gradually longer and narrower distally, the terminal cell spinose. Secondary axes long,
divergent, branched |-3 times with differentiated accessory appendages associated with the
development of each perithecium. Perithecium typically only one per thallus, 50-75 x 20-40
um, symmetrical, elliptical to ovoid, tapering abruptly to a narrow apex with 4 short lip cells.
Perithecial basal cells small and hardly distinguished. Perithecium with 4 cells of unequal height
in each vertical row of outer wall cells. Stalk cell multicellular, consisting of a superposed series
of 3-4 quadrate to rectangular cells. Trichogyne a simple filament. Antheridia 10 x 5 um
simple, stout, flask-shaped, solitary and borne from cells of the accessory appendages on the
secondary axes.
HOLOTYPE: New Zealand: South Island; Otago Lakes District, 17km NW Glenorchy, on the
elytra, abdomen, and legs of Parepierus sp. (Coleoptera, Histeridae), under bark of rotten log,
28 Jan. 1999, leg. R. A. B. Leschen and C. Carlton, PDD 72040
ISOTYPES: same collection data as above, in coll. SYRF (AW-844).
Etym.: This new species is named for Alexey Tishechkini, student of the Histeridae, who
identified the host on which this fungus was found.
H. tishechkinii differs from H. acriti and H. venezolanus in its more repent habit, the production
of single, non-terminal, antheridia from cells of the accessory appendages, and in the size and
shape of the perithecium.
The new species also differs from H. ramosus and H. flagelliferus in the lack of terminally-
produced antheridia and in the distinctly intercalary development of the foot.
Based on gross morphology, H. tishechkinii is perhaps most closely allied with H. europaeus.
Both of these taxa have a generally repent habit, and the foot occupies an intercalary position.
H. tishechkinii differs in typically forming only one perithecium on each thallus, and in lacking
the extremely long braches of the secondary axes exhibited by H. europaeus. The new species is
also unusual within the genus Histeridumyces in possessing single, simple antheridia that form
directly from cells of the accessory appendages. It is uncertain whether or not this character is
present in H. europaeus since no structures undoubtedly referable to antheridia were observed
in any of the many specimens observed by Rossi (1980).
The two recognized subfamilies of Histeridae known as hosts of Histeridomyces spp..,
Abraeinae and Tribalinae, are thought to be only distantly related, with members of Tribalinae
being basai and Abraeinae more advanced (Slipinski and Mazur, 1999). It is of some interest,
therefore, that these subfamilies share obviously closely-related parasites, with the presumed
nearest relative of the newly described parasite species H. tishechkinii occurring on a host
85
Figs 8-9 Mature thalli with antheridial scars (arrowheads).
Scale Bars = 10 pm
currently classified in a different sub-family. Bearing in mind the habitat preferences of all of
the known hosts of Histeridomyces for subcortical space in dead wood it seems likely that the
pattern of occurrence of Laboulbeniales parasites on Histeridae has more to do with shared
habitat characteristics than with host taxonomy. Unlike the patterns of host utilization reported
in the Staphylinidae (Frank, 1982), the patterns observed in Histeridae may, thus, not be a good
indicator of phylogenetic history.
Acknowledgments
I am grateful to Rich Leschen and Chris Carlton for provision of the insect samples from New
Zealand on which this new species was found. I am also indebted to Alexey Tishechkini for
identification of the host. This study was supported by National Science Foundation Grant
DEB-9972083.
86
Literature cited
Benjamin, R. K. (1955) New genera of Laboulbeniales. Aliso 3: 183-197.
Benjamin, R. K. (1971) Introduction and supplement to Roland Thaxter’s
contribution towards a monograph of the Laboulbentaceae.
Bibliotheca Mycol. 30: 1-155.
Benjamin, R. K. (1986) Laboulbeniales on semiaquatic hemiptera. V.
Triceromyces: with a description of monoecious-dioecious
dimorphism in the genus. Aliso 11: 245-278.
Frank, J. H. (1982) The parasites of the Staphylinidae (Coleoptera). Bull.
Florida Agric. Exp. Sta. 824: 1-118.
Robin, C. P. (1853) Histoire Naturelle des Végétaux Parasites qui Croissent
sur l’Homme et sur les Animaux Vivants. J.-B. Bailliére, Paris 702pp
Rossi, W. (1980) On two Laboulbeniales (Ascomycetes) parasitic on
Histeridae (Insecta, Coleoptera). Mycologia 72: 430-433.
Slipinski, S. A., and S. Mazur (1999) Epuraeosoma, anew genus of
Histerinae and phylogeny of the family Histeridae (Coleoptera,
Histeroidea). Annales Zoologici (Warsaw) 49(3): 209-230
Stadelmann, M., and J. Poelt (1962) Zur Kenntnis der mitteleuropdischen
Laboulbeniales. Ber. Bayer. Bot. Ges. 35: 120-132.
Thaxter, R. (1931) Contribution towards a monograph of the
Laboulbeniaceae. Part V. Mem. Amer. Acad. Arts Sci. 16: 1-435.
MY COTAXON
Volume LXXIX, pp. 87-99 July-September 2001
PERONOSCLEROSPORA ERIOCHLOAE SP. NOV. AND OTHER DOWNY
MILDEWS ON NATIVE GRASSES IN QUEENSLAND, AUSTRALIA
M.J. RYLEY!” & R.F.N. LANGDON!”
' Botany Department, University of Queensland, St. Lucia, Queensland, Australia 4067
* current address: Queensland Department of Primary Industries, PO Box 102,
Toowoomba, Queensland, Australia 4350
retired
Corresponding author: ryleym@dpi.qld.gov.au
ABSTRACT
A new species of downy mildew, Peronosclerospora eriochloae, found on Eriochloa
pseudoacrotricha, is described and illustrated. The morphology and taxonomic status
of Peronosclerospora noblei, found only on Sorghum leiocladum in Australia are
discussed. Both downy mildews are systemic within their hosts, the asexual and sexual
states developing on vegetative tillers which have more nodes and wider leaves than
healthy flowering tillers. The morphology of the sexual states of unidentified downy
mildews on three other wild grasses, known only from herbarium material, is also
given.
Keywords: Peronosclerospora noblei, downy mildew
INTRODUCTION
Three of the nine downy mildews that have been recorded on grasses in
Queensland, Australia (Table 1), namely Peronosclerospora maydis (Racib.) C.G.
Shaw, Peronosclerospora sacchari (Miyake) Shirai & Hara, and Sclerophthora
macrospora (Sacc.) Thirum., C.G. Shaw & Naras., cause serious losses of cultivated
annual grasses, eg., maize (Zea mays L.), sorghum [| Sorghum bicolor (L.) Moench] and
sugarcane (Saccharum officinarum L.) in several countries. According to distribution
maps published in Commonwealth Mycological Institute (1988) and in Bock and Jeger
(1996), Peronosclerospora sorghi (Weston & Uppal) C.G. Shaw has also been recorded
in Queensland. However, these records are incorrect because specimens of a downy
mildew on maize which were tentatively identified as P. sorghi at the Commonwealth
Mycological Institute were reexamined and considered to be P. maydis (Stamps, pers.
com.). Ramsey and Jones (1988) confirmed the identity of this downy mildew as P.
maydis.
During a study of systemic diseases of subtropical grasses in southern
Queensland, Australia, downy mildews were found on Sorghum leiocladum (Hack.)
Hubb. (wild sorghum) and Eriochloa pseudoacrotricha (Stapf ex Thell.) J.M. Black
(early spring grass). Langdon (1950) had already recorded Sclerospora noblei Weston
[= Peronosclerospora noblei (Weston) C.G. Shaw] on S. leiocladum at Hirstglen in
88
[= Peronosclerospora noblei (Weston) C.G. Shaw] on S. leiocladum at Hirstglen in
southern Queensland. That downy mildew was described by Weston (1929, 1942) from
material collected in the Glen Innes district of northern New South Wales. In the
United States, Kubicek and Kenneth (1984) gave a brief description of the first downy
mildew recorded on Eriochloa spp., which they tentatively named Peronosclerospora
globosa. However, that name has never been validly published. The downy mildew on
Eriochloa in Australia has characteristics which distinguish it from P. globosa, and is
here described as a new species.
The Sclerospora species on Eragrostis sp., Sorghum plumosum (R.Br.) Beauv.
and Triodia pungens R.Br. in Queensland are known only from herbarium specimens
which consist of frayed leaves containing oogonia. This paper presents data on the
morphology of the downy mildews on S. leiocladum and E. pseudoacrotricha from
studies on living plants, and on Eragrostis sp., S. plumosum and T. pungens from
herbarium material. The taxonomic status of these downy mildews is also discussed.
Table 1. Graminicolous downy mildews recorded in Queensland
ty Pathvogem 0h) [Sais Sa ELT P| A TINY Reference MIN
Peronosclerospora (Ito)
Shirai & Hara
eriochloae sp. nov.
maydis
Eriochloa pseudoacrotricha
Sorghum plumosum
Zea mays
Sorghum leiocladum
Present report
Ramsey and Jones (1988)
Ramsey and Jones (1988)
Langdon (1950); present
noblei
report
sacchari Saccharum officinarum Leece (1941)
sp. Zea mays Unpublished’
Sclerophthora Thirum.,
C.G. Shaw & Naras.
macrospora
Axonopus compressus (Sw.) P. | Steind! (1957)
Beauv.
Brachiaria mutica (Forssk.)
Stapf
Digitaria ciliaris (Retz) Koeler
Panicum maximum Jacq.
Pennisetum purpureum
Schumacher
Saccharum officinarum
Sorghum bicolor
Sorghum verticilliflorum
(Steudel) Stapf
Zea mays
Steindl (1957)
Steindl (1957)
Steindl (1953)
Steindl (1953)
Steind! and Smith (1952)
Unpublished?
Steind! and Smith (1952)
Unpublished”
Sclerospora (Schrot.) de
Bary
sp.
sp.
sp.
Eragrostis sp.
Sorghum plumosum
Triodia pungens
Simmonds (1966)
Unpublished’
Unpublished?
' All hosts, other than Sorghum bicolor and Zea mays, are perennial
* Unpublished records; specimens held in BRIP
89
THE QUEENSLAND DOWNY MILDEWS
1. Peronosclerospora eriochloae Ryley & Langdon sp. nov. on Eriochloa
pseudoacrotricha
Mycelium hyalinum, non-septatum; oogoniis luteolis, globosis vel subglobosis levis, 33-(46.6 + 6.4)-70
uum diameter; parietes oogonialis, hyalini, 1.0-1.5 um crass, confluentes cum pariete oosporis; oosporii,
hyalini, globosis, 27-(33.5 + 3.1)-46 um diameter, germinatione oosporae nondum visa; pariete oosporis
bistratus, exosporium rubro-brunneum, 2-15 tm crassa, endosporium hyalinum, 2-3 pm crassa;
conidiophores erectis, 2-4 dichotomo-ramosis, 245-280 um altis, 45-100 um ad locum latissimum,
sterigmatibus coniodo-subulatis, 4-9 tm longis, 3-4 um crassa; conidiis globosis vel subglobosis,
hyalinis, paries unitunicatus, sine operculo vel poro, 9-(13.3 + 1.1)-18 x 9-(12.0 + 1.4)-12 tm, semper
germinantia per germinationis tubos.
Hospes: Erichloa pseudoacrotricha: Allora, Queensland, 31.i11.1979, M.J. Ryley (BRIP 13691); Esk,
Queensland, 1.iv.1979, M.J. Ryley (BRIP 13692); Upper Pilton, Queensland, 9.iv.1979, M.J. Ryley
(HOLOTYPUS: BRIP 13693).
Mycelium hyaline, nonseptate. Oogonia orange to luteus (Rayner, 1970), globose to subglobose, 33-
(46.6 + 6.4)-70 xm in diameter. Oogonium wall hyaline, 1.0-1.5 um thick, confluent with oospore wall.
Oospores, one per oogonium, hyaline and globose, 27-(33.5 + 3.1)-46 tm in diameter. Oospore
germination not observed. Oospore wall of two layers, a reddish-brown exosporium 2-15 pm thick, and
the hyaline endosporium 2-3 ym thick. Conidiophores emerge through stomata from hyphae in the
substomatal cavities reaching a total length of 245-280 um. Main axis of conidiophore swollen at the
base (6-13 tm in diameter), gradually decreasing in diameter to 6-9 um wide at a septum, 90-115 um
from the base. Above the septum the axis diameter increases to 20-30 um at the start of the branches.
Branching system dichotomous, with secondary, tertiary and quaternary branches, 45-100 um wide.
Sterigmata at tips of branches, conoid-subulate, 4-9 um long, 3-4 um wide. Conidia globose —
subglobose, hyaline, without operculum or pore, 9-(13.3 + 1.1)-18 x 9-(12.0 + 1.4)-12 um, germinating
by one or two germ tubes. The asexual and sexual states of P. eriochloae are illustrated in Figure 1.
The dichotomous branching of the conidiophores, iterative germination of
conidia, and the morphology of the oogonia places this downy mildew in
Peronosclerospora (Shaw, 1978). However, the morphological features of the asexual
and sexual states of the downy mildew on Eriochloa pseudoacrotricha differ from all
the recognised Peronosclerospora species. It closely resembles Sclerospora secalina
Naumov in the characteristics of its oogonial state. That downy mildew was described
by Naumov (1949) on Secale cereale L. on the basis of its sexual state only. The
description of S. secalina is confusing because the upper limit for the diameter of
oospores is greater than the maximum diameter of oogonia, an inconsistency noted by
Waterhouse (1964). Shaw (1975) offered the opinion that the material on which S.
secalina was based was a collection of Sclerophthora macrospora, a downy mildew
known to infect S. cereale.
Kubicek and Kenneth (1984) gave a brief description of a downy mildew which
they had found on Eriochloa contracta Hitchcock in Texas, USA. It infected E.
contracta, Eriochloa crebra §.T. Blake and Eriochloa nubica Stapf, but not sorghum or
maize. Conidia were globose, occasionally subglobose, and 12-18 um wide, and
oospores were 28-36 ym in diameter, in adherent oogonia 40-54 um in diameter.
Kubicek and Kenneth considered the downy mildew to be a new species, and named it
Peronosclerospora globosa. However, this name has never been validly published in
accordance with Article 36 of the International Code of Botanical Nomenclature, so it
must be considered a nomem nudum. In most respects the characteristics of the
oospores and conidia of the Texas Eriochloa downy mildew are similar to those of the
Queensland specimens. Lack of further information prevents a definitive conclusion to
90
20 ym
20 ym
re) Se
jag 20 ym
en
eX
Figure 1. Peronosclerospora eriochloae. A conidiophores; B germinating conidia; C
oogonia showing exosporium (ex), endosporium (en) and oil globule (0).
a
be made on the relationship between the Eriochloa downy mildews in Queensland and
Texas.
Kubicek and Kenneth (1984) made a brief mention of an Australian specimen in
their article. They were undoubtedly referring to two specimens of Peronosclerospora
found on E. crebra in New South Wales (see below), because both specimens contain a
short note written by Kenneth and dated 9 October 1984. There was profuse asexual
sporulation on both leaf surfaces in the specimens, the conidia being subglobose,
hyaline and 15-19 x 13-17 um. The conidia were broader than those of P. eriochloae,
so the identity of the New South Wales specimens remain uncertain until fresh
specimens, with conidia and oogonia, are examined.
Specimens examined: On Eriochloa crebra: Bourke, New South Wales, D. Campbell, 9.ix.1979 (DAR
34156); Bourke, New South Wales, D. Campbell, 30.i.1980 (DAR 35870).
Erichloa pseudoacrotricha (early spring grass) is a perennial, tussocked grass
with winter dormancy in southern Queensland. Tiller production is closely linked to
rainfall, with individual tussocks having more than one period of tiller production
during its growing season (September to April). Peronosclerospora eriochloae survives
as hyphae in the tiller bases of its host. There the hyphae are coenocytic, branched,
thin-walled, 3-6 um wide, and are always found intercellularly in the parenchyma near
the vascular strands. When tiller buds begin to elongate in response to rain, hyphae
grow into some of the buds and not into others. Uninvaded buds developed into
healthy, flowering tillers while invaded tiller buds develop into systemically infected
tillers. In the field, individual tussocks may be entirely healthy or have both healthy
flowering tillers and infected vegetative tillers in varying proportions.
The asexual and sexual reproductive structures of P. eriochloae are confined to
tillers which differ markedly from healthy flowering tillers. These special tillers are
vegetative, there being no development of an inflorescence at the apical growing point.
They are approximately equal in height to flowering tillers (mean height 55.3 cm vs
60.8 cm), have more nodes (mean number 6.6 vs 3.8), and bear wide, upright chlorotic
leaves (mean width 9.6 mm vs 3.6 mm).
Conidiophores bearing conidia develop from substomatal cavities on both
surfaces of chlorotic leaf blades, with sporulation beginning at the leaf tips and
extending in a series of steps towards the ligule over time. Soon after infected tillers
reach their maximum height the uppermost leaves die and begin to fray from the tips,
due to the pressure exerted on the vascular bundles as the oogonia of P. eriochloae
expand in the interfascicular spaces. The presence of tall tillers bearing necrotic frayed
leaves is a dominant feature of the symptom picture in the field during the grass’s
dormant period.
Infected seedlings have been observed growing in the vicinity of mature infected
tussocks at a number of localities in southern Queensland. Symptoms developed when
seedlings were 15 cm high, with one or two culms bearing two basal green leaves and
one or two wide, partly chlorotic leaves. On the loweremost chlorotic leaf, chlorosis
was confined to the basal part of the leaf blade. Conidiophores bearing conidia of
Peronosclerospora eriochloae only developed on the chlorotic areas of leaf blades.
Fourteen-day-old seedlings of early spring grass which had been grown from
surface-sterilised seed were inoculated with conidia of P. eriochloae by spraying with a
suspension of 1 x 10* conidia/ml. Forty to fifty days after inoculation, tillers bearing
wide chlorotic leaves (on which sporulation occurred) developed. The seedlings were
92
transplanted into garden plots at the University of Queensland, St. Lucia, Queensland,
where they grew into large tussocks which produced both healthy and infected tillers
over the next two growing seasons.
2. Peronosclerospora noblei (Weston) C.G. Shaw on Sorghum leiocladum
Sclerospora noblei was described by Weston (1929) on a grass then identified
as Sorghum plumosum. It was shown by Hubbard (1938) that the grass was distinct
from S. plumosum, so he named it Sorghum leiocladum. It is now known that Sorghum
plumosum is restricted to the northern tropical parts of Australia, while S. leiocladum
grows in upland areas of the subtropical and temperate zones of eastern Australia
(Vickery, 1961). The original description of S. noblei (Weston, 1929) was based on
oosporic material collected at Glen Innes, New South Wales and later Weston (1942)
described the asexual state from preserved material sent to him by R.J. Noble. Weston
(1942) noted that the conidium walls of S. noblei lacked a thickened, modified papilla
for dehiscence, and that the spores germinated by germ tube(s). He also considered that
its characteristics precluded S. noblei from any alliance with the sporangium-producing
S. graminicola (Sacc.) Shrét. On the basis of Weston’s observations, Shaw (1980)
transferred S. noblei to Peronosclerospora. The downy mildew has been recorded only
in Australia, and on one host, Sorghum leiocladum.
The characteristics of Peronosclerospora noblei listed below are summarised
from Weston (1929, 1942) -
Conidiophores 300-450 um long, comprising a basal swollen cell 8-(10)-13 um wide extending 68-110
um to a delimiting septum, a main axis expanding gradually, 120-(170)-200 um x 20-(28)-34 um, and a
_ branch system 70-130 pm x 100-130 pm with 2-4 primary branches, then secondary, tertiary and
quaternary branches each terminating in a tapering sterigma 10-15 pm long bearing a conidium; conidia
obovoid, 21-(25-31)-39 um x 13-(17-23)-31 pm, hyaline, with a thin unmodified wall and germinating by
hyphae; oogonia ovoid-spherical, occasionally with bluntly rounded projections, 28-44 ym in diameter,
oogonial wall closely adherent to the oospore within, wall 3-(5-10)-20 ym thick, rich golden-brown;
oospores spherical 20-(23-29)-34 tm, wall hyaline, pale golden, 1-3 um thick, germination not observed.
Downy mildew-infected tussocks of S. leiocladum were found at upland
localities in south-eastern Queensland. Several tussocks were transplanted to a garden -
plot at the University of Queensland, St. Lucia, Queensland to provide a source of fresh
sporulating material. The morphology of the asexual and sexual states of this downy
mildew could then be compared with the descriptions of P. noblei (Weston, 1929, 1942)
which had been based on preserved material.
Two types of mature conidiophores were found (Table 2). The first, here
referred to as the normal type, comprised the vast majority of conidiophores. The
second “abnormal” type was occasionally formed both in the field and in the laboratory.
The characterisitics of the mature “normal” conidiophores were identical in most
respects to those given by Weston (1942), except that he stated that sterigmata were 10-
15 um long, whereas in this study they were found to be 10-40 um depending on
whether they were on secondary, tertiary or quaternary branches.
The asexual spores formed on the “normal” and “abnormal” conidiophores were
similar in most respects to those described by Weston (1942). The walls of the conidia
were thin, hyaline and smooth and did not have any apical thickening or modification.
There were differences in spore dimensions between Weston (1942) and the present
study. The conidia collected from transplanted tussocks were 21-(27.6+2.3)-35 um x
13-(23.2+2.3)-31 um , being the same length, but wider than those reported by Weston
93
(1942). The discrepancy between Weston’s data and that of the present study may be
due to the use of preserved material by Weston.
Table 2. Some characteristics of normal and abnormal conidiophores of
Peronosclerospora noblei
Characterisities | Weston (1942)
Total length (um) 70 - 184
Basal cell (um) absent
Branches’ None, 1° or 2°
Sterigmata length (um) 30 - 40(1°), 15-20(2°)
Spores/conidiophore 3-8
' 1°, 2°, 3°, 4° = primary, secondary, tertiary and quaternary branches
The mode of conidium germination was studied by spraying freshly harvested
conidia onto 1.5% water agar in 9 cm plastic petri dishes, which were sealed and
incubated in the dark at 4°C intervals between 16°C and 32°C. The spores germinated
directly at all temperatures by producing one or rarely two thin-walled aseptate germ
tubes 3-5 um in diameter.
Oogonia collected from frayed leaves of S. leiocladum at several localities in
southern Queensland and in the vicinity of the type locality in New South Wales were
identical in every respect to those described for Sclerospora noblei by Weston (1929).
The characteristics of the sexual state of this species based on these collections are —
Sexual state consisting of an oospore borne singly and surrounded by a thick wall of two fused elements,
a thin oogonium wall, and a thick exosporium; oogonia 28-44 ym in diameter, ovoid, elliptical or
subglobose, with flattened sides bordered by inconspicuous ridges, outer surface of the oogonium
generally smooth, occasionally scabrid, remnants of the oogonial stalk or of the antheridium sometimes
adherent to the oogonium; oogonium wall hyaline and 1.0-1.5 um thick [difficult to detect by light
microscopy, even at high magnification (ca. x1000)]; exosporium pigmented and variable in thickness (4-
6 um ); oospore globose, 19-(26.4+2.4)-35 um in diameter with a hyaline, smooth wall (endosporium) of
even thickness (3-4 um ). Germination not observed.
Specimens examined: On Sorghum leiocladum: Hirstglen, Queensland, 3.vii.1978, M.J. Ryley (BRIP
14533); Glencoe, New South Wales, -.vii.1978, M.J. Ryley (BRIP 14391); Upper Pilton, Queensland,
4.1.1979, M.J. Ryley (BRIP 14389); Stuart R., Queensland, 1.iv.1979, M.J. Ryley (BRIP 14387); Cooyar,
Queensland, 1.v.1979, M.J. Ryley (BRIP 14390); St Lucia ex Hirstglen, Queensland, 4.iii.1979, M.J.
Ryley (BRIP 14352). On Sorghum plumosum: Glen Innes, New South Wales, Australia, -.ii.1928, R.J.
Noble (TYPE: ex Herb. W.H. Weston)(FH). (Host now called Sorghum leiocladum.)
Examination of frayed leaves from infected tillers in the field showed that
prolonged exposure to the weather resulted in morphological changes to the sexual
spores. The ridges on the oogonium became less pronounced, and the oogonium
diameter gradually decreased. After 8 months the thin oogonium wall had disappeared,
and the outer surface of the exosporium was smooth, lacking the scabrid appearance of
newly-formed oogonia. Although the diameter of the propagules had decreased to 24-
38 um due to the weathering of the exosporium, the oospore diameter range remained
unchanged.
The characteristics of the downy mildew on Sorghum leiocladum agree very
closely with those of S. noblei described by Weston (1929, 1942). The asexual spores
are true conidia as defined by Shaw (1978) in that they have a uniform wall, lack an
apical papilla and always germinate by one or two germ tubes. There is no doubt that
94
this downy mildew should be called P. noblei. The production of ‘abnormal’
conidiophores with a reduced branch system has no taxonomic significance because it
has been reported for other graminicolous downy mildews, Sclerospora graminicola
(Safeeulla and Thirumulachar, 1956), Peronosclerospora sacchari (Bonde and
Melching, 1979), P. sorghi (Safeeulla, 1976) and P. philippinensis (Weston) C.G. Shaw
(Kimigafukuro, 1979). This study has shown that care must be taken when using
oogonium diameter and exosporium ornamentation as taxonomic criteria. Prolonged
weathering can affect these characteristics. On the other hand, oospore diameter is an
immutable character.
Sorghum leiocladum is a strongly tussocked, densely caespitose perennial. In
southern Queensland the grass is found growing on volcanic-derived soils on ranges and
plateaux. Healthy tussocks consist of tightly-packed underground tiller bases from
which two types of tiller develop. There are short vegetative tillers, 30-40 cm high with
three to four arching narrow green leaves, which are present throughout the year.
Individual tillers rarely survive for more than one year. During late spring and early
summer (October to February) tall flowering tillers, up to 1.25 m high, with narrow
green leaves and each bearing a loose terminal panicle develop over one short period
(14 to 21 days) in response to rainfall.
Infected tussocks consist of short vegetative tillers similar to those in healthy
tussocks, and tall vegetative tillers bearing wide chlorotic leaves on/in which the
reproductive structures of P.noblei develop. Flowering tillers develop on some infected
tussocks and not on others. Infected tillers have more nodes (mean = 7.8 vs 3.2), and
wider culms (mean = 2.1 mm vs 1.7 mm) and leaves (mean = 6.5 mm vs 2.8 mm) than
flowering tillers. The chlorotic leaves are held in an upright manner and are close
together, resulting in a bunchy appearance. The vast majority of infected tillers are
vegetative, but malformed inflorescences develop on a few tillers.
Hyphae of P. noblei perennate in tiller bases, moving into some buds and not
others when tillers begin to elongate. Invaded buds develop into systemically infected
tillers, the hyphae in the apical growing point infecting leaves as they develop.
Sporulation of P. noblei is confined to the abaxial leaf surfaces of chlorotic leaves of
these special tillers, with the area of sporulation spreading in a series of steps from the .
tip towards the ligule. Differences in stomatal density between the abaxial (mean 19460
stomata/em”) and the adaxial (4200 stomata/cm”) surfaces may be responsible for the
absence of conidiophores on the adaxial surface. In any chlorotic area of the leaf blade,
only two crops of conidiophores develop. During the life of an individual tiller, asexual
sporulation occurs simultaneously on all chlorotic leaves, even though at a particular
time they are in various stages of development. On the lowermost one or two chlorotic
leaves, sporulation does not occur until they are fully expanded, but on younger leaves
sporulation can occur soon after they are exposed. Occasionally conidiophores develop
on the sheaths of chlorotic leaves (but then extending only 10-20 mm past the ligule),
and on the spikelets of underdeveloped inflorescences on infected tillers.
Soon after a diseased tiller reaches its maximum height the last formed, partly
expanded chlorotic leaves die rapidly from the tips towards the ligules. By this time
some of the lowermost infected leaves are dead while others may be partly necrotic.
Fraying of the leaf blades, which is associated with the expansion of the tightly packed
oogonia in the interfascicular parenchyma, usually begins simultaneously at the tips of
all or some of the uppermost three or four leaves. Within 7 days, all of the infected
leaves which will ultimately fray have begun to disintegrate. On some infected leaves,
fraying may commence while there is still some chlorotic tissue at the proximal end of
95
the blade, but asexual sporulation ceases when fraying starts. In the winter months
when the grass is dormant, tall dead tillers bearing frayed leaves are the dominant
feature of the symptom picture at many sites where S. leiocladum grows. The robust,
thick infected tillers are more capable of withstanding weathering than are the remnants
of healthy flowering tillers.
3. The downy mildew of Sorghum plumosum
This specimen was collected in June 1978 from Lizard Island, approximately
100 km north of Cairns. It consists of a number of frayed leaves with oogonia adhering
to the necrotic remnants of the vascular bundles. The sexual state of the downy mildew
has the following characteristics —
Oogonia spherical to subspherical with smooth polygonal faces, 26-44 um in diameter, oogonium wall
hyaline, 1.0-1.5 um thick and fused to exosporium, exoporium pigmented, variable in thickness; oospore
more or less central, adnate with the exosporium, 19-(26.2+2.2)-30.0 tm in diameter with a thin, hyaline
wall (endosporium) 1.0-2.0 pm thick. Germination not observed. Asexual state not seen.
Specimen examined: On Sorghum plumosum: Lizard Island, Queensland, 7.vi.1978, V. Boughton (BRIP
14388).
Four downy mildews have been recorded on Sorghum plumosum — P. maydis
(Ramsey and Jones, 1988); P. miscanthi (Miyake) C. G. Shaw (Frederiksen and Renfro,
1977); P. philippinensis (Frederiksen et al., 1970) and P. sorghi (Bonde and Freytag,
1979). The records of the last two fungi are based on the results of inoculations and
neither has been recorded on S. plumosum in the wild. The characteristics of the sexual
state of this specimen differ from those reported for all of the last three fungi
(Waterhouse, 1964). The report of P. maydis on Sorghum plumosum by Ramsey and
Jones (1988) was based on studies made in the Atherton Tableland district of northern
Queensland. Here a severe epidemic of P. maydis developed on maize (Zea mays L.) in
1985 and there was strong evidence that infected plants of S. plumosum were acting as
alternative hosts. However, oospores never developed on P. maydis-infected plants of
Z. mays or S. plumosum. In fact, the sexual state of P. maydis is unknown (Kenneth,
1981). In our opinion it is unlikely that the Lizard Island specimen is P. maydis,
because of the presence of oospores.
The range of oospore diameter and the ornamentation of the oogonia are very
similar to those of P. noblei recorded by Weston (1929, 1942) and reported in this
study. However, the identity of the fungus can be determined with certainty only when
a study of its asexual state is made.
4. The downy mildew of Eragrostis sp.
This specimen consists of the upper portion of a culm with five frayed leaves but
no inflorescence. The characterisitics of the sexual state found adhering to the remnants
of the frayed leaves are as follows-
Oogonia spherical to subspherical, 30-44 pm in diameter, oogonium wall hyaline, 1.0-2.0 um thick and
fused to the exosporium, 3.5-7.5 pm thick, exosporium pigmented, 2.5-3.0 um wide with rounded,
hyaline papillae, 3.5-4.5 um high, 4.5-6.0 pm wide at base; oospores one per oogonium, adnate with
exosporium, centrally located, spherical, 19-(24.3+2.3)-30 um, oospore wall (endosporium) hyaline, 2-3
uum thick. Germination not observed. (Figure 2A). Asexual state not seen.
Specimen examined: On Eragrostis sp.: Charleville, Queensland, -.v.1955, A. Johnson (BRIP 2105).
96
Two graminicolous downy mildews have been recorded on Eragrostis species,
namely Sclerophthora macrospora (Saffeulla, 1976) and Basidiophora butleri (Weston)
Thirum. & Whitehead (Weston, 1933). Sclerophthora macrospora, which has been
recorded on over 140 hosts throughout the world (Safeeulla, 1976; Shaw, 1981), has
smooth-walled spherical to subspherical oogonia, 34-70 x 36-62 um in diameter and
oospores 35-70 tm in diameter. The downy mildew of Eragrostis from Queensland has
papillate oogonia which are much smaller than those of S. macrospora. Sclerospora
butleri Weston was described on Eragrostis aspera (Jacq.) Nees by Weston (1933) as
having spherical to subspherical oogonia, 21-(33-37)-43 tm in diameter with bluntly-
rounded, papillate projections, 2-5 um high, with a central oospore 15-(19-23)-27 in
diameter. Later, Thirumalachar and Whitehead (1952) described the asexual state of
that fungus on Eragrostis plumosa (Retz.) Link. The sporangiophores were simple,
unbranched, pedicel-like cells, obconical, narrow at the base and up to 22 um long and
12 tm wide. Six to eight lemon-shaped sporangia (28-34 um x 15.5-22 um) developed
on short sterigmata at the apices of the sporangiophores. Thirumalachar and Whitehead
(1952) proposed a new combination, Basidiophora butleri (Weston) Thirum. &
Whitehead for this fungus based on the morphology of its asexual state.
Two other graminicolous downy mildews, namely Peronosclerospora
heteropogoni Siradhana, Dange, Rathore & Singh and Scleropsora iseilematis Thiram.
& Naras., possess papillate oogonia. The oospores of P. heteropogoni are 25-(29)-37
uum in diameter (Siradhana et al., 1980), while those of S. iseilematis are 38-50 ym in
diameter (Thirumalachar and Narasimhan, 1949). The upper and lower limits of the
oospore diameter of both downy mildews are greater then the corresponding values for
the Eragrostis downy mildew. The mean oospore diameter and exosporium
ornamentation of the Eragrostis downy mildew in Queensland is very similar to those
reported for Basidiophora butleri.
There are two important characteristics of the genus Basidiophora which are
relevant to the taxonomic standing of B. butleri. Firstly, the other two valid species of
Basidiophora, that is, B. entospora Roze & Cornu and B. kellermanii (Swingle ex
Sacc.) Wilson occur only on members of the Family Asteraceae (Constantinescu, 1998).
Recently, Constantinescu (1998) erected a new genus, Benua Constant., with B.
kellermanii the type and only species, based mainly on the characterisitics of the
sporangiophores. Secondly, Francis (1981) and Constantinescu (1998) stated that in the
genus Basidiophora the sporangia fall away from the sporangiophore with a small part
of the sterigma attached, but Thirumalachar and Whitehead (1952) did not report this
feature for B. butleri.
The transfer of S. butleri to Basidiophora was based solely on the characteristics
of the asexual state which are considered to be reliable criteria for generic delimitation
within the Family Peronosporaceae (Hall, 1996). However, when the facts above are
taken into account, the placement of S. butleri in Basidiophora is questionable. Barreto
and Dick (1991) rejected Basidiophora butleri, suggesting that it be better placed in
Sclerospora, and Constantinescu (1998) did not consider the species in his revision of
Basidiophora.
The downy mildew found on Eragrostis sp. in Queensland is similar in many
respects to the fungus now called Basidiophora butleri. However, until the asexual
state of the Queensland specimen is found, its taxonomic status will remain in doubt.
97
Figure 2. A Scanning electron micrograph of papillate oospore of the downy mildew
on Eragrostis sp. (BRIP 2105). B Photomicrograph of oospores of the downy mildew
on Triodia pungens (BRIP 2107).
5. The downy mildew of Triodia pungens
Specimens of a downy mildew on Triodia pungens have been found at two
localities in Queensland. The collection made at Yalloroi consists of four intact plants,
each with a number of tillers up to 15 cm high. The upppermost leaves on each culm
are frayed, with oogonia attached to the remnants of the vascular bundles, while the
lower leaves are intact, and do not contain oogonia. No inflorescences were found in
the upper portions of any of the culms. The Barcaldine collection consists of a few
frayed leaves. The sexual states found on the two specimens did not differ. They have
the following characteristics —
Oogonia subspherical, with flattened faces, 32-47 um in diameter, oogonium wall fused to exosporium,
hyaline, 1.0-1.5 zm thick, exosporium pigmented, variable in thickness; oospores one per oogonium,
centrally placed, spherical, 25-(29.9+2.1)-35 um, adnate with exosporium, oospore wall (endosporium) 2-
3 um thick. Germination not observed. (Figure 2B). Asexual state not seen.
Specimens examined: On Triodia pungens: Yalloroi, Queensland, 23.vi.1952, E. F. Henzell (BRIP 2106);
Barcaldine, Queensland, 13.vi.1974, R.G. Silcock (BRIP 2107).
There have been no previous reports of a downy mildew on Triodia. The
characteristics of the oogonium wall and the range of oospore diameter of this downy
mildew are similar to those of Peronosclerospora noblei recorded in this paper and by
Weston (1929). However, only a study of the asexual reproductive structures of this
graminicolous downy mildew will determine its taxonomic position.
LITERATURE CITED
Barreto, R.W. and Dick, M.W. (1991). Monograph of Basidiophora (Oomycetes) with a
description of a new species. Bot. J. Linn. Soc. 107: 313-332.
Bock, C.H., and Jeger, M.J. (1996). Downy mildew of sorghum. Jnt. Sorghum Millets Newsl.
J72335-51¢
Bonde, M.R. and Freytag, R.G. (1979). Host range of an American isolate of
Peronoscleropsora sorghi. Pl. Dis. Reptr 63: 650-654.
98
Bonde, M.R. and Melching, J.R. (1979). Effect of dew-period temperature on sporulation,
germination of conidia, and systemic infection of maize by Peronosclerospora
sacchari. Phytopathology 69: 1084-1086.
Commonwealth Mycological Institute (1988). Peronosclerospora sorghi (Weston & Uppal)
C.G. Shaw. C.M.I. Distr. Maps PI. Dis. No. 179.
Constantinescu, O. (1998). A revision of Basidiophora (Chromista, Peronosporales). Nova
Hedwigia 66: 251-265.
Francis, S.M. (1981). Basidiophora entospora. C.M.I. Descr. Pathogen. Fungi Bact. No. 681.
Frederiksen, R.A., Bockholt, A.J., Rosenow, P.T. and Reyes, L. (1970). Problems and progress
of sorghum downy mildew in the United States. Indian Phytopath. 23: 321-328.
Frederiksen, R.A. and Renfro, B.L. (1977). Global status of maize downy mildew. Ann. Rev.
Phytopath. 15: 249-275.
Hall, G.S. (1996). Modern approaches to species concepts in downy mildews. Pl. Pathol. 45:
1009-1026.
Hubbard, C.E. (1938). Sorghum leiocladum and key to the species of Sorghum found in
Australia. Hooker’s Icon. Pl. 34: t.3364, 1-6.
Kenneth, R.G. (1981). Downy mildews of graminaceous crops. In The Downy Mildews. (Ed.
D.M. Spencer) pp.367-394. London and New York: Academic Press.
Kimigafukuro, T. (1979). Effect of temperature on conidial size of Sclerospora maydis, s.
Philippinensis and S. sorghi. JARQ 13: 76-77.
Kubicek, Q.B. and Kenneth, R.G. (1984). Peronosclerospora globosa, a new downy mildew of
Gramineae, attacking cupgrass in Texas. Phytopathology 74: 792.
Langdon, R.F.N. (1950). Records of Queensland fungi, VI. Pap. Dep. Biol. Univ. Od 2: 15-18.
Leece, C.W. (1941). Downy Mildew Disease of Sugar Cane and Other Grasses. Tech.
Commun. Bur. Sugar Exp. Stns Qld 5: 111-135.
Naumov, N.A. (1949). A new fungus on winter rye. Notul. Syst. Inst. Cryptog. Horti. Bot.
Petropol. 6: 79-80. (Title and article in Russian).
Rayner, R.W. (1970). A Mycological Colour Chart. Kew: Commonwealth Mycological
Institute.
Ramsey, M.D. and Jones, D.R. (1988). Peronosclerospora maydis found on maize, sweet corn
and plume sorghum in Far North Queensland. Pl. Path. 37: 581-587.
Safeeulla, K.M. (1976). Biology and Control of the Downy Mildews of Pearl Millet, Sorghum
and Finger Millet. Mysore: Wesley Press.
Safeeulla, K.M. and Thirumulachar, M.J. (1956). Periodicity factor in the production of asexual .
phase in Sclerospora graminicola and Sclerospora sorghi and the effect of moisture and
temperature on the morphology of the sporangiophores. Phytopath. Z. 26: 41-48.
Shaw, C.G. (1975). The taxonomy of graminicolous downy mildews, with emphasis on those
attacking maize. Trop. Agric. Res. Series, Tokyo 8: 47-55.
Shaw, C.G. (1978). Peronosclerospora species and other downy mildews of the Gramineae.
Mycologia 70: 594-604.
Shaw, C.G. (1980). Peronosclerospora noblei. Mycologia 72: 426-427.
Shaw, C.G. (1981). Taxonomy and evolution. In The Downy Mildews. (Ed. D.M Spencer)
pp.17-29. London and New York: Academic Press.
Simmonds, J.H. (1966). Host Index of Plant Diseases of Queensland. Brisbane: Queensland
Department of Primary Industries.
Siradhana, B.S., Dange, S.R.S., Rathore, R.S. and Singh, S.D. (1980). A new downy mildew on
maize in Rajasthan, India. Curr. Sci. 49: 316-317.
Steindl, D.R.L. (1953). Sclerospora disease of sugar-cane. In Proc. 8” Congress Int. soc.
Sugarcane Tech. Pp 952-955.
Steindl, D.R.L. (1957). Sclerophthora disease at Proserpine. Cane Gr. Quart. Bull. Qd 20: 91-
92.
Steindl, D.R.L. and Smith, N.McD. (1952). Sclerospora disease. Cane Gr. Quart. Bull. Qd 15:
7-9.
99
Thirumalachar, M.J. and Narasimhan, M.J. (1949). Downy mildew on Eleusine corocana and
Iseilema laxum in Mysore. Indian Phytopath. 2: 46-51.
Thirumalachar, M.J. and Whitehead, M.D. (1952). Sporangial phase of Sclerospora butleri.
Am. J. Bot. 42: 416-418.
Vickery, J.W. (1961). Gramineae. Contr. NSW Natn. Herb. Flora Series 19(1): 1-124.
Waterhouse, G.M. (1964). The genus Sclerospora. Diagnoses (or descriptions) from the
original papers and a key. Misc. Publs C.M.I. No. 17.
Weston, W.H. Jr (1929). A new Sclerospora from Australia. Phytopathology 19: 1107-1115.
Weston, W.H. Jr (1933). A new Sclerospora from Nyasaland. Phytopathology 23: 587-594.
Weston, W.H. Jr (1942). The conidial phase of Sclerospora noblei. Phytopathology: 32: 206-
233
MYCOTAXON
Volume LXXIX, pp. 101-105 July-September 2001
RHIZOPOGON BUENOI (BOLETALES, BASIDIOMYCOTA) A NEW
SPECIES FROM SPAIN
Maria P. Martin & Francisco D. Calonge
Real Jardin Botanico, C.S.I.C., Plaza de Murillo 2, 28014 Madrid, Spain.
E-mail: maripaz@ma-tjb.csic.es
Abstract
Rhizopogon buenoi is described as a new species, based upon macro-, micromorphology and
DNA sequencing features. Relationships with close species are discussed.
Key words: Hypogeous fungus, morphology, molecular analysis, ITS rDNA, taxonomy.
INTRODUCTION
Going on with our research project within Flora Mycologica Iberica, and following the theme
of recent publications (MARTIN, 1996; MARTIN & CALONGE, 2000; CALONGE & MARTIN,
2000) we are proposing a new species of Rhizopogon from Spain growing under Pinus
sylvestris L.
MATERIAL AND METHODS
MATERIALS.- The material studied was collected growing under Pinus sylvestris in sandy soil.
Spain, Avila, Arenas de San Pedro, Hontanares, 21-XI-1998, leg. S. Barbero, MA-Fungi
47676.
MORPHOLOGICAL CHARACTERS.-Specimens were examined to define the macroscopic and
microscopic characters, following the criteria outlined by SMITH & ZELLER (1966) and
MARTIN (1996).
MOLECULAR ANALYSIS.- Total DNA was isolated, amplified and sequenced according to
CALONGE & MARTIN (2000). Sequences were obtained at the Automatic Sequencing Service
(CIB-CISC, Madrid, Spain). Sequence Navigator™ Sequence Comparison software (Perkin
102
Elmer) was used to identify the consensus sequences from the two strands. The new sequence
has been logged in the EMBL database with the Accesion Number AJ297263. Sequence
obtained in this study were compared with homologous sequences in the alignments mentioned
in JOHANNESSON & MARTIN (1999) and R. aromaticus Calonge & M.P. Martin (MARTIN &
CALONGE (2000). SEQAPP software for multiple sequences was used to search for the best
alignment. Parsimony analysis was performed using the computer program PAUP 4.0b*
(SWOFFORD, 1996). Branch robustness was estimated by bootstrap analysis (FELSENTEIN, 1985)
of 1000 heuristic replicates.
RESULTS
DESCRIPTION
Rhizopogon buenoi Calonge & M.P. Martin, sp. nov.
Etym.: Dedicated to Francisco Bueno, an excellent collaborator.
Diagnosis.- Basidiomata subhypogaeus, angiocarpous, globosa, subglobosa, tuberoidea vel
irregularia, 2.5-7 cm lata, sessilis. Peridium album. Rhizomorpha abundantis presentis in
basis. Gleba cremea brunnea. Columella nulla. Sporae ovoidae-ellipsoidae vel cilyndricae,
truncatae, biguttulatae, 5-7 x 2.5-3.5 tum, non amyloideae. Basidia 2-4 sporigena, cylindrica,
15-22 x 5-8 pam. Brachybasidiola pyriformis, aequalis dimensionis basidia. Peridium simplum,
100-200 pam latum, corsicus-typus. Trama hymenophoralis homoiomera, hypha 3.5-10 uum lata.
Holotypus: Hispania, Avila, Arenas de San Pedro, Hontanares, subter Pinus sylvestris, 21-XI-
1998, legit S. Barbero. MA-Fungi 47676.
Basidiomata aggregate, glabrous, subhypogeal, angiocarpous, globose to tuberoid, 2.5-7 cm
diam., sessile, with numerous rhizomorphs at base. Peridium glabrous, white, on bruising there
is no colour change. Gleba white then cream-colour, labyrinthiform; soft and cartilaginous
when fresh, bone-hard on drying; odour absent, taste light sweet which remains hazelnuts.
Chemical reactions: When contacting KOH on peridium becoming violet-lilac, then dark
brown-reddish, and on gleba light yellowish.
Spores ovate-ellipsoid to cylindrical, truncate, 5-7 x 2.5-3.5 ym, pale yellowish smooth and
biguttulate, neither amyloid not with small areas of spore blackening in Melzer's reagent (Fig.
la). Basidia 2-4-spored, cylindrical to clavate, 15-22 x 5-8 ym mixed with basidioles.
Peridium simple, < 200 ym thickn, formed by hyphal packets arranged in two directions
(corsicus-type; Fig. 1b). Constituent hyphae are 4-10 pm diam., hyaline, thin-walled, septate,
branched, coated with numerous orange-brown pigmented masses. Hymenophoral trama of
laxly interwoven hyphae, 3.0- 10.0 pm diam., rather gelatinized, refractive, septate, thin-walled
and little branched.
Molecular characters. In the cladistic analysis, R. buenoi clades as a sister group of R.
aromaticus (data not known). The 21 different base pairs between the ITS rDNA sequences of
R. buenoi and R. aromaticus are shown in Fig.2. ;
Fig. 1 Rhizopogon buenoi. a) Spores (bar= 10 xm); b) Peridium corsicus-type (bar= 50 tm).
104
R_AROMAT
R_BUENOI
R_ AROMAT
R_BUENOI
R_AROMAT
R_BUENOI
R_AROMAT
R_BUENOI
R_AROMAT
R_BUENOL
R_AROMAT
R_BUENOI
R_AROMAT
R_BUENOI
R_ AROMAT
R_BUENOI
R_ AROMAT
R_BUENOT
R_AROMAT
R_BUENOI
R_AROMAT
R_BUENOI
R_AROMAT
R_BUENOI
R_ AROMAT
R_BUENOT
R_ AROMAT
R_BUENOI
R_AROMAT
R_BUENOI
R_AROMAT
R_BUENOI
R_AROMAT
R_BUENOI
ATATAATAAGCGGAGGAGCC
NNNNNTTTACCT-AGGAG--—
AACGAGGGCATGTGCACACT
AACGAGGGCATGTGCACACT
TCTCTCTCACCTGTGCACTA
TGLCTCTCACCTGTGCACTA
ATTTTTGCTCGTATGAACCT
ATTTTTGCTCGTATGAACCT
TGTGTAGAAAGTCTTTGAAT
TGTGTAGAAAGTCTTTGAAT
GACTTCTAGGAGTAGTGAAT
GACTTCTAGGAGTTGTGAAT
CAACTTTCAGCAATGGATCT
CAACTTTCAGCAATGGATCT
AAGAACGCAGCGAAAAGCGA
AAGAACGCAGCGAAAAGCGA
TCTACANNNNNNNNNNNNNN
TCTACAGTGAATCATCGAAT
NNNNNNNNNNNNNNNNNNNN
CCTTGGTATTCCGAGGAGCA
NNTTCTCAACCCCTTTCAAT
ATTTCTCAACCCCTCTCAAT
GATAGTGGGTGTTGCCAGAG
GATAGTGGGTGTTGCCAGAG
GACTTGGGCTCACCTGAAAT
GACTTGGGCTCACCTGAAAT
TTTGACTTTGCATGATAAGG
TTTGACTTTGCATGATAAGG
GCCGTGTGCTGAAGTGCATG
ACCGTGTGCTGAAGTGCATG
AATACAGGTTGGGTTTGGTT
AATACCGGTTGGGTTTGGTT
GTAGGTGATCCTGGCCTTGT
GTAGTTGTTGCTGGACTT-T
ATGTCTTATCALIACCTCIC
ATGICLIALCATTACCTCIC
ACTGCGGGTTCAGCCAGCTG
ACTGTAGGTTCAGCCAGCTG
ATGTCCTTCATATACATCTT
ATGTCCTTCATATACATCTT
GTTTATTATCGGAGAGTTGC
GTTTATTATCGGAGAGTTGC
CTTTGAGACAAACGTTATTA
CTTTGAGACAAAAGTTATTA
CTTGGCTCTCGCATCCGATG
CT TIGGCTCT.CGCATC=GATG
TATGTAATGTGAATTGCAGA
TATGTAATGTGAATTGCAGA
NNNNNNNNNNNNNNNNNNNN
CTTTGAACGCACCTTGCGCT
NNNNNNNNNNNNNNNNNNNN
TGCCTGTTTGAGTGTCAGTA
TAGCTTTGAAGGGGAGCTTG
TAGCTTTGAGGGGGAGCTTG
ACTTTACGATCCAATCGTAA
ACTTTACGATTCAATCGTAA
GCATTGGCTTGCAGTCAACC
GCATTGGCTTGCAGTCAACC
CTTTCGGTGTGATAATGATC
CTTTCGGTGTGATAATGATC
AATAAAGGTTCTIGTGCCTCTr
AATAAAGGTTCTGTGCCTCT
GGATTGACTTTAGTCTTTCT
GGATTGACTTTAGTCTTTCT
ACGATATTCCCCCCNNNNN NNNNNNNNNNNNNNNNN
AC-ATATTCCCCCCTTTTT GACTTTTGACCTCAAAT
Fig.2 Comparison of the nucleotide sequences of the ITS1, 5.8S and ITS2 (complete sequence)
R. buenoi (R_BUENOI) and R. aromaticus (R_AROMAT). "-"= Alignment gaps; "N"=
Unresolved or unknown nucleotides.
105
DISCUSSION
From characters of the peridium, R. buenoi could well be related with R. corsicus Moyersoen &
Demoulin, R. ochraceorubens A.H. Smith and R. subalpinus A.H. Smith. However, in these
three species the rhizomorphs cover the whole peridium surface, whereas in R. buenoi the
rhizomorphs are attached to the basidiome base. Moreover, with KOH the peridium in R.
corsicus and R. subalpinus is unchanging. The chemical reaction in R. buenoi is similar to R.
ochaceorubens due to the presence of pulvinic acids (Martin & Telleria, unpublished).
There are other species with truncate and non-amyloid spores; however, they show
different types of peridium (Martin, 1996), e.g. R. abietis A.H.Smith (abietis-type: hyphae
forming a loosely interwoven weft), R. luteolus Fr. & Hordholm and R. verii G. Pacioni
(/uteolus-type: hyphal packets arranged in different directions) and R. vinicolor (roseolus-type:
hyphae running parallel to the surface). The peridium type clearly separates R. buenoi from
the species included in Subsection Fulviglebae of SMITH & ZELLER (1966), which shown
abietis-type or roseolus-type.
The magnitude of sequence variation in ITS rDNA between R. buenoi and R. aromaticus,
together with the different morphological characters (peridium roseolus-type, not truncate
spores and spore wall becoming dark bluish with Melzer in R. aromaticus), allow — the
separation of both taxa.
It is therefore apparent that this newly described species has a unique suite of macro- and
micromorphological characters which are conclusively supported by molecular analysis.
ACKNOWLEGMENTS
Thanks are due to Dr. Marian Glenn (Seton Hall University) for her kind English revision.
Financial support has been received from the DGES, under the research project Flora
Micoldgica Ibérica PB98-0538-C04-01 and a postdoctoral grant from the Comunidad de
Madrid to MPM.
REFERENCES
CALONGE, F.D. & Martin, M.P. 2000.- Morphological and molecular data on the taxonomy of
Gymnomyces, Martellia and Zelleromyces (Elasmomycetaceae, Russulales). Mycotaxon
76: 9-15.
FELSENSTEIN, J. 1985.- Confidence limits on phylogenies: an approach using the bootstrap.
Evolution 39: 783-791.
JOHANNESSON, H. & Martin, M.P. 1999.- Cladistic analysis of European species of Rhizopogon
(Basidiomycotina) based on morphological and molecular characters. Mycotaxon 71: 267-
283.
Martin, M.P. (1996).- The genus Rhizopogon in Europe. 173 pp. Edic. Specials Soc. Catalana
Micol. Barcelona.
Martin, M.P. & CALONGE, F.D. 2000.- Rhizopogon aromaticus (Basidiomycotina) a new
species found in Spain. Mycotaxon 75: 425-429.
SMITH, A.H. & ZELLER, S.M. 1966.- A preliminary account of the North American species of
Rhizopogon. Mem. N. Y. Bot. Gard. 14(2): 1-178.
SwoFForRD, D.L. 1996.- PAUP* version 4.0. Sinauer Assoc. Inc., Sunderland, Mass.
cas
a
Kee ifs * iy on pi
ee
ape ny Vis
t
(uf oy ie
\ rT ek)
yea ny
NED Wa eit: en
af Ops tv ‘
De ar
CUayte) ie
a 4
} i
og yw
lie H "Ths ¥ i ap f
weletrs pe he rf, vi ne OO ec) : ey
A gaia soap ae
fata ay) bod at
a . ori) Snead ‘wie yn aed
ea aes ke
re earth tea ye
be aiba Paton Asay a ote ape
iat ff pe ASE ae A batntiny &
Lifahes ee wep re 4
ae saat oe Vani cate | oh i teens Sei |
AG RR on ea Res | |
i yee eee , re Mii SS Le eae
ee Wy x ag sia Bon hoa gent aE
re F ro rer, 28 i iil sy : ent
| ; isin: vi ' 48 Lae Oy var * Hats anes ts la! ae aie Faw dp sae a aneeee ae i
ft) Heist ' pail os it Ad Gh jie hae, da ms ea Can an A: 2
aa ; AY He at o ive me t
ee if 3 by i ne a ay Aa i mre ut hes vi at) oui) is! vs ois a Y harass re nats rat ai o
4 <r bi rae ei ain ae ‘° oe I ate WE Ta ir ‘
ae Was Wie ania y ms BY al eal ieee fh dl I wih ys — si
Ry ; y 4 iv glad "i ani ; nk i, a act \ i } ” ca : is * 4 = S a ou ae
! = ) m ; , ¥ * ae . NM * y ke n: yt ; a ' Le $ ‘ i : iy Core ae
1 aaa me OR ag lor eae Es Bets te sel bia EL tae
nF wis wong. ely sail PY sees ee sat it Sere! tte ohh Pay pk, ‘ese
pe hfe eal aun ie at the ek spd a ani i. 4.) fbi nape wa \ Agi cus “etal
i sn) nN
2 | ET et Lhe ite a Ahh a A ae a
. Pe RO ble AL Uy ot a : ; : a
j J ayly hs a iv ; ay Sai Koen a ar vay in
ead pele eet it ay 4 eee vane) 1 Canvi24 7 2) \' eb Pils a e
f i 2 Sen Th tLe ate Ry 4 ‘ Vs i ae ‘ { ‘ eC 5 i i
‘ i, pe ay eee bagi Wa Pa vA eae i Ve eg ote ee en ee >
i we Mt ny f ae ae ae yr yh nay “h room pany y} soa wr am rast ar
: wi ; ‘ 5 ’ é ’ ss j -
i fy Si Pre i.e ¢ ud F
A $4) ‘wih id tis yy ty Vi sll Pula ih: a ote ti ie ‘inthe sat i ie % Oke ed ee oa 1% Pad - ore
meh oy ain jail Bae ie » Ae AN all sa ee gees trea ai el
ft Ra Ant \ nA f ;
, f ete mn Sh Shaan i Cig Uy
Oh nie wi he
VA ti
; l i,
_— 4 bide Pry) eae
i hn ‘ ch sald gi lh ol
. ; ae y aa) tegen) OME HN al co oar ily iat a
l 43 tT
ld An RRR Tel § ait sin ae ie sles weit ih
“ys ; Ame Mi be ot dita heh nod At pene Pyied pie oe Mi
Crt th eaae ! elias Nu APN aa,
hd a oe : ies aa Ne hal hae g:
ee re an 7 ,, i ) : ie ie he Ae Fy ja ia ie Wrst Cae
“a ; | oh | ih ener Dodie wo nai nts
ms, ay wl oe
ay cogs
aa
\
ees aye “apse
tual
i}, pe
: J er ai"
t , we: 7
i y i Pe Way i ue <
by WEN f no En as ne
a ah’ anh a ‘i *
é ee A it ¥ Sits fe
‘ i” A ¥ i
| et As; ‘ hat .
" Are ee - bgt Lat asin ee
(ao acai Sl
ee
vow. eon
a at
| eae Ww
he mie
Te yn
' ae
MYCOTAXON
Volume LXXIX, pp. 107-176 July-September 2001
HYMENOCHAETOID FUNGI (BASIDIOMYCOTA)
OF NORTH AMERICA
ERAST PARMASTO
Institute of Zoology and Botany, Estonian Agricultural University
181 Riia St., 51014 Tartu, Estonia (E-mail: e.parmasto@zbi.ee)
28 species of the genera Asterodon, Dichochaete and Hymenochaete found in
northern America (Greenland, Canada, Temperate Mexico and USA), two
dubious species and one not yet found here are described, their distribution and
hosts (substrata) characterized. Morphological characters in use for identifica-
tion are described and keys to species found in this region are given. The num-
ber of species inhabiting different zones diminishes from southeastern USA (23
species) to northern Subarctic America (4 species).
Keywords: Asterodon, Dichochaete, Hydnochaete, Hymenochaete, North
America
INTRODUCTION
Hymenochaetoid fungi (families Asterodontaceae, Clavariachaetaceae and Hy-
menochaetaceae) is a group of the order Hymenochaetales (Hymenomycetes,
Basidiomycota) characterized by resupinate (effused), effused-reflexed, pileate
or clavarioid non-poroid basidiomata (fruitbodies). In one species (H. dami-
cornis) the pileate basidiome is stalked. Hymenophore is smooth, in some spe-
cies colliculose, with flattened teeth or in some species hydnoid; basidiome is
brown, sometimes yellowish or blackish; the colour darkens when moistened
with KOH solution (xanthochroic reaction). Hyphae are with simple septa
(without clamps); hyphal system is sometimes subdimitic, 1. e., differentiated
- into subhyaline thin-walled generative hyphae and brown thick-walled skele-
_toids. In hymenium thick-walled brown or dark brown subulate or fusoid cys-
tidia-like cells (setae) are present. Usually the setae are very numerous, hyme-
nium is thickening and a Ssetal layer will be formed. Basidia are clavate or
subutriform, bear four (rarely two) sterigmata and on these hyaline, thin-
walled, non-amyloid spores.
All species inhabit angiospermic or gymnospermic wood, being on dead
trunks, branches and twigs; fallen logs and other wood, as an exception on bark
scales of living trees, living twigs or seemingly on ground but really on buried
roots or pieces of wood. All species cause white fibrose or pocket rot of wood.
108
GEOGRAPHICAL SCOPE
This paper covers Northern America as delimited by the Plant Taxonomic
Database Standard No 2 (Hollis & Brummitt, 1992) including Greenland,
Canada, Alaska south to central Mexico. The Western Antilles, southeastern
Mexico and countries to the South are excluded because they belong to the
Mesoamerican Plant Region of Southern America. One species common in
Mesoamerica and Caribbean regions has been included because it may occur in
southern regions of the area.
FORMER STUDIES IN NORTHERN AMERICA
Few species of Hymenochaetoid fungi were mentioned in Northern America
before Burt’s survey was published in 1918. Of the new species of Thelephora
by Schweinitz, two were later transferred to Hymenochaete (H. episphaeria and
H. imbricatula, a synonym of H. tabacina). Peck described four new taxa of
Hymenochaete and one of Hydnochaete; two of these (Hymenochaete spreta
and H. tenuis; Peck, 1878, 1887) are accepted here. Banker (1914) published a
paper on nomenclature and synonymy of Asterodon and Hydnochaete; how-
ever, according to his views, the last named genus belongs to pore fungi (Poly-
poraceae s. 1.). Ecology of Hymenochaete agglutinans (= H. corrugata), a
facultative parasite causing death of several angiospermic trees and bushes was
studied by Graves (1914); these data were supplemented by Overholts’ (1924)
studies. Timber rot caused by H. rubiginosa was studied by Brown (1915). In
the monograph of the genus Hymenochaete by Burt (1918), 10 new species
were described from N. America and Cuba. He gave descriptions of 21 species
found in the region; of these, 6 are now synonyms, 2 are dubious species. In a
later paper (Burt, 1924), the only species of the genus Asterodon, A. ferru-
ginosus was described by him as a new species Asterostroma ochrostroma from
New Hampshire. All collections studied by Burt were indicated in detail in his
papers. Altogether, 16 species were found by him in our study area.
Some Hymenochaete species have been mentioned in the lists of fungal _
biota by several authors, but only few of them (e. g., Morgan, 1887; Gilbert-
son & Bigelow, 1998), have mentioned more than 2-3 species. Coker (1921) in
his paper on North Carolina fungi gave descriptions of three species. In their
paper of West Indian species of Hymenochaete, Reeves & Welden (1967) indi-
cated four species as found in USA, and one, H. sallei (= H. rheicolor), as
found in Mexico; three of these were new for USA (H. anomala, H. opaca and
H. rigidula). H. agglutinans was synonymized with H. corrugata by them. In
his unpublished dissertation, DeFigio (1970) described and listed localities of
six species, found in Canada and USA; he neotypified three species described
originally in Europe, using for this North American (!) specimens (Hymeno-
chaete fuliginosa, H. rubiginosa, H. tabacina). This unfortunate selection was
supported by Job (1990) who published the neotypification data on H. rubigi-
nosa and H. tabacina. Two species found in northern America were described
in detail in the monograph of the genus Hydnochaete by Ryvarden (1982). Ina
paper on wood-rotting fungi of the Appalachian coniferous forests, Jung (1987)
described and illustrated by figures five species; three common species were
described by Chamuris (1988) from Northeast USA and adjacent Canada. Two
109
species found in transitional area between boreal woodland and forest tundra in
northern Quebec, Canada, were mentioned by Niemela (1985). In a paper on
Hymenochaete species of the temperate zone of the Southern Hemisphere by
Job (1990), some specimens of 8 species collected in Northern America were
cited, including H. cacao and H. rheicolor found in Mexico; H. tenuis was
lectotypified by him. In his world monograph of Hymenochaete by Léger
(1998), specimens of 13 species found in North America were used; this is also
the only modern book with full descriptions (in French) of species found in the
present study area.
A list of species of Hydnochaete and Hymenochaete found in the United
States was published by Farr et al. (1989); of 19 species mentioned by them,
13 are accepted in this paper. The published data on Canadian and USA species
were summarized by Ginns (1986) and Ginns & Lefebvre (1993).
Most of the data published on hymenochaetoid fungi are from USA and
Canada. 17 species have been found in Mexico, but only few localities are
mentioned in these papers (Burt, 1918; Reeves & Welden, 1967; Guzman,
1972; Welden & Guzman, 1978; Escobar, 1978; Welden, Davalos & Guzman,
1979; Marmolejo, Castillo & Guzman, 1981; Job, 1990). Data on two species
found in southern Greenland have been published by Knudsen, Hallenberg &
Mukhin (1993).
Altogether 27 taxa have been noticed in literature in Northern America; of
these, six (H. agglutinans, H. arida, H. badioferruginea, H. borealis, H.
spreta, H. ungulata) are considered to be synonyms here, two (H. episphaeria
and H. opaca) are doubtful species. Four new species have been described by
Parmasto and Greslebin (Parmasto, 2001). 28 ‘good’ species are accepted in
the Northern American mycoflora.
MATERIALS AND METHODS
This paper is based on a study of herbarium specimens in the herbaria ARIZ,
BPI, CFMR, LA, NY, TENN. In addition, types and some other specimens
were borrowed from FH, NYS, PDD, TRTC, XAL, or studied in the Euro-
pean herbaria visited by me (GB, H, K, LE, O, S, TUR, UPS); the author used
also his own collections from Great Smoky Mountains (1988) and Louisiana
(1994). Descriptions are mainly based on the specimens from Northern Amer-
ica. Colours are named using Rayner’s Mycological Colour Chart (1970), these
names are with a capital letter. Colour notations are given using the Munsell
Book of Color (1942) and Methuen Book of Colour by Kornerup & Wanscher
(1967); colour names used in that book are in parentheses. Microscopic study
was carried on making free-hand sections of basidiomata or as squash mounts
in 2% aqueous solution of KOH. Measurements have been made using
eyepiece micrometer at magnifications x 700 and x 1000, since 1998 with the
aid of a Sony CCD Video Camera attached to a Nikon Labophot 2 microscope
and analysed by Global Lab Image (Data Translation Inc.) software. For
statistics, 25 or 30 spores were measured in each specimen. Keys to species and
descriptions are compiled with the aid of the program DELTA (Dallwitz, 1980;
Dallwitz, Paine & Zurcher, 1993). Herbarium acronyms are after Holmgren,
110
Holmgren & Barnett (1990). Latin names of substrata are unified using the
Kartesz (1994) checklist.
PRESENTATION OF THE DATA
Of synonyms, only those used in North America are given. In the nomen-
clatural part, also the basionym of the correct name, descriptions of species by
American authors or in some instances important papers (Jahn, 1971; Léger,
1998; Ryvarden, 1982, 1985) are cited. In the lists of substrata and States
where a species has been found, the number of collections studied by the author
of this paper is indicated in parentheses. When the author has not seen the
specimens, these data are given mainly following Ginns & Lefebvre (1993)
check list; no attempts were made to check once again all the literature used by
them. Distribution in other regions has been indicated using Hollis & Brum-
mitt’s World Geographical Scheme for Recording Plant Distributions (1992);
for these data, reliable literature sources as well as author's unpublished data
have been used.
There are numerous misidentified specimens in all herbaria; to help
avoiding similar mistakes, in a special paragraph the most common misnamings
are indicated.
MORPHOLOGY
The basidiomata (basidiocarps, fruit bodies) are in most species resupinate (ef-
fused), i. e., without any pilei or reflexed margins. In other species, they are
pileate or resupinate with elevated upper margin (effused-reflexed; part of such
basidioma is resupinate, another part pileate). The form sometimes depends on
the substrate: in all species, the spore-bearing hymenophore (hymenium) is di-
rected downwards, to enable free falling of ripened spores. However, on fig-
ures presented in several papers on Hymenochaete, the layers of a basidiome
have been shown “upside down”, 1. e., basidium, setae etc. pointing up-
wards. In one species (Hymenochaete damicornis), the basidiome is a vertical,
sometimes scantily branched in upper part, stipe and pilei on top of it.
Fig. 1. Structure of basidiomata: T - tomentum, C - cortex, L - hyphal layer,
S - setal layer, H - hymenium. (Adopted from Jahn, 1971 and Léger, 1998.)
ms
Hymenium is smooth in most of the species; in some species it is collicu-
lose or with low, almost subspherical warts. In the species of the genera Aste-
rodon and Dichochaete the warts are developing to spines. In the species of the
genus Hydnochaete, hymenophore is hydnoid to odontioid.
The colour of basidiomata is always of some shade of brown, and this col-
our darkens or turns almost black when KOH water solution or any other alca-
line reagent is used (xanthochroic reaction). The colour is not caused by some
specific pigment, but mainly by polymerized polyphenols of unstable compo-
sition (Parmasto & Parmasto, 1979), or (also?) by styrylpyrones (Fiasson,
1982). The colour of a basidiome is in most species quite variable and depends
on the stage of development of its hymenium. When this is without basidia and
spores (sterile), it is usually much darker; when basidia and spores are present,
it may be much lighter. The same bleaching takes place in old basidiomata of
some species, when hymenium is covered with numerous crystals, but also
when hyaline hyphal ends are forming a new layer of the thickening hyme-
nium.
In the structure of a basidiome, several strata or layers may be distin-
guished under a looking glass at magnification of not less than x 10; for better
understanding, it must be studied under a microscope at magnification 100-400
x (Fig. 1). Depending on species, but also on age of the specimen studied, not
all layers are present (except hymenium which is always present in fertile
specimens).
Hymenium is the undermost layer; it consists of basidioles, basidia, setae,
sometimes also of hyphidia (see below), rarely of simple cystidia. Next is the
setal layer: a uniform or indistinctly stratose layer made by thickening hymen-
ium. Setae interwoven with more or less vertically situated hyphae is the main
element of this layer; sometimes old hyphidia, in many species crystals,
brown(ish) resinous matter or conglomerates of both are abundant in this layer.
Next is the hyphal layer composed of loosely or densely, more or less par-
allel (radiately situated) or irregularly intertwined hyphae. Different types of
hyphae (thick-walled and brown, thin-walled and subhyaline) may be distin-
guished in different species; seta-like dark hyphae (setal hyphae) are character-
istic for some species. In four species, hyphal layer seems to be divided into
upper and lower part by a dark line (duplex basidiome); actually, the line is
cortex and upper layer of hyphae is homologous with the tomentum.
Cortex (crust) is composed of densely agglutinated thick-walled dark
hyphae; it is usually 25-250 um thick.
Tomentum is a layer of loosely interwoven or descending fascicles of
hyphae; in pileate specimens it is forming the velutinous, hairy or strigose
upper surface of a pileus. In resupinate specimens, presence of a tomentum is a
sign that the species is able to develop pilei (or reflexed margins), or that the
species has been evolved from a pileate ancestor.
Due to the different structure of basidiomata, their consistency varies from
soft or coriaceous to woody hard. Thick setal layer is making a basidiome hard
and woody; when cortex is present, the basidiome is coriaceous but usually
breakable, not flexible. Thin basidiomata without a cortex are bendable when
112
with pilei. When resupinate specimens have a tomentum (sometimes degraded
to a thin layer), the basidiomata are detachable from the substrate.
Hyphae. Two main types of hyphae, generative and skeletal have been dis-
tinguished in many aphyllophoroid fungi. When both types are present, the
hyphal system is called dimitic; when only generative hyphae are present, the
system is called monomitic.
Generative hyphae are with septa and branching, subhyaline and thin-
walled when young. Later the walls thicken and change to yellow or brown.
Skeletal hyphae are typically thick-walled, brown, straight, with only rare septa
and not branching. In the order Hymenochaetales, in some species the hyphal
system is distinctly monomitic; in other species, it may be called subdimitic.
The skeletal hyphae are not true skeletals in this case, but with rare septa, occa-
sional branching, and there are intermediates between these skeletoids and gen-
erative hyphae. In other words: the hyphae are differentiated but not enough to
call their system dimitic; the term subdimitic is used in such case.
In some species (e. g., Hymenochaete tabacina) there are a few setal
hyphae embedded in the hyphal layer. These are very thick-walled, with
greater diameter and darker walls than generative or skeletal hyphae, lacking
septa, their ends are sometimes pointed as in hymenial setae.
In Asterodon, most of the hyphal layer is made of asterosetae - stellate or
slightly branched compound setae with several simple or repeatedly branched
rays (Fig. 3, 2 a).
In Dichochaete resupinata, many hyphae are dichotomously branched; this
is a type unusual in most hymenochaetoid fungi, but observed in a tropical
genus Clavariachaete characterized by positively geotropic branched, Pterula-
or Ramaria-like basidiomata.
Hymenial setae (Figs. 2-4) are thick-walled, usually subulate, narrowly
fusoid or narrowly conical; their length is about 30-120 um, diameter 4-15 wm;
usually they emerge 10-60 um above the hymenium. In thickening hymenium
the old setae are embedded into the setal layer. In several species, setae are
encrusted in upper half or at tip. This incrustation may be disolvable in KOH
solution stronger than 2%, and spiral-like structure of setal walls may be seen
in many species when a 10% solution is used. In most species, old setae are
covered with a very thin sheath of hyaline thin-walled hyphae 0.5-1.5 um in
diam. Using scanning electron microscopy, Gilbertson & Lindsey (1978) ob-
served another type of setal sheath in Hymenochaete arida (= H. cinna-
momea), made of primary wall of young setae separated from the secondary
wall during the growth of setae. No other studies on ultrastructure of setae have
been published since 1978.
Cystidia have been observed in three species (Asterodon ferruginosus, Hy-
menochaete anomala and H. fulva); these are atypical, usually hardly notice-
able, and may be incrusted by crystals. They are somewhat enlargened hyphal
ends in the hymenium and subhymenium.
Hyphidia are similar to hyphal ends; they may be on the same level as ba-
sidioles and basidia, or may project somewhat from the hymenium. In several
species, hyphidia have yellowish, brownish or brown thickened walls; some-
times they may be covered with small granules of resinous matter, and then
113
Fig. 2. Setae of hymenochaetoid fungi: 1 - Hymenochaete cacao, 2 - H.
anomala (c - cystidia), 3 - Hydnochaete tabacina, 4 - H. olivacea, 5 -
Hymenochaete luteobadia, 6 - H. epichlora, 7 - H. tenuis, 8 - H. rigidula,
9 -— H. pinnatifida (d - dendrohyphidia), 10 - H. unicolor, Il - H.
corrugata, 12 - H. leonina.
114
Fig. 3. Setae of hymenochaetoid fungi: J - Dichochaete setosa, 2 - Asterodon
ferruginosus (a - asteroseta), 3 - Hymenochaete rubiginosa, 4 - H. escobarii
(d - dendrohyphidia), 5 - H. carpatica, 6 - H. burdsallii, 7 - H. curtisti (h -
hyphidia), 8 - H. cervina, 9 - H. jobit.
115
Fig. 4. Setae of hymenochaetoid fungi: 1 - Hymenochaete fulva (c -
cystidia), 2 - H. americana, 3 - H. tabacina, 4 - H. fuliginosa, 5 - H.
cinnamomea, 6 - H. rhabarbarina, 7 - H. rheicolor, 8 - H. damicornis.
116
OU oN DiGN er eta.’
Go 1 OR ean
ACO GOS TODO ND
CO FE Oy RC NG
OD: DOGG SO Ge
Oe ee 0 oe Bey:
OOO OO
D0 OO" AG
NNO OOO
Hy ie ) dd» 0G-
tS) 10 um
Fig. 5. U of hymenochaetoid fungi: 7 - Hymenochaete rheicolor, 2 — H.
cacao (Léger, 1998, f. 18), 3 - Dichochaete setosa, 4 - Hymenoch.
epichlora, 5 - H. anomala, 6 - H. rigidula, 7 - H. rubiginosa, 8 - H. tenuis,
9 - H. rhabarbarina, 10 - H. jobii, 11 - H. leonina, 12 - H. fulva, 13 - H.
tabacina, 14 - Hydnochaete tabacina, 15 - Hymenochaete cervina, 16 -— H.
burdsallii, 17 - Hydnochaete olivacea, 18 - Hymenochaete americana, 19 -
H., pinnatifida, 20 - H. cinnamomea.
117
Geese eiele
ile gece es ok are a
DIC ND 64g OC
DG+ G+ gne OV
JOS Egg QOC
10
Gee ccs
Fig. 6. Spores of hymenochaetoid fungi: 1 - Hymenochaete luteobadia, 2 - As-
terodon ferruginosus, 3 - Hymenochaete unicolor, 4 - H. fuliginosa, 5 - H. al-
lantospora, 6 - H. corrugata, 7 - H. damicornis, 8 - H. curtisii, 9 - H. car-
patica, 10 - H. escobarii.
these seem to be with unevenly thickened walls or monilioid. In some species
(Hymenochaete cinnamomea ssp. spreta, H. rhabarbarina) the encrusted hy-
phidia look sometimes like acanthohyphidia. Hyphidia are usually numerous in
sterile hymenium before (or after) formation of basidioles and basidia.
When sterile hymenium is beginning to thicken, i.e., before formation of a
new layer of setae, basidioles and basidia, growing hyphae are emerging from
it.Sometimes these hyphae simulate hyphidia, and have been described as such.
Basidioles are common in most species; partly these are unripe basidia -
not all basidia are sporulating simultaneously. A portion of the basidioles will
remain sterile; both types may have thickened at the base, sometimes encrusted
with granules of resinous matter yellow(ish) walls. Several authors (e. g., Cun-
ningham, 1963) have called these hyphidia, and sometimes there are intermedi-
118
ates between basidioles and true hyphidia: both may be homologous in several
species. The main difference is in size: basidioles have nearly the same
measurements as basidia, hyphidia are usually of smaller diameter, and with
thickened walls.
Basidia are usually thin-walled, hyaline, and either clavate or with a con-
striction in the upper part below the sterigmata; in last case these may be called
subutriform. In several species, the basidial wall is thickening and yellowish at
base, sometimes encrusted with brownish granules of resinous matter. When
using low magnification of microscope, such basidial wall may seem unevenly
thickened. In the species found in Northern America, the basidia bear four thin
and short sterigmata.
Form of the spores (Figs. 5-6) is from subglobose or broadly ellipsoid to
long cylindrical; one side of the spores is usually flattened or slightly concave;
cylindrical spores may be distinctly curved. Spore size varies in limits 3-11 x
1.2-5.5 um. The size is variable in one specimen; as an average, their coeffi-
cient of variation is CV = 5-10. This variation is independent of the variation
of (mean) spore size in different specimens of a species; consequently, their
variability in one collection does not give any information on the intraspecific
variability.
Mean spore size in a specimen and mean spore length/width quotient Q is
a characteristic much more informative than observed variation range. Never-
theless, in several cases comparison of these statistics in two or a few different
specimens does not give us convincing information, whether they are conspeci-
fic or belong to different species. For taxonomic conclusions, but also for iden-
tification of specimens data on mean size of several specimens is necessary.
TAXONOMY
Asterodon, Dichochaete, Hydnochaete and Hymenochaete belong to the order
Hymenochaetales - together with several genera characterized by poroid
(“polyporoid”) hymenophore (Coltricia, Inonotus, Onnia, Phellinus, Phyllo- .
poria and several segregated from these genera) or upright ramified (clavarioid,
ramarioid) basidiomata (Clavariachaete). Presence of hymenial setae, lack of
clamps on hyphae, xanthochroic brown basidiomata and smooth, colliculose or
hydnoid hymenophore makes it possible to distinguish the group of hymeno-
chaetoid fungi easily.
History of the taxonomy of Hymenochaete, of its infrageneric classification
and related genera was briefly given by Parmasto (1995). The genus was
described by Léveillé (1846) as a “most natural group” of thelephoroid fungi.
Patouillard (1900) asserted close relationship of genera with more or less
smooth hymenium (Hymenochaete) and poroid hymenophore (/nonotus, Phelli-
nus), and included these into les Fomes, sér. des Igniaires. These fungi were
united into a subfamily Hymenochaetoideae by Donk (1931), was later raised to
the rank of family (Donk, 1948) and by Oberwinkler (1977) to the order
Hymenochaetales. The change from a subfamily to a family and then to an
order was not caused by some new important findings in their morphology; it
was the reflection of general devaluation of scope in taxonomic units and trend
to extreme splitting of taxa.
119
The order Hymenochaetales seems to be a monophyletic taxon. Subdivi-
sion of it depends on views of a taxonomist; for a “lumper”, no families except
Hymenochaetaceae can be distinguished. Modern trends in fungal taxonomy
gave preference to splitting; e. g., the families Clavariachaetaceae, Coltricia-
ceae, Hymenochaetaceae and Phellinaceae have been distinguished by Jiilich
(1982). Fiasson & Niemela (1984) added Inonotaceae for several genera,
included by Julich (1982) into Coltriciaceae; the same scheme was followed by
Knudsen (1995). However, the line between Hymenochaete and poroid (poly-
poroid) Phellinus is not as clear as thought earlier. The author of this paper
published a new species, H. reticulata recently (Parmasto, 2001); according to
macromorphological characters (reticulate hymenophore), it may be included to
Phellinus.
Until molecular characters and based on these phylogenetic analysis will be
employed for a new classification of Hymenochaetales, we have to avoid insuf-
ficiently founded changes in classification. A cladistic study based on mor-
phological characters (Parmasto, 1995) has shown, that Stipitochaete, a satellite
genus of Hymenochaete is indistinguishable from the latter. The other satellite,
Hydnochaete is a paraphyletic genus with unclear position. Infrageneric taxa
(sections) distinguished in Hymenochaete by Léger (1990) and Job (1990) based
on structure of basidiomata (presence or absence of cortex, context and setal
layer) are not monophyletic taxa but grades, useful for preliminary
arrangement of species (see Parmasto, 1995). The number of species growing
in Northern America is low, and that is why I did not use these arbitrary taxa in
this paper.
The genera of hymenochaetoid fungi (polyporoid genera excluded) may be
arranged as given below.
Asterodontaceae Parmasto: context of basidiomata composed mainly of stellate
asterosetae. Spores smooth. One genus: Asterodon Pat.
Clavariachaetaceae Julich: basidiomata branched, erect, or secondarily
effused but with erect branched outgrowths; numerous dichotomously or
crest-like branched dichohyphae present. Two genera: tropical
Clavariachaete Corner characterized by erect clavarioid basidiomata, and
mainly subtropical Dichochaete Parmasto with pileate or effused basidio-
mata (one species found in Mexico).
Hymenochaetaceae Donk: basidiomata effused or pileate; asterosetae and dich-
ohyphae absent. Two genera easily distinguishable in Northern America
(but not when all species considered): Hymenochaete Lév. - basidiomata
with smooth or colliculose hymenium; Hydnochaete Bres. - basidiomata
with hydnoid or odontioid hymenophore.
ECOLOGY
Most species grow on dead wood or bark of fallen tree trunks, branches and
twigs in forests, bushland, rarely also in open habitats. In humid climate, a few
species may grow on dead hanging twigs. One species, Hymenochaete dami-
cornis is growing on roots of trees, or in wood pieces buried in soil. Another,
H. carpatica has been only found on dead bark scales of old living trees; it is a
saprobiont, not a parasite. One species, H. corrugata may infect branches of
120
growing trees and shrubs; parasitic way of living is possible but not proved in
other species.
All species cause a white rot, 1. e., are decomposers of lignin. Some spe-
cies cause a pocket rot of wood, i. e., the rotten wood has numerous small
holes.
Basidiomata may develop during all vegetation seasons but in countries
with temperate climate mostly late summer or early spring. Most species have
perennial basidiomata: their hymenium is thickening, forming a setal layer. In
some species the new annual setal layer is clearly distinguishable from the old
ones, sometimes strata are separated from each other by a thin layer of inter-
woven hyphae. If one setal layer (and hymenium) is developing during a year,
the age of basidiomata may be counted; it is usually not more than 2-3 years,
but in some species up to 12 (Hymenochaete cinnamomea), 15 (H. escobarii) or
20 (H. cervina) years.
Most collections in all herbaria are sterile, i. e., without basidia and
spores. In many cases, it is so due to slow drying of specimens: the basidia will
collapse during this, and thin-walled spores will be destroyed by insects and
(mainly) bacteria. Sporulation period of most species is unknown and it may be
quite short. In other groups of Aphyllophorales fungi, it is usually early spring
and late summer to late autumn (in Boreal Zone), when it is rainy and air tem-
perature not high. Many species of aphyllophoroids studied sporulate late
evening and early morning, or during the night, i. e., when basidiomata are
usually not collected by mycologists.
DISTRIBUTION
Of the about 115 accepted species of the genera Asterodon, Clavariachaete, Di-
chochaete, Hydnochaete and Hymenochaete, more than a half have been only
found in tropical or subtropical areas. 34 species have been found in the Boreal
and Nemoral zones of the Northern Hemisphere, of these 11 only in this area.
There are numerous species (22) which seem to have distribution of Gondwana _
type; 12 species have been found until only in Australasia, 17 only in Africa
and 20 only in Southern America. These numbers reflect the fact that some
areas are better studied than others; nevertheless, general features of their dis-
tribution show that the species are mainly of tropical/subtropical origin. The
number of species specialized to grow only or mainly on coniferous wood is 4,
on angiospermic wood (including 2 species only found on bamboos) - 39. For
many species the preferred host is unknown.
In Northern America, the number of species diminishes from south and
northeast to northwest. Of the 30 species (including two doubtful ones), 23
have been found in southeastern USA, 15 in northeastern, 15 in southwestern
(mainly in Arizona), 11 in south-central, 9 in north-central USA, northwestern
USA, western and eastern Canada, and only 4 in Subarctic America (two in
Greenland and one in the Northwest Territories of Canada). 18 species
(including 2 doubtful ones) have been found in Mexico, but this small number
is obviously due to insufficient study of this area.
12]
COLLECTING
Species of Hymenochaetoid fungi are mainly growing on fallen trunks and
twigs. As other aphyllophoroid fungi, most resupinate species prefer the
underside of fallen logs or twigs. Pileate species can also grow on vertical sub-
strate. Three species have special localities: the basidiomata of Hymenochaete
damicornis are upright and growing seemingly on soil, actually on buried wood
or roots; H. carpatica forms basidiomata on bark scales of living trees; Aste-
rodon ferruginosus may grow not only on very rotten logs, but also under the
roots of rotten stumps.
The collected specimens must be dried as soon as possible; to avoid change
of colour and consistency, it is best to be done in moving air and with tempera-
ture not above 35 centigrade. Slowly dried or kept in moisture specimens are
usually without basidia and spores; especially important is quick drying in
tropics and subtropics, where basidia and spores will be damaged very soon.
To acquire spores for further study, it is recommended to make a spore
print. When basidiomata are dry, soak these for 20-30 min in water and let
them slightly dry after this. Place a moist basidiome on waterproof black paper
and cover with a plastic bag to avoid rapid drying. A clearly visible white spore
print will be formed in a few hours; lower temperature stimulates sporulation
more than warm one. The spore print must be dried immediately and put into a
small envelope. Using sterile microscope slides instead of paper, the spore print
is suitable for introducing the fungus into pure culture; dry spores are viable for
several weeks. Fresh spore prints as well as these kept in a herbarium many
years are usable for spore measurement and statistical treatment of the results.
LABORATORY STUDY OF SPECIMENS
Colour of specimens is variable not only between species, but even more in the
same basidioma during its life cycle. To describe the colour, several colour
charts are available. The colours have no names in the Munsell Book of Color
(1942 or any later variety of this, including the Soil Color Chart), but are
denoted using a combination of letters and numbers. (E. g., deep red is denoted
as 2.5 R 4/12). This costly book has been used by few mycologists in North
America. Available for a much smaller cost is the book by Kornerup and Wan-
scher (1967). On 30 tables, 1266 colours are represented, and in addition to the
colour notations (e. g., 6 C 5), vernacular names are given, too. These names
are used in this paper (in parentheses) to describe the basidiomata.
MICROSCOPIC STUDY. Hand-made sections made radially from basid-
iomata are needed to see the structure (presence or absence of its different lay-
ers, basidia and other hymenial elements); scratch preparates may be done to
measure the setae and spores. Preparates are usually mounted into 2-3 percent
water solution of KOH. Avoid use of more concentrated KOH because the
incrustation of setae and crystals present in basidiome may dissolve. Use of
Melzer’s reagent is in most cases useless, as is the use of different stains.
Spore measurements are useful for sure identification in many species.
Measurement of some 7-10 spores avoiding extreme sizes may give a prelimi-
nary picture of spore size for identification. For more detailed study, 25-30
randomly taken (not selected!) spores must be measured. Arithmetic mean of
Y22
the measurements is a statistics usable to characterize a specimen (but not spe-
cies!) and to study variation within a species when data on several specimens
are available. In most species, spores are small and moving due to the
Brownian movement; use of a micoscope with image analysis equipment gives
much more exact data than a usual microscope.
ABBREVIATIONS USED
G & L- Ginns & Lefebvre, 1993 CO - Colorado
K & W - Kornerup & Wanscher, 1967 CT - Connecticut
M - Munsell, 1942 DC - District of Columbia
DE - Delaware
Abbreviations of state names FL - Florida
GA - Georgia
Canada IA - Iowa
AB - Alberta ID - Idaho
BC - British Columbia IL - Illinois
MB - Manitoba IN - Indiana
NB - New Brunswick KS - Kansas
NF - Newfoundland KY - Kentucky
NS - Nova Scotia LA - Louisiana
NT - Northwest Territories MA - Massachusetts
ON - Ontario MD - Maryland
PE - Prince Edward Island ME - Maine
PQ - Quebec MI Michigan
YT - Yukon Territory MN - Minnesota
MO - Missouri
Mexico MS - Mississippi
BS - Baja California Sur MT - Montana
DU - Durang NC - North Carolina
JA - Jalisco ND - North Dakota
M-MI - Michoacan NE - Nebraska
M-MO - Morelos NH - New Hampshire
NL - Nuevo Leén NJ - New Jersey
OA - Oaxaca NM - New Mexico
PU - Puebla NV - Nevada
SI - Sinaloa NY - New York
SL - San Luis Potosi OH - Ohio
TA - Tamaulipas OK - Oklahoma
VC - Veracruz OR - Oregon
PA - Pennsylvania
United States RI - Rhode Island —
AK - Alaska SC - South Carolina
AL - Alabama TN - Tennessee
AR - Arkansas TX - Texas
AZ - Arizona UT - Utah
CA - California VA - Virginia
123
VT - Vermont WV - West Virginia
WA - Washington WY - Wyoming
WI - Wisconsin
KEYS TO THE NORTH AMERICAN SPECIES
1. Synoptical key to some species with distinctive characters.
2. Key to species found in Greenland, Canada and northern USA.
3. Key to all species.
1. SYNOPTICAL KEY TO SOME SPECIES WITH DISTINCTIVE
CHARACTERS
Pileus stipitate: 15. Hymenochaete damicornis.
Basidiomata stratose with distinct setal layers; hyphal layer(s) present: 12. Hy-
menochaete cinnamomea ssp. spreta, 17. H. escobarii, 23. H. pinnatifida.
Basidiomata on bark scales of living trees: 10. Hymenochaete carpatica.
In context and hymenium numerous asterosetae: 1. Asterodon ferruginosus.
In context numerous dichohyphae: 2. Dichochaete setosa.
Setal hyphae present: 1. Asterodon ferruginosus, 2. Dichochaete setosa,
3. Hydnochaete olivacea, 4. H. tabacina, 10. Hymenochaete carpatica,
26. H. rigidula, 28. H. tabacina.
Hyphidia with hook-like curved tips: 14. Hymenochaete curtisit.
Brown(ish) or yellow hyphidia with thickened walls present: 11. Hymeno-
chaete cervina, 21. H. leonina, 22. H. luteobadia, 23. H. pinnatifida.
Dendrohyphidia present: 2. Dichochaete setosa, 17. Hymenochaete escobarii,
23. H. pinnatifida.
2. KEY TO SPECIES FOUND IN GREENLAND, CANADA AND
NORTHERN USA (north of California, Arizona, New Mexico, Texas,
Arkansas, Kentucky and North Carolina)
1. Hymenophore distinctly warted or with teeth up to 2.5(-4) mm long
CyOni Gi ye Sree Pee en see creer NN RL NU, ee ee eee ee 2
- Hymenium smooth or with scattered low tubercles ................cceeeeeeeeee 3
2 (1). Basidiomata very soft when dry, easily detachable from substrate; in
context and hymenium stellate asterosetae; mycelial strands at margin
usually present 1. Asterodon ferruginosum
- Basidiomata coriaceous, woody when dry, closely adnate; asterosetae and
mycelial strands absent 3. Hydnochaete olivacea
3 (2). Basidiomata pileate, effused-reflexed or with elevated margins ........... 4
SEPT ASICIOMALA CLLUSCU Pee et ras feo AAG ts Lat ore AYER ETOH CAR CRUE Cpt Rich ica Nae 6
4 (3). Setae few, in sterile hymenium numerous hyphidia with hook-like or
coiled tips; spores 5.5-8.3 um long 14. Hymenochaete curtisii
- Setae numerous; hyphidia absent or without coiled tip; spores 3.8-7 um
LOTTE Ne Pe RON ccs a ec reed arse eae ts Doct Dee Sa nves Anat a Totus ce Bee 5
124
5 (4). Basidiome woody hard; pileal surface velutinous, soon glabrous; hy-
menium not cracked or deeply scantily creviced when old; no setal hyphae
27. Hymenochaete rubiginosa
- Basidiome soft coriaceous, brittle when dry; pileal surface radially fibrose,
hairy, glabrous when very old; hymenium radially or plumosely densely
cracked; setal hyphae usually present but scattered, 120-250 um long
28. Hymenochaete tabacina
6.(3).;Dendrohyphidiajabsent .33. 82 ns te ee opener ff
- Dendrohyphidia with thickened brownish walls, usually repeatedly
branched; basidiome sometimes stratose with alternating hyphal and
setal layers 23. Hymenochaete pinnatifida
7 (6). On bark scales of living angiospermic trees; spores ellipsoid to broadly
ellipsoid, 5.5-6.5 x 3-3.5 wm 10. Hymenochaete carpatica
-AMNeverions living trees tedieiids euhea nell SMe ds Reet Ney ae iam cas Svat obutanen 8
8 (/)e- Hyphal layer{present:(Sometimesi thin): sea exes, sasessaee es eee 9
- Hyphal layer absent, only (thickening) setal layer present .................. 10
9 (8). Basidiomata stratose, with 2-10 distinct rows of setae and sometimes a
thin hyphal layer between these, thickening (up to 1-2 mm), deeply
cracked; spores 4.5-6.5 x 1.8-2.8 wm
12. Hymenochaete cinnamomea ssp. spreta
- Basidiomata not stratose, thin (up to 200 wm), not cracked; spores broadly
ellipsoid, 7-8 x 4.2-5.2 um 8. Hymenochaete burdsallii
10 (8). Most setae with almost blunt tip, 7-15 um in diam, in upper part always
encrusted with amorphous granules or rugose; no hyphidia; spores cylin-
drical, slightly curved, 4.5-6.8 x 1.5-2.3 um
13. Hymenochaete corrugata
- Setae usually with an acute tip, not encrusted or in old basidiomata
sometimes encrusted in the upper part; hyphidia absent or when present,
then hyaline or brownish; spores 1.8-4.3 um broad ................0..eeeeeee 11
11 (10). Setae small, 30-60 x (5-)6-10(-12) um, without incrustation, some with ©
slightly curved tips, some sinuate; spores 4.5-5.5 x 2-2.5 um
29. Hymenochaete tenuis
- Setae 55-110 x 7-15 um, in old specimens sometimes encrusted; spores 5-
P25 &x 148-43 | me: vcs eight due a de Re lh Cee erecae oa alterna team 12
12 (11). Spores cylindrical, slightly curved, 5-6.5 x 1.8-2.6 wm. On conifers
18. Hymenochaete fuliginosa
- Spores ellipsoid or broadly ellipsoid. On angiospermic trees ................. 13
13 (12). Hymenium usually with scattered low rounded tubercles; spores
ellipsoid, 4.5-6 x 2.2-3.2 um 20. Hymenochaete jobii
- Hymenium smooth; spores broadly ellipsoid, 5-7.5 x 3.5-4.3 um
11. Hymenochaete cervina
3. KEY TO ALL SPECIES
1. Hymenophore distinctly warted or with teeth up to 2.5(-4) mm long
(hydnodid orodontoid) 2x jteerecs eer eee te eee 2
- Hymenium smooth or with scattered low tubercles ..........:.........:ceeceeees: 5
125
2 (1). Basidiomata very soft when dry, easily detachable from substrate; in con-
text and hymenium dichotomously branched hyphae or stellate astero-
setae; mycelial strands at margin usually present; spores 1.8-4.5 ym in
UAL Cat Bats Seas. MRR a anata atin ON EMORY RON OPT OR iy, Su EIR Iii ees etic I 3
- Basidiomata coriaceous or soft-coriaceous, closely adnate; dichotomously
branched hyphae and asterosetae absent; mycelial strands absent; spores 5-
Oe Tig MEO TA le rt oh a: Be Nar im Rs tre RN Bl ie 4
3 (2). Basidiomata effused; in context and hymenium numerous asterosetae;
spores 4.5-7 x 3.5-4.5 ym. Not found in southern USA (except AR) and
Mexico 1. Asterodon ferruginosus
- Basidiomata effused-reflexed or effuse; in context numerous dichotomously
branched hyphae; spores 3-4.2 x 1.8-2.3 um. Southern species, Mexico
and to the South 2. Dichochaete setosa
4 (2). Tomentum absent, in old specimens cortex present as a black zone near
substrate; setae numerous, 60-200 x 8-15 ym 3. Hydnochaete olivacea
- Tomentum present as a cottony upper layer of the context; cortex present as
a dark line; setae rare, present in the hymenium of the upper part of the
teeth and between these, 25-55 x 5-9 um 4. Hydnochaete tabacina
5 (1). Basidiomata pileate, effused-reflexed or umbonate ....................06:0000s 6
- Basidiomata effused, margins sometimes slightly elevated .................... 14
6 (5). Basidiome pileate, with a (sometimes branched) distinct stipe, 2-10 cm
high; usually growing on ground near trees. Southern species, Mexico and
to the South 15. Hymenochaete damicornis
- Basidiome always without a stipe, growing on wood .................:1eceeeeeee i
7 (6). Pileus flexible, soft; no cortex; hyphal layer well developed, with loosely
arranged hyphae; spores cylindrical, slightly curved, 1.5-2.5 um broad . 8
- Pileus coriaceous or woody hard, not flexible; hyphal layer absent or when
present, then hyphae more or less densely arranged and basidiome with a
cortex; spores cylindrical or ellipsoid, 1.2-4.8 wm broad ..................... 9
8 (7). Basidiomata effused-reflexed; setae few, in sterile hymenium numerous
hyphidia with hook-like or coiled tips; spores 5.5-8.3 4m long
14. Hymenochaete curtisii
- Basidiomata sessile-pileate or umbonate-sessile; setae scattered or numer-
ous; no hyphidia with coiled or hook-like tips; spores 4.5-7 ym long
25. Hymenochaete rheicolor
9 (7). Setae 4-8 zm in diam. Southern species, Mexico and to the South ..... 10
see metacd <1). pintin iain grven eek ae eee eh ON eee a eae, emi teeey Be EON 12
10 (9). Dendrohyphidia present; setal layer distinctly stratose; spores broadly
ellipsoid, 5.2-6.5 x 3.5-4.5 wm 17. Hymenochaete escobarii
- Dendrohyphidia absent; setal layer never distinctly stratose; spores subcyl-
indrical to,broadlyellipsoid#3-5ix- 178-235) rem eae ces. cael catn 11
11 (10). Hyphidia absent; setae 20-40 x 4-8 pm; spores 3-4(-4.5) um long; hy-
menium brown, greyish or dark brown to blackish
9. Hymenochaete cacao
- Numerous brownish encrusted hyphidia with thickened walls present; setae
(25-)40-60 x 5-8 ym; spores 4-5(-5.5) wm long; hymenium greyish to
126
brownish orange, in old specimens rust brown
22.Hymenochaete luteobadia
12 (9). Basidiome woody hard; pileal surface velutinous, soon glabrous; hy-
menium not cracked or with few deep crevases when old; no setal hyphae;
setae 40-80(-100) x 8-10(-12) um, without incrustation; spores ellipsoid,
with one side flattened, 3.8-5.5 x (1.8-)2-2.8 um
27. Hymenochaete rubiginosa
- Basidiome coriaceous; pileal surface radially fibrose or coarsely hirsute,
glabrous when old; setae (50-)60-150 x 7-15(-16) um, with encrusted tip;
a cylindrical, slightly curved or allantoid, (4.3-)4.5-11(-13) x 1.2-2.7
13 2) ) Pileal surface radially fibrose and hairy; hymenium radially or plumo-
sely densely cracked; setal hyphae usually present but not numerous, 120-
250 pum long; setae (50-)60-120(-150) x 7-15(-16) um, with finely en-
crusted tip; spores slightly curved, 4.5-7 x 1.2-2.2 um
28. Hymenochaete tabacina
- Pileal surface coarsely hirsute; hymenium not cracked; setal hyphae absent;
setae 80-150 x (9-)10-15 um, in upper part or at tip encrusted with gran-
ules of polyhedric crystals; spores curved (allantoid), 8.5-11(-13) x 2.2-
2.7 pm 5. Hymenochaete allantospora
145(5)>,Dendrohyphidiavabsents ype sets eee eee er ene 15
- Dendrohyphidia with thickened brownish walls, usually repeatedly
branched; basidiome without tomentum but with cortex and hyphal
layer, sometimes stratose with alternating hyphal and setal layers
23. Hymenochaete pinnatifida
15 (14). Hyphal layer present (sometimes thin) ....................ceeeeeeeeeeeee ees 16
- Hyphal layer absent or indistinct, only (usually thickening) setal layer
PLeSenit ery HONEA SA Ae LS AE RN SNE ue eg LE en Crete a 26
16 (15). Hyphal layer (seemingly) duplex, with a dark line in this layer.... 17
=" Hyphalidayernotiduplex: 20) 2a ee en eee 18 .
17 (16). In sterile hymenium hyphidia with yellowish thickened walls; in hy-
phal layer setal hyphae absent; basidiome with a dark line (cortex) in
context dividing it into two parts 21. Hymenochaete leonina
- Hyphidia always absent; setal hyphae infrequent, up to 150 um long, 5-
10 um in diam; dark line in hyphal layer sometimes present
26. Hymenochaete rigidula
18 (16). Cortex present, sometimes thin (12-60 um). Very rare southern spe-
CLESE YY HEISE ERY eI USS ES Epa SIEas 19
-)/ w@ortexiindistincet onabsentey 32.402). J aueeh oe ean ee ee ee ee 20
19 (18). Setae 70-100 x 8-12 tum, always encrusted with groups of crystals,
or crystals forming a narrowly conical cap; basidiome 100-600 ym
thick; spores cylindrical, slightly curved or sigmoid, (7-)7.5-9.2 x 2.5-
3(-3.2) wm 6. Hymenochaete americana
- Setae 70-90(-95) x 7-9(-10.5) um, without incrustation; basidiome up to
225 wm thick; spores broadly ellipsoid, 5-6 x 3.2-4 um
19. Hymenochaete fulva
PURCLS PeSelaciDU-OU Miho Siesta tree, eee seeee nye Ma a a ee Cr VES 21
PR SLAG JN SE LO VEMON SH are cater eT Ma matnee hel keener ttn, Ae OE z3
21 (20). Setae rare or scattered, fusiform; spores 3.5-5 x 1.8-2.5 pm;
hyphidia absent; basidiome thin (up to 230 pum), soft to coriaceous
16. Hymenochaete epichlora
- Setae numerous, subulate to fusiform; basidiome 200-1000 pm thick,
COLIACEOUSHLO WOOGYallardearas ty iaies ceatiem tata, Mie ete t tes cana ene, cee Paty 22
22 (21). Setal hyphae absent; spores 4-5 x 2.4-3.2(-3.5) um; hyphidia not nu-
merous, hyaline or yellowish 30. Hymenochaete unicolor
- Setal hyphae infrequent, up to 150 um long and 4-10 pm in diam; spores
3.7-5 x 1.5-2.3(-2.5) um; hyphidia absent 26. Hymenochaete rigidula
23 (19). Setae rare or scattered; spores cylindrical, slightly curved, 5.5-8.3 x
1.5-2.5 ym; hyphidia numerous, with hook-like or coiled tips in sterile
hymenium 14. Hymenochaete curtisii
- Setae numerous; spores cylindrical or ellipsoid; hyphidia with coiled tips
ABSENT ee Meee ROR Eee LLL MOTTE MIAN TS FT LMR onan en ae a GAL AAO Nee, 24
24 (23). Basidiomata stratose, with 2-10 distinct rows of setae and sometimes
a thin hyphal layer between these, thickening (up to 1-2 mm), deeply
cracked; spores short cylindrical, 4.5-6.5 x 1.8-2.8(-3.2) ym. Common
species 12. Hymenochaete cinnamomea ssp. spreta
- Basidiomata not stratose, thin (up to 300, rarely 700 or 1000 pum), not
deeply cracked; spores ellipsoid, 2.3-5.2 um broad. Very rare species . 25
25 (24). Spores broadly ellipsoid, 7-8 x 4.2-5.2 um; basidioles thin-walled, 5-8
pm in diam 8. Hymenochaete burdsallii
- Spores ellipsoid, 4.8-6 x 2.3-3.3 um; basidioles with thickened walls, 3.5-5
pm in diam 24. Hymenochaete rhabarbarina
26 (15). Setae 7-15 um in diam, setal tip usually encrusted with crystals or
amorphous granules. On angiospermic trees, rarely on conifers .......... pad
- Setae 5-11 um in diam, without incrustation (in H. opaca encrusted in
LIDPELIMIOSt: Part eacemeee tetera tees coe tee erate ines LEN etc sepheuna le Rome 4 30
27 (26). Most setae with almost blunt tip, in upper part encrusted with
granules; no hyphidia; spores cylindrical, slightly curved, 4-6.8 x 1.5-2.3
- Setae usually with acute tip, in older basidiomata with encrusted with
crystals upper part or tip; hyphidia absent or when present, then hyaline
of brownish @spores 272-4. 3.0m broad yo ie eet hone rae ee ct eee 29
28 (27). Cortex absent but thin dense cortex-like layer of hyphae may be
present; basidiome brownish or reddish grey, later sometimes dark brown.
Common species 13. Hymenochaete corrugata
- Cortex 30-40 um thick; basidiome yellowish brown to brown. Doubtful
species, found only twice 31. Hymenochaete episphaeria
29 (27). Hymenium usually with scattered low tubercles; spores ellipsoid, 4.5-6
x 2.2-3.2(-3.5) wm 20. Hymenochaete jobii
- Hymenium smooth; spores broadly ellipsoid, 5-7.5 x 3.5-4.3 um
11. Hymenochaete cervina
128
30 (26). On bark or between bark scales of living angiospermic trees. Spores
ellipsoid, (5-)5.5-6.5(-7) x (2.8-)3-3.5 wm; most setae 50-90 x 6-10 pm,
some setae 20-25 x 5.5-7 wm 10. Hymenochaete carpatica
- Never on living trees. Spores cylindrical or ellipsoid, 1.5-2.6 ym in width;
Setae:more-onless‘ofunifOrm size Chis. c nee eee te. ree eee ee eee 31
31430) eSetaeS0-O08X'5-10 rm es. Bel ee eee oie) | paren rene | ee araeg a2
“0 Setae 65-100 Xi7-L1 pm le ya apespncas «coats 2 ee ee ee oi)
32 (31). Basidioles hyaline, thin-walled; spores 4.5-5.5 x 2-2.5 wm; some setae
with slightly curved tips, sometimes some sinuate; no cystidia
29. Hymenochaete tenuis
- Basidioles yellowish, encrusted with thin granules; spores 3.2-4(-4.5) x
(1.5-)1.8-2.3(-2.5) um; setae usually flexuose; cystidia sometimes present,
with thickly encrusted walls, 15-23 x 6-12(-15) um
7. Hymenochaete anomala
33 (31). Setae without incrustation; on wood of coniferous trees. Common in
boreal forests, not found in southeastern USA or Mexico
18. Hymenochaete fuliginosa
- Setae encrusted in uppermost part with small crystals; on wood of
angiospermic trees. Described from Jamaica, mentioned (possibly errone-
ously) from AL, FL, LA and Mexico; dubious species
32. Hymenochaete opaca
ASTERODONTACEAE
1. Asterodon ferruginosus Pat. era Picsw3e240" 2
Pat., Bull. Soc. Mycol. France 10: 130 (1894); Corner, Trans. Brit. Mycol. Soc.
31: 235, f. 1-5 (1948); Parmasto, Lachnocladiaceae Soviet Union 121, 151, f. 88-95,
105 (1970). - Hydnochaete setigera Peck, Ann. Rep. New York St. Mus. 50: 113
(1897). - Asterostroma ochrostroma Burt, Ann. Missouri Bot. Gard. 11: 34 (1924).
Basidiome annual, effused, easily detachable from substrate, cottony soft,
light weight, to 5 mm thick, round, 3-20 cm in diam (when confluent to 5 m
long); context soft, loose, cottony, up to | mm thick. Hymenophore warted,
soon composed of densely arranged teeth, bright Fulvous or Ochreous-Fulvous
to Sienna (M: 7.5 YR 6/8, sometimes 5-7/6-8; K & W: (5-)6 C 7 or 6 C-D 6,
brownish orange, caramel brown or cinnamon brown); teeth cylindrical-
conical, (0.2-)0.5-2(-4) mm long, 0.12-0.3(-0.4) mm diam; margin 0.5-2 mm
wide, thin, radially fibrillose or almost arachnoid, whitish, then concolorous
with hymenophore, later disappearing; margin and rotten substrate with
numerous, sometimes branched, soft, whitish, later brownish mycelial threads
up to 0.7 mm in diam.
Tomentum and cortex absent; context composed of hyphal layer 200-1000
um thick; dark line above the hymenium absent. |
Hyphal system asteritrimitic with generative and skeletal hyphae, and
asterosetae; setal hyphae present in teeth, 60-170 x 5-7 um; generative hyphae
numerous, with thin hyaline or yellowish walls, septate, branched, 1.5-3 wm in
diam; skeletal hyphae thick-walled, brownish, 1.5-3 um in diam; asterosetae
common, with 3-5(-7) unbranched rays, each 30-120(-150) x 5-8 wm, in subhy-
129
menium smaller than at substrate; hyphae in teeth more or less parallel; in
hymenium crystalline matter absent.
Hymenial setae numerous, 40-80 x 5-10 ym, single or as sidebranches of
setal hyphae, simple or with 2-4 sidebranches at base, 25-80 x 5-10 pm,
projecting to 40 ym, subulate to fusiform, with acute tip, straight, naked, with-
out incrustation.
Cystidia (cystidioles) not numerous, mainly situated on tip of a tooth,
fusoid, with usually cylindric upper part, thin-walled, 20-50 x 4-6 wm; hyphidia
rare, hyaline, 1-2.5(-3) wm in diam. Basidioles present, without incrustation;
basidia clavate, some slightly flexuose, 17-25(-30) x 5-7(-8) wm; sterigmata 4,
4-5 um long; spores broadly ellipsoid, with one side slightly flattened, with thin
or slightly thickened walls, 5-6.5(-7) x 3.5-4.5 um.
SUBSTRATA IN N. AMERICA. Abies balsamea (6), A. lasiocarpa (G & L,
1995), Acer rubrum (1), Acer sp. (1), Betula alleghaniensis (8), B. papyrifera (1),
Betula sp. (4), Fagus grandifolia (3), Fagus sp. (2), Picea engelmannii (4), P. glauca
(G & L, 1995), P. rubens (7), Picea sp. (3), Pinus monticola (1), P. strobus (2),
Populus grandidentata (1), Populus sp. (2), Pseudotsuga menziesii (2), Thuja plicata
(1), Tsuga canadensis (12), T. heterophylla (4), Tsuga sp. (8).
DISTRIBUTION IN N. AMERICA. CANADA: BC (1), NB (G & L, 1995),
ON (5), PQ (1), YT (G & L, 1995). USA: AR (G & L, 1995), CT (G & L, 1995), DE
(1), ID (11), MA (2), ME (8), MI (16), MT (8), NH (28), NY (17), VT (3), WA (1),
WI (1).
DISTRIBUTION ELSEWHERE. Europe; Asia-Temperate: Russia (W.
Siberia, S. Siberia incl. Altai and Sayani Mts.). - On rotten logs, under roots of old
rotten stumps or in forest litter of mainly coniferous trees (Abies, Larix, Picea, Pinus).
REMARKS. Basidiomata of this species are sometimes growing over the
remains of the last year ones, and seem to be stratose. One of such specimens
seen by me (collected in Vermilion, Michigan; BPI 325219) has 7 layers and is
more than 15 mm thick. Development of microstructure in this species has been
described in detail by Corner (1948). Parmasto (1970: 125) found that the first
stage in development of skeletal hyphae and asterosetae from the generative
hyphae is identical: after a septum, a brownish hypha with thickening walls
begins to grow. After an interval of length equal with prospective rays of an
asteroseta, growth stops in one case and an asteroseta will develop. In other
cases, the growth of the hypha is unlimited and a skeletal hypha will be
formed. Accordingly, skeletal hyphae and asterosetae are homologous in this
species. Misidentifications. In herbaria, sometimes A. ferruginosus has been
filed under the name Tomentella crinalis (Fr.) M.J. Larsen (Thelephoraceae s.
str.)
CLAVARIACHAETACEAE
2. Dichochaete setosa (Sw.: Fr.) Parmasto Riess, 2 Deus
Parmasto, Folia Crypt. Estonica 37: 57 (2001). - Thelephora setosa Sw., FI.
Indiae Occid. 3: 1929 (1806); Fr., Syst. Mycol. 3, Index 189 (1832). - Hydnochaete
setosa (Sw.) Lloyd, Mycol. Writ. 4, Mycol. Notes 41: 559, f. 766 (1916). - Hydnum
resupinatum Sw., Prodr. 149 (1788). - Hydnochaete resupinata (Sw.) Ryvarden, Myco-
130
taxon 15: 437, f. 5 (1982); Corner, Ad Polyporaceas 7: 164, f. 39-42 (1991). -
Hymenochaete aspera Berk. & M.A. Curtis, J. Linn. Soc. Bot. 10: 334 (1868); Burt,
Ann. Missouri Bot. Gard. 5: 311, f. 2 (1918); Reeves & Welden, Mycologia 59: 1040,
f. 1 J (1967); Léger, Hymenochaete 57, f. 10 (1998).
Basidiome effused, effuso-reflexed or resupinate with elevated margins,
closely adnate but sometimes separable, cottony soft or papery when dry,
100-3000(-7000) um thick. Pilei confluent, imbricate, flabelliform to dimidiate,
(0.5-)1-3(-5) cm long and to 10 cm wide, flexible when dry; surface radiately
strigose, rough with coarse fibers, or densely covered with entangled forked or
corniculately branched hairs up to 4 mm long, with concentric zones, at base
sometimes with long branched outgrowths, dark Sienna to Umber (M: 5-7.5
YR 4/4, 6/8 or 4/6-8; K & W: 6 E7 or 6 D 5 - 6, cognac or sunburn to
cinnamon brown); margin thin, entire to lacerate, sometimes long-fimbriate (up
to 7 mm broad) or eroded at the edge, plicate, concolorous with the pileal
surface. Hymenium granulose, colliculose, then warted or hymenophore
irregularly hydnoid; aculei pointed to rounded, scattered or in groups, up to 2
mm long, dark Sienna to light Umber (M: 5-7.5 YR 5/7-8, 5/5 or 4/6; K & W:
6 C 3 - 6 E 6-7, light brown to cocoa colour at the center; 6 B 4, greyish
orange at the edges), without olive or lilac tint; margin of the resupinate part
usually fibrillose, concolorous or lighter than hymenium, or with a darker
zone; mycelial strands usually present at the margin and at base of the
basidiome, up to 10 mm long, finger-like, sometimes brighter coloured.
Tomentum and cortex absent; context composed of hyphal layer, some
darker hyphae agglutinated to form a thin darker band in some areas;
sometimes in context hyphal threads 50-100 ym in diam; or of hyphal layer and
a setal layer formed of overlapping rows of setae; dark line above the
hymenium absent.
Hyphal layer 100-1000 pm thick, concolorous with other layers, cinnamon
to rusty brown; context hyphae tightly interwoven but more loosely arranged
towards the adaxial surface, often structure fibrillose with elongated cavities:
and hyphal threads 20-45 or up to 90 um in diam, these longitudinally arranged
or descending, curved outward toward the upper surface of the pileus.
Hyphal system dimitic with generative and dichohyphae; setal hyphae
present in context and in pileal surface, up to 250 um long, 4-10 wm in diam;
generative hyphae 2-5 wm in diam, yellowish to brownish, thin- to
thick-walled, septate, in the subhymenium hyaline and thin-walled; dicho-
hyphae rare or abundant in the teeth, less common in the context but numerous
at margin of the pileus, strongly dendroidly, dichotomously branched with
mostly short sidebranches, yellow to hyaline; in context, setal stratum and
hymenium crystalline matter absent.
Setal layer 40-100 um thick (when present); setae uncommon to numerous,
40-80 x 5-10 wm, projecting to 30-40 um, conical to fusiform, with acute tip,
straight, naked or enmeshed in hyphal sheaths, without incrustation.
Dichotomous hyphidia abundant in the teeth, with mostly short side-
branches; dendrohyphidia present or absent (see above about dichohyphae);
cystidia absent; basidioles present, without incrustation; basidia clavate or sub-
13]
clavate, 8-15 x 3-5 um; sterigmata 4; spores broadly ellipsoid, 3-4.2 x 1.8-2.3
pm.
SUBSTRATA IN N. AMERICA. On dead wood of deciduous trees.
DISTRIBUTION IN N. AMERICA. MEXICO: VC (Cordoba, Matlaquihahuite,
Dec 1854 Sallé, K; near Cordoba, 17 Jan 1910 W.A. & E.L. Murrill 1215, NY).
DISTRIBUTION ELSEWHERE. Mesoamerica: Costa Rica; Caribbean: Cuba,
Dominica, Jamaica, Puerto Rico, Trinidad; South America: Argentina (Tierra del
Fuego), Brazil, Chile, Colombia, Ecuador, Venezuela; Asia-Tropical: India (N. India
and Bengal), Nepal.
TYPES STUDIED. Thelephora setosa: Jamaica, Swartz (K). Hydnum resupina-
tum: Jamaica, Swartz (K, lectotype selected by L. Ryvarden; K, S, isolectotypes).
Hymenochaete aspera: Cuba, Wright 211 (K; isolectotypes: BPI 277592, FH, K, NY,
S; paratypes: K).
REMARKS. Strigose pileal surface, granular to hydnoid hymenium and
dichotomous hyphidia similar to those in Clavariachaete and Vararia are the
most important characteristics of this species.
HYMENOCHAETACEAE
3. Hydnochaete olivacea (Schwein.: Fr.) Banker Figs. 2, 4; 5, 17
Banker, Mycologia 6 (5): 234 (1914); Ryvarden, Mycotaxon 15: 433, f. 3 (1982);
Jung, Wood-rott. Aphyll. s. Appal. 131, f. 41, pl. 16 C, 26 E; Gilb. & Ryvarden, N.
Am. Polypores 1: 351, f. 168 (1986). - Sistotrema olivaceum Schwein.: Fr., Schr.
Naturf. Ges. Leipzig 1: 101 (1822). - Hydnum olivaceum (Schwein.: Fr.) Fr., Elench.
fung. 134 (1828). - Sistotrema fuscescens Schwein., Schr. Naturf. Ges. Leipzig 1: 102
(1822). - Hydnoporia fuscescens (Schwein.) Murrill, N. Am. fl. 9 (1): 3 (1907). - Inpex
cinnamomeus Fr., Epicr. 524 (1838).
Basidiome annual (?), effused or effuso-reflexed, closely adnate, coria-
ceous, woody when dry, 500-2800 um thick, round, 5-25 cm in diam; reflexed
margin (pileus) short (up to 2 mm) and broad. Hymenophore warted or
hydnoid with irregular, round to flattened teeth, obtused to incised in the top,
often antlerlike with a fused base; length of teeth 0.5-2.5 mm; hymenium not
cracked, in fertile specimens Cinnamon or reddish Brown (M: 7.5 YR 5/6-10;
K & W: 5 C 5-8, topaz to brownish yellow), rusty brown in sterile and old
specimens (K & W: 6 D 7-8, light brown), without olive or lilac tint; resupinate
margin fibrillose or abrupt, lighter coloured (M: 7.5 YR 8/6-8 to 7/10 when
older), then concolorous with hymenium, pale cinnamon to rusty brown or
ferruginous.
Tomentum and cortex absent, or cortex present in old specimens as a black
zone next to the substrate; context composed of hyphal layer, or setal layer
only with setae scattered throughout; dark line above the hymenium absent.
Hyphal layer to 300 pm thick, rusty brown, homogeneous (without a dark
line); hyphal system dimitic; setal hyphae present; generative hyphae 1.5-3 wm
in diam, yellowish, with thickened walls, moderately branched, with scattered
septa; skeletal hyphae dominating, yellow to pale rusty brown, 3-5 um in diam,
thick- or very thick-walled to solid; there are also a few hyphae of transitional
type with very rare septa; in context and hymenium crystalline matter absent.
132
Setae numerous, 60-200 x 8-15 ym, projecting to 50 um, fusiform-subu-
late, with acute tip, straight, naked, without incrustation.
Hyphidia, cystidia and basidioles absent; basidia clavate or subclavate,
6-12 x 4-5 wm; sterigmata 4; spores cylindrical to allantoid, 5-6 x 1.2-2 pm.
SUBSTRATA IN N. AMERICA. On dead branches, often still attached to the
trees. Acer rubrum (G & L, 1995), A. spicatum (Jung, 1987), Alnus incana (includ.
ssp. incana and ssp. rugosa) (G & L, 1995), A. rubra (1), A. viridis ssp. crispa (G &
L, 1995), Betula alleghaniensis (G & L, 1995), B. lenta (G & L, 1995), B. lutea (Jung,
1987), B. pumila (G & L, 1995), Carpinus caroliniana (G & L, 1995), Fagus
grandifolia (G & L, 1995), Ligustrum sp. (1), Ostrya virginiana (1), Populus sp. (G
& L, 1995), Prunus serotina (G & L, 1995), Pseudotsuga menziesii (G & L, 1995),
Quercus alba (1), Q. coccinea (1), Q. marilandica (1), Q. nigra (G & L, 1995), Q.
rubra (syn.: Q. borealis) (3), Q. velutina (G & L, 1995), Quercus sp. (17), Salix nigra
(G & L, 1995).
DISTRIBUTION IN N. AMERICA. CANADA: NB (G & L, 1995), NS (G &
L, 1995), ON (5), PQ (7). MEXICO: VC (Jalapa, 1). USA: AL (G & L, 1995), AR
(1), CT (4), FL (3), GA (G & L, 1995), ID (G & L, 1995), IL(G & L, 1995), IN (G
& L, 1995), KY (G & L, 1995), LA (3), MD (1), ME (G & L, 1995), MI (G & L,
1995), MO (G & L, 1995), MS (1), MT (G & L, 1995), NC (7), NH (G & L, 1995),
NJ (1), NY (G & L, 1995), OH (G & L, 1995), PA (Ryvarden, 1982; G & L, 1995),
RI (1), SC (G & L, 1995), TN (6), TX (G & L, 1995), VA (G & L, 1995), VT (G &
L, 1995), WA (1), WI (1), WV (G & L, 1995).
DISTRIBUTION ELSEWHERE. Caribbean: Jamaica; South America: Ecua-
dor.
TYPE STUDIED. Sistotrema olivaceum: USA, Pennsylvania, Salem, 540 (UPS,
isotype).
4. Hydnochaete tabacina (Berk. & M.A. Curtis) Ryvarden Figs. 2, 3; 5, 14
Ryvarden, Mycotaxon 15: 441, f. 7 (1982); Gilb. & Ryvarden, N. Am. Polypores
1: 353, f. 169 (1986); Corner, Ad Polyporaceas 7: 168, f. 43 (1991). - Irpex tabacinus
Berk. & M.A. Curtis in Fr., Nova Acta Reg. Soc. Sci. Upsal. II 1: 106 (1851). -
Cerrenella tabacina (Berk. & M.A. Curtis) Murrill, Bull. Torrey Bot. Club 32: 361
(1905).
Basidiome effused to effuso-reflexed, closely adnate, coriaceous when dry,
up to 3000 um thick. Pilei single or a few growing together, short and broad,
when present reflexed part up to 0.6 cm long; pileal surface concentrically sul-
cate or not, tomentose but not radiately fibrillose or rugose, with concentric
zones, dark cinnamon brown; margin entire, not plicate, concolorous with the
pileal surface. Hymenophore hydnoid, azonate, cracked, dark Sienna, dark
Cinnamon (M: 7.5 YR 5-8/10; K & W: 6 D 6-7, cinnamon brown to raw
Sienna), in old specimens dark brown, without olive or lilac tint; teeth round
and acute to flattened, often fused in basal parts, sometimes radially arranged,
when immature sinuous and deeply incised, up to 2 mm long, 2-3 per mm;
resupinate margin concolorous with hymenophore.
Tomentum present as the floccose or cottony upper layer of the context, up
to 200 pm thick; cortex (30-)40-50(-100) um thick; hyphal layer 200-300 pm
153
thick, hyphae interwoven; trama in the teeth distinctly paler, hyphae more
parallel intertwined.
Hyphal system subdimitic; setal hyphae present; generative hyphae 2-4(-5)
ym in diam, subhyaline to pale rusty brown, thin-walled or with thickened
walls, septate, very rare in the context; skeletoids numerous in tomentum and
hyphal layer but lacking or few in hymenophoral trama, dark rusty brown,
3.5-6 um in diam, thick-walled; in context and hymenium crystalline matter
absent.
Setae rare or not numerous, present in the hymenium in the upper part of
the teeth, 25-55 x 5-9 um, projecting to 30 wm, fusiform, with almost blunt tip,
straight, often with slightly undulating walls, without sheaths or incrustation.
Hyphidia and cystidia absent; basidioles 4-5.5 um in diam; basidia 13-20 x
4.5-6 um, soon collapsing; spores cylindrical or allantoid, 5-6 x 1.5-2 um.
SUBSTRATA IN N. AMERICA. Quercus alba (1), Q. macrocarpa (1), Q. rubra
(syn.: Q. borealis) (1), Q. virginiana (1), Quercus sp. (3).
DISTRIBUTION IN N. AMERICA. USA: FL (12), GA (2), LA (2), MO (1),
NC (3), SC (Ryvarden, 1982), TN (1).
DISTRIBUTION ELSEWHERE. Not found.
REMARKS. Mean size of spores was 5.28 x 1.78 um (Q = 2.96) in the
only specimen studied which has spores (TAA 151201, TN). The species has
been lectotypified by Maas Geesteranus (1974) who selected Curtis 2358 (K).
Subsequently Ryvarden (1982) designated Curtis 2356 (K) as lectotype.
5. Hymenochaete allantospora Parmasto Fig2695
Parmasto, Folia Cryptog. Estonica 37: 58, f. 1, 7 (2001).
Basidiomata effuso-reflexed with small pilei 0.5-1 cm long, 200-500(-700)
um thick, resupinate part 1-3 cm in diam, then confluent; upper surface of pilei
coarsely hirsute, indistinctly zonate, dark Umber (M: 7.5 YR 3-4/4; K & W: 6
E 6-7, later 6 F 7, dark brown). Hymenium smooth, sometimes concentrically
sulcate, not cracked, fulvous Umber or dark Hazel (M: 7.5 YR 5/5, later 5 YR
6/4; K & W: 6 D 4-5, then 6 D 3, light brown to greyish brown = Café-au-
lait), without olive or lilac tint; margin of the pileus slightly lobose or lacerate.
Tomentum well developed; cortex present; context composed of hyphal
layer and (in old specimens) of setal layer; dark line above the hymenium
absent or indistinct.
Tomentum 200-400(-600) pm thick, hyphae in ascending bundles,
brownish, with thickened walls, 3.5-5 wm in diam; cortex 20-35(-45) um thick,
hyphae densely parallel, agglutinated, brown; hyphal layer up to 300 um thick,
hyphae densely longitudinally arranged but not agglutinated.
Hyphal system monomitic; hyphae with thickened walls, brownish,
septate, rarely branching, 2.5-4 wm in diam; uncommon hyphae thin-walled
and subhyaline; in hymenium crystals or granules of resinous brownish matter
locally present.
Setae rare or uncommon, 80-150 x (9-)10-15(-16) wm, projecting up to
120 um, subulate to fusiform, very easily breakable, with acute tip, straight,
enmeshed in thin or thick hyphal sheaths, in upper part or at tip encrusted with
granules of polyhedric crystals.
134
Cystidia absent; hyphidia numerous, cylindrical, thin-walled and hyaline,
then brownish, with thickened walls usually encrusted with resinous granules or
crystals, 2-3.5 zm in diam; basidioles not numerous, partly with slightly thick-
ened and encrusted walls; basidia clavate-cylindrical, 20-25 x 5-6 um; sterig-
mata 4, 3-4 wm long; spores cylindrical, curved (allantoid), 8.5-11(-13) x 2.2-
2.7 pm.
SUBSTRATA IN N. AMERICA. Unknown.
DISTRIBUTION IN N. AMERICA. MEXICO: VC (Rancho Santa Inés, km 1
of the Xalapa-Coatepec road, alt. 1330 m, 29 Mar 1990 V.M. Bandala, TAA 171364,
holotype; XAL, isotype; near Xalapa, alt. 1330 m, 10 Dec 1990 D.M. Murietta 359,
XAL; near Xalapa, 1750 m, 7 Jul 1994 A. Garcia-Velazquez 394, XAL and TAA
171365).
DISTRIBUTION ELSEWHERE. Not found.
TYPE STUDIED. See above.
REMARKS. H. allantospora is externally similar to H. tabacina which
has setae up to 120(-150) tum long and spores less than 7 um long, and setal
hyphae in context.
Mean spore size and Q value of the specimens studied:
9.36 x 2.33 4.02 (paratype, TAA 171365)
9.96 x 2.51 3.96 (holotype, TAA 171364)
6. Hymenochaete americana Greslebin & Parmasto Figs. 4, 5; 6, JJ
Parmasto, Folia Cryptog. Estonica 37: 59, f. 2 (2001).
Basidiomata resupinate, crustose, 100-600 um thick, 1-3 cm in diam, then
confluent. Hymenium smooth or with scattered rounded tubercles, slightly
cracked, dark Vinaceous Buff to dark Fawn or chocolate brown (M: 5 YR 5/3
or 3-4/3-4; K & W: 6 D 4), without olive or lilac tint; margin broad (up to 2
mm wide), distinct, yellow-ochre or Sienna (M: 7.5 YR 5/8; K & W: 5 C-D 7,
yellow ochre or golden brown), later not distinguishable from the hymenium.
Tomentum present but sometimes indistinct; cortex present; context com-’
posed of thin hyphal layer and later a stratose setal layer; dark line above the
hymenium absent.
Tomentum 25-40 pm thick, hyphae loosely interwoven, brownish, with
thickened walls, 4-5 4m in diam; tomentum in old specimens disappearing; cor-
tex 20-60 ym thick, hyphae parallel densely agglutinated, brown; hyphal layer
thin, hyphae more or less loosely, longitudinally arranged.
Hyphal system subdimitic; setal hyphae absent; generative hyphae 2-3.5
um in diam, yellowish, with thickened walls; skeletoids brownish, 3-4.5 um in
diam; in context and hymenium crystalline matter locally present.
Setal layer 50-400 pm thick, indistinctly 1-3-stratose; setae not numerous
or numerous, (60-)70-100 x 8-12 um, projecting up to 70 um, subulate to
fusiform, with acute tip, straight, naked or rarely enmeshed in hyphal sheaths,
always encrusted with small groups of polyhedric crystals, sometimes crystals
forming a narrowly conical cap.
Cystidia and hyphidia absent; basidioles numerous, with slightly thickened
walls; basidia clavate-cylindrical, 15-22 x 5-6 wm; sterigmata 4, 4-5 um long;
135
spores cylindrical, slightly curved, sometimes some almost sigmoid, (7.0-)7.5-
9.2(-9.5) x 2.5-3(-3.2) wm.
SUBSTRATE IN N. AMERICA. Quercus arizonica (2).
DISTRIBUTION IN N. AMERICA. USA: AZ (Pima Co, Coronado Nat. For-
est, Sycamore Canyon, 24 Sep 1970 and 21 Jan 1971 E.R. Canfield 56 and 7122,
ARIZ).
DISTRIBUTION ELSEWHERE. Southern South America: Argentina (Tierra
del Fuego), Brazil (Rio Grande do Sul).
TYPES STUDIED. Argentina, Tierra del Fuego, Estancia Moat, on Drymis
winteri, 12 Nov 1999 A. Greslebin 2181 (TAA 166666, holotype; BAFC, isotype).
REMARKS. The possibly related H. vaginata G. Cunn. differs in having
sometimes effused-reflexed basidiomata, numerous hyaline, yellow or brownish
hyphidia and encrusted with small crystals or not encrusted large setae 90-160 x
9-14 pm; it has been found once in New Zealand on Phyllocladus alpinus
(Pinopsida, Podocarpales), and (a young specimen) in Hawaii. Isotype of that
species (K) has only few, partly collapsed spores; these are (6-)6.8-8 x 2.4-
3.2 wm (mean of 12 spores: 7.24 x 2.79 um). If the two taxa are allopatric
species or subspecies, their origin and distibution is possibly Gondwanan.
7. Hymenochaete anomala Burt Biss s22 7515
Burt, Ann. Missouri Bot. Gard. 5: 358 (1918); Reeves & Welden, Mycologia 59
(6): 1040, fig. 1 D (1967); Job, Mycol. Helvet. 4 (1): 6 (1990); Léger, Hymenochaete
Dosuiet 2 (1998):
Basidiomata effused, closely adnate, coriaceous to hard when dry,
50-200(-250) wm thick, 0.5-2 cm long, then confluent. Hymenium smooth or
finely granulose, azonate, irregularly minutely cracked when old, Isabelline
(M: 10 YR 6-7/4, later 5-6/6; K & W: 5 C 4-5, brownish orange, to 5 D 5-7,
golden brown), with a slight olive tint, without a lilac tint; margin thin, slightly
tomentose, then determinate, concolorous with hymenium or lighter coloured
(K & W: 5A 4).
Tomentum and cortex absent; context composed of hyphal layer and con-
colorous setal layer, sometimes setal layer seated on substratum and hyphal
layer absent; setal layer composed of overlapping rows of setae; dark line
above the hymenium absent.
Hyphal layer (when present) to 150 wm thick, hyphae compactly inter-
woven; hyphal system monomitic or subdimitic, without setal hyphae; genera-
tive hyphae 2-4 ym diam, yellowish, branched, with slightly thickened walls;
skeletoids brownish, with thickened walls, 2-4 wm in diam; some crystals in
context and in hymenium, clusters of reddish brown granules to 25 wm diam
present.
Setal layer 60-120 um thick; setae numerous, small, (20-)30-45(-50) x
(4-)5-7(-8) wm, embedded or projecting to 15(-25) wm above the hymenium,
subulate to fusiform, usually flexuose, with tip acute, naked, without incrus-
tation.
Hyphidia absent; cystidia sometimes present, 15-23 x 6-12(-15) wm, cylin-
drical, with thin or thickened usually thickly encrusted walls; basidioles 4-5 wm
in diam, yellowish, usually encrusted with small granules; intermediates
136
between cystidia and basidioles sometimes present; basidia clavate or subcla-
vate, 15-20(-25) x 4-5 um, sterigmata 4, 3-4 um long; spores ellipsoid, one
side flattened, 3.2-4(-4.5) x (1.5-)1.8-2.3(-2.5) um.
SUBSTRATE IN N. AMERICA. Salix sp. (1).
DISTRIBUTION IN N. AMERICA. USA: LA (St. Martin Parish, St.
Martinsville, 14 Oct 1956 A.L. Welden 205, BPI 277530); MS (Harrison Co, Harrison
Exper. Forest, 2 Dec 1989 H.H. Burdsall 13034, CFMR).
DISTRIBUTION ELSEWHERE. Mesoamerica: El Salvador; Caribbean:
Cuba, Trinidad; South America: Argentina, Brazil, Venezueia.
TYPE STUDIED. Cuba, Managua, Earle & Murrill 36 (NY, holotype).
REMARKS. The ‘cystidia’ figured by Burt (1918, f. 26 c) and described
as 16-20 x 6 um are obviously encrusted hyphidia similar to those in H. yasu-
dai Imazeki, many specimens of H. cinnamomea ssp. spreta and very conspicu-
ously in H. mollis Bres. Cystidia are described as 6-12 um in diam by Reeves
& Welden (1967) and 7-11 wm in diam by Job (1990); on Fig. 1 D by Reeves
& Welden (1967) they are figured as similar to basidioles. In the holotype the
‘cystidia’ are actually somewhat enlarged hyphal ends covered with agglomera-
tion of crystals; they are hardly differentiated and not easily distinguishable.
8. Hymenochaete burdsallii Parmasto Figs sno, 7H 6
Parmasto, Folia Cryptog. Estonica 37: 61, f. 1, 4 (2001)
Basidiomata effused, closely adnate, coriaceous when dry, as round patches
0.5-2.5 cm in diam, 40-150 wm thick. Hymenium smooth but in some places
uneven (with very low tubercles), azonate, somewhat farinose, not cracked,
dark Ochreous (M: 10 YR 6/8; K & W: 5 C-D 7), without olive or lilac tint;
margin farinose-fibrillose, thin, when young about 1 mm wide, Luteous (M:
10 YR 7.5/10; K & W: 5 A-B 7), later disappearing and margin distinctly
delimited
Tomentum and cortex absent, hyphal layer absent or indistinct, then 20-
30 pm thick, hyphae densely interwoven but not agglutinated; setal layer with -
numerous hyphae; dark line above the hymenium absent; in hymenium
conglomerates of brownish resinous matter or crystals up to 10 wm in diam.
Hyphal system monomitic; setal hyphae absent; generative hyphae
brownish, with thin or thickened walls, (1.5-)2-3.2(-4) wm in diam.
Setae numerous but not crowded, subulate, with acute tip, straight,
(50-)60-90(-95) x 5-9(-10) um, projecting 30-50 um, usually covered with a
thin hyphal sheath.
Cystidia and hyphidia absent; basidioles numerous, hyaline, thin-walled,
with rounded tip, 15-25 x 5-7(-8) wm; basidia urniform, thin-walled, hyaline,
15-20(-25) x 6-7.5 wm, with 4 broad when young, then thin sterigmata about
4 um long; spores broadly ellipsoid, thin-walled, hyaline, some with one side
slightly flattened, (6.5-)7-8(-8.5) x 4.5-5.2(-5.5) wm.
SUBSTRATE IN N. AMERICA. Ostrya virginiana (2).
DISTRIBUTION IN N. AMERICA. USA: MI (Marquette Co, Big Bay, SE
slope of Breakfast Roll, 10 Aug 1974 H.H. Burdsall 8272, CFMR, holotype; nearby,
Lumbermanna cove, 9 Aug 1974 H.H. Burdsall 8252, CFMR, paratype)
TYPE STUDIED. See above.
il
REMARKS. Basidiomata of H. burdsallii are externally similar to H. cin-
namomea which has a well developed layer of loosely interwoven hyphae and
short cylindrical or almost ellipsoid narrow spores 4.5-6.5(-7).x 1.8-2.8(-3.2)
pm.
9. Hymenochaete cacao (Berk.) Berk. Pivse2 1-552
Berk., J. Linn. Soc. Bot. 10: 333 (1868); Reeves & Welden, Mycologia 59 (6):
1041, f. 1 C (1967); Job, Mycol. Helvet. 4 (1): 10 (1990); Léger, Hymenochaete 79, f.
18 (1998). - Stereum cacao Berk., Hook. J. Bot. 6: 169 (1854).
Basidiome sessile-pileate, effuso-reflexed or seemingly effused but attached
in midpoint and with slightly elevated margins (umbonate), closely adnate, hard
or coriaceous but brittle when dry, 250-600(-2000) um thick. Pilei single or a
few growing together, sometimes confluent and imbricate, flabelliform or dimi-
diate, 1-3.5 cm long; pileal surface densely concentrically sulcate and zonate,
velutinous or tomentose, yellowish brown, dark brown to blackish (M: 10 R
3-3.5/4; K & W:5 B2-6E 8 or 6-7 E 6 - F 7, orange grey to hazel, almost
chestnut or dark brown); margin lobate, plicate, concolorous with the pileal
surface. Hymenium azonate, not or slightly cracked, brown, dark brown or
blackish, usually somewhat greyish (M: 10 R 3-5/2 when with basidia; K & W:
5 E 3 or 6 E 4-6 G 8, greyish brown to purplish gray, sometimes 6 D 7),
without olive or lilac tint; margin sometimes pale yellow (K & W: 4 A 3 or
yellow orange).
Tomentum indistinct, 20-30 um thick, or present as abhymenial hairs; cor-
tex absent or sometimes only present as some agglutinated darker hyphae form-
ing a thin dark band in some areas; context composed of hyphal layer and setal
layer. Hyphal layer sometimes indistinctly duplex (upper part with very
thick-walled hyphae); setal layer with overlapping rows of setae; dark line
above the hymenium absent.
Cortex (when present) 20-30 um thick, hyphae densely interwoven, agglu-
tinated; hyphal layer 150-700 ym thick, concolorous with the setal layer;
context hyphae longitudinally, not very compactly arranged, sometimes glued
together.
Hyphal system monomitic; setal hyphae absent; generative hyphae 2.5-5
pm diam, yellowish to brownish, thick-walled; in hymenium of old specimens
crystalline matter present.
Setal layer (40-)80-140 ym thick; setae numerous, 20-40 x 4-8 um, pro-
jecting to 30 ym, fusiform, with stipe-like basal part (similar in form to metu-
loids of Peniophora species), straight, with tip acute, naked, without incrus-
tation.
Cystidia and hyphidia absent; basidioles present, without incrustation;
basidia clavate or subclavate, 8-12 x 3-5 ym; sterigmata 4, 2-3 wm long; spores
ellipsoid to broadly ellipsoid, 3-4(-4.5) x 1.8-2.5 ym.
SUBSTRATA IN N. AMERICA. Unknown.
DISTRIBUTION IN N. AMERICA. USA: NC (M.A. Curtis, BPI 277660).
MEXICO: ? VC (Jalapa, Escobar 1978; the specimen in NY collected by W.A. &
E.L. Murrill in 1909, no. 334 is very small and of somewhat doubtful identity).
138
DISTRIBUTION ELSEWHERE. Mesoamerica: Costa Rica, Mexico; Carib-
bean: Cuba, Guadeloupe, Jamaica, Puerto Rico; South America: Argentina, Brazil,
Colombia, Venezuela; Asia: India (Eastern part), Indonesia (Amboina Is.), Malaya,
Malaysia (Sabah), Nepal, ? Philippines, ? Singapore; Australasia: Australia. - Found
on wood of angiospermic trees.
TYPES STUDIED. Stereum cacao: India, Khasia (K, holotype; LA, isotype);
"authentic, Hook. Herb." (isotypes in BPI: 277664, 277665, 277667 and Lloyd Herb.
29713).
REMARKS. Setae similar to those in H. cacao are also characteristic for
H. luteobadia, but that species differs in its grayish yellow hymenium and
presence of thick-walled brownish hyphidia. Most of the Southeast Asian
specimens seen by me in American herbaria are of doubtful identity: their setae
are sometimes longer (to 50 wm); these, mainly old specimens may belong to
H. villosa (Lév.) Bres.
10. Hymenochaete carpatica Pilat MMF Iigs#3505105.9
Pilat, Hedwigia 70: 124 (1930); Baici & Léger, Mycol. Helvet. 3: 90 (1988);
Rticker & Forstinger, Linzer Biol. Beitr. 23 (1): 417-424, f. 1-3 (1991); Léger,
Hymenochaete 81, f. 19-20 (1998).
Basidiomata effused, closely adnate, corky (soft when young),
50-600(-800) sm thick, small, inconspicuous, at first 0.3-1 mm_ broad,
rounded, then confluent and forming irregular patches to 10 cm long. Hyme-
nium smooth, later irregularly deeply cracked, dark Ochreous, dark Fulvous or
grayish Sienna when sporulating (M: 10 YR 6/8 to 7.5 YR 5-6/6; K & W: 5 C
6 to 6 D 5-6, Pompeian yellow to cinnamon brown), when sterile golden brown
or brown (M: 5-7.5 YR 6.5/5, 5/8 or 4-5/4-6; K & W: 6 D-E 5 or 6 E 5-7,
sunburn or cocoa brown), without olive or lilac tint, but sometimes dark
reddish grey; margin thin, indistinct, whitish, soon abrupt, thick and concolor-
ous with hymenium.
Tomentum indistinct or absent; cortex absent or indistinct; hyphal layer-
present in young specimens, later disappearing; setal layer with few or numer-
ous rows of setae; dark line above the hymenium absent or present. |
Cortex about 15 ym thick but absent in the majority of specimens, discon-
tinuous in others; hyphae of the cortex few, very densely interwoven, dark red-
dish brown, thick-walled; hyphal layer to 100 um thick. Context hyphae com-
pactly agglutinated, erect, in subhymenium almost loosely interwoven.
Hyphal system monomitic; generative hyphae septate, 1-3 um diam, yel-
lowish brown, with thickened walls; crystalline masses or numerous crystals
and brown resinous matter in context and hymenium present.
Setal layer 30-600(-800) um thick, in old specimens indistinctly stratified;
setae numerous, 50-90 x 6-10(-12) 4m (sometimes there are also setae 20-25 x
5.5-7 pm), projecting 35-60(-70) wm, a few 2-rooted; subulate, with tip acute,
straight, naked or ensheathed by thin-walled, hyaline hyphae about 1 um diam,
without incrustation.
Cystidia and hyphidia absent; basidioles with slightly thickened and yel-
lowish at base walls, 15-25 x 3.5-4.5 um; basidia clavate or subclavate, 15-25
x 4-5.2 um; sterigmata 4, 4-5(-6) wm long; spores ellipsoid to broadly ellipsoid,
139
with one side flattened or sometimes slightly concave, (5-)5.5-6.5(-7) x (2.8-)3-
3.5(-3.8) wm.
CULTURAL CHARACTERS. Léger & Lanquetin, 1996: 106.
SUBSTRATA IN N. AMERICA. Acer sp. (1), Quercus alba (3).
DISTRIBUTION IN N. AMERICA. USA: MD (Takoma Park, on bark of living
maple, 19 Feb 1899 C.L. Shear 1096, BPI 277679, identified by E.A. Burt as H. corti-
color); NY (Scarsdale, 26 Jul 1914 P. Wilson; Ulster Co, Glasco, 25 Aug 1914 P. Wil-
son; Greene Co, Vicinity of Green Lake, 3 Sep 1914 P. Wilson; all three on bark of
living Quercus alba; NY).
DISTRIBUTION ELSEWHERE. Europe: Austria, Czechia, England, Ger-
many, Slovakia, Switzerland; Asia Temperate: Russian Far East. - In Europe on bark
of Acer platanoides, A. pseudoplatanus and Ulmus procera, in Asia of Tilia
manshurica.
TYPE STUDIED. Slovakia, Kleine Karpathen, Glashititten, on Acer platanoides,
Apr 1926 A. Pilat (K, isotype).
REMARKS. Basidiomata of this species are hardly remarkable growing
on external and lateral sides of bark scales of living trees. The species is similar
to H. jobii which differs in its habitat (never on living trees) and spores 4.5-6 x
2.2-3.2(-3.5) wm. H. corrugata may be similar to H. carpatica; it differs in
short, encrusted in upper part with amorphous granules or rugose setae 35-80 x
7-13 pm and cylindrical spores 4-7 x 1.5-2.2 um.
Possibly the species is widely distributed in Northern America but not yet
noticed due to its inconspicuous appearance and unusual for Hymenochaete
habitat on bark of living trees. Setal hyphae are absent in North American
specimens but present in the Asian Far East, few, 4-6.5 wm diam and to 100
um long; they were also noted in culture of the species by Léger & Lanquetin
(1996).
Mean spore size and Q value of the specimens studied
Deoiex B22 1.86 (NY, NY, Wilson 3 Sep 1944)
6259x303 2.06 (Russian Far East, TAA 107605)
6.30 x 3.60 1.75 (England, Ainsworth)
11. Hymenochaete cervina Berk. & M.A. Curtis Bissnse6 MoS
Berk. & M.A. Curtis, J. Linn. Soc. Bot. 10: 334 (1868); Burt, Ann. Missouri
Bot. Gard. 5: 363 (1918); Reeves & Welden, Mycologia 59 (6): 1042, f. 1A (1967);
Léger, Hymenochaete 86, f. 21 (1998) p. p. - H. corticolor Berk. & Ravenel, Grevillea
1: 165 (1873); Burt, Ann. Missouri Bot. Gard. 5: 339, f. 14 (1918); Reeves & Welden,
Mycologia 59 (6): 1043 (1967).
Basidiome perennial, effused, sometimes with thickened (reflexed) blackish
upper margin, closely adnate, woody hard when dry, indistinctly stratose when
old, 100-700(-800) um thick. Hymenium smooth, azonate, irregularly cracked
when old, dark Hazel, Isabelline, light Umber to Umber (M: 5-7.5 YR 4/6 to
5/4; K & W: 5-6 C 4-5, 6 D 4, 6 E 8 or 6 D-E 6-7, light umber or hazel),
Vinaceous Buff when with basidia and spores (M: 7.5 YR 6/4-6; K & W: 6 C
4), without olive or lilac tint; margin slightly tomentose when young, then
thick, abrupt, concolorous with hymenium or darker (tobacco brown).
140
Tomentum and hyphal layer absent; cortex absent or a thin blackish band
of dark hyphae next to the substratum; setal layer composed of setae in
overlapping rows or arranged in irregular strata; dark line above the hymenium
absent.
Hyphae of the cortex densely interwoven, thick-walled, about 3 um diam;
context hyphae compactly arranged, erect or descending, later cemented
together.
Hyphal system monomitic; setal hyphae absent; generative hyphae 2-4 wm
diam, subhyaline to brown, thin- to thick-walled, branched; in context and
hymenium usually numerous crystals and aggregates of brown resinous matter
12-30 xm diam; in hymenium crystals usually present.
Setal layer 100-650 ym thick; setae numerous, 55-100 x 7-15 wm, project-
ing to 25, rarely to 60(-70) um above the hymenium, subulate to long-conical,
with almost blunt or acute tip, straight, at base grown together with a bundle of
brown branched agglutinated hypha, enmeshed in hyphal sheaths (rarely
naked), in older basidiomata with encrusted upper part.
Hyphidia absent or present (in old specimens difficult to find), cylindrical-
filiform, 2-3 wm diam, hyaline to brownish, with thickened rough wall, very
little projecting above the basidia; cystidia absent; basidioles present, encrusted
or without incrustation; basidia subclavate or subutriform, (15-)20-25 x 5-7
pm; sterigmata 4, 3-4.5 um long; spores broadly ellipsoid to short cylindric,
one side flattened, 5-7.5 x 3.5-4.3 pm.
CULTURAL CHARACTERS. Job, 1986: 224.
SUBSTRATA IN N. AMERICA. Fagus grandifolia (1), Magnolia grandiflora
(1), Magnolia sp. (1), Prosopis glandulosa (2), Quercus alba (2), Q. gambelii (1),
Quercus sp. (2), ? Rhododendron maximum (1), Ulmus sp. (1).
DISTRIBUTION IN N. AMERICA. MEXICO: VC (Jalapa, 1). USA: AZ (2),
FL (5), GA (1), IL (1), LA (2), MD (Burt, 1918 p.p.), NJ (1), NM (1), NY (2), SC
(1), TN (1), VA (2).
DISTRIBUTION ELSEWHERE. Mesoamerica: Costa Rica. Caribbean: Cuba,
Grenada, Jamaica; South America: Argentina, Brazil, Ecuador, Paraguay, Uruguay;
Africa: ? Uganda; Australasia: New Zealand. - On many unknown substrata, in New
Zealand on Nothofagus fusca.
TYPES STUDIED. H. cervina: Cuba, Wright 213 (FH, holotype; BPI, Lloyd
Herb. 29422, isotype). Corticium corticolor: USA, South Carolina (Ravenel, Fungi
Carol. Exs. III 30 as H. corticola, lectotype selected by Léger, NY; isotypes in BPI).
REMARKS. Hyphidia are sometimes absent, or difficult to see in the basi-
diomata of H. cervina when covered with brown resinous matter; their tips may
seem to be shortly branched but this is caused by agglomerates of the resinous
matter. Léger observed hyphidia in the (iso)type specimen of H. cervina (K);
however, the author of this paper was unable to distinguish these in the
holotype (FH). Encrusted cystidia figured (f. 29, b) but not described by Burt
(1918: 363) and mentioned shortly by Reeves & Welden were not seen by me
nor by Job (1990: 12).
There are three very closely related species in Northern America, Meso-
america and Caribbean which may form very thick effused, externally almost
identical basidiomata. H. unicolor (found in Caribbean area and Mesoamerica)
14]
has much smaller setae (25-)40-60 x 5-7.5 um, short spores (3.5-)4-5 x 2.4-
3.2(-3.5) ym, and a sometimes hardly remarkable thin hyphal layer 10-100 um
thick. H. jobii has short narrowly ellipsoid spores 4.5-5.5 x 2.2-3.2 wm similar
to these in H. unicolor, but setae similar to those in H. cervina, (50-)65-110(-
120) x 7-12(-15) wm, and uneven hymenium with scattered low tubercles.
Specimens of H. cervina and H. jobii are almost indistinguishable when without
basidia and spores. Misidentifications. Some specimens of this species have
been misidentified in herbaria as H. corrugata.
12. Hymenochaete cinnamomea (Pers.: Fr.) Bres. Figs. 4, 5,5, 20
Bres., Atti Accad. Sci., Lett. Arti Agiati IIT 3 (1): 110 (1897); Burt, Ann.
Missouri Bot. Gard. 5: 345, f. 17 (1918); Jahn, Westfal. Pilzbr. 8 (4-7): 139, f. 25
(1971): Léger, Hymenochaete 91, f. 93 (1998). - Thelephora cinnamomea Pers.: Fr.,
Myc. Eur. 1: 141 (1822). - Hymenochaete unicolor s. auct. Amer. non Berk. & M.A.
Curtis. - H. simulans s. Peck (1897) non Bres. - H. spreta Peck, Ann. Rep. N. Y. State
Mus. 30: 47 (1878). - Hymenochaetella arida P. Karst., Bidr. Kanned. Finl. Nat. Folk
48: 428 (1889). - Hymenochaete arida (P. Karst.) Sacc., Syll. fung. 9: 228 (1891);
Burt, Ann. Missouri Bot. Gard. 5: 340, f. 15 (1918); Gilb. & Lindsey, Great Basin
Naturalist 38 (1): 42, f. 1-3 (1978).
H. cinnamomea ssp. spreta (Peck) Parmasto
Parmasto, Folia Cryptog. Estonica 37: 62 (2001). - H. spreta Peck, Ann. Rep. N.
Y. State Mus. 30: 47 (1878); Burt, Ann. Missouri Bot. Gard. 5: 348, f. 19 (1918);
Pilat, Hedwigia 70 (1/2): 115 (1931); Jung, Wood-rott. Aphyll. s. Appal. 137, f. 43 j-
m, pl. 27 B (1987).
Basidiomata effused, loosely adnate and separable, soft but not waxy,
coriaceous or brittle when dry, (50-)200-1000(-2000) um thick, confluent and
then up to 25 cm long. Hymenium smooth, azonate, not cracked when very
young, then densely, later deeply irregularly cracked, Cinnamon, then dark
Sienna to Cinnamon Umber or reddish brown (M: 7.5 YR 4.5-5/6-8,
sometimes 2.5 YR 4-5/4-5 or 7.5 YR 6/9; K & W: 6-7 D 6-8 or 7 D-E 7-8,
cinnamon to light brown or brick red), without an olive or lilac tint; margin
thin, indeterminate, later distinct, concolorous with the hymenium.
Tomentum and cortex absent; context composed of a hyphal layer and a
setal layer with 1-10 more or less distinct rows of setae; sometimes between the
rows a thin intermediate hyphal layer to 30(-60) um thick composed of densely,
sometimes partly loosely interwoved hyphae; dark line above the hymenium
absent. Basal hyphal layer 20-150(-250) wm thick, lighter coloured than setal
layers or concolorous; hyphae loosely arranged, interwoven.
Hyphal system monomitic; setal hyphae absent; generative hyphae distinct,
2-4.5 ym diam, yellow to brownish, with thickened walls, branches diverging
at a right angle, with numerous septa; in context, setal stratum and hymenium
crystalline matter absent.
Setae numerous, (60-)70-120(-150) x 5-9(-10) um, projecting to 90 pm,
subulate, usually some slightly curved, naked or enmeshed in hyphal sheaths,
without incrustation, tips acute or very sharp; hyphae between setae vertically
arranged, short-celled.
142
Hyphidia absent but basidioles may simulate thick-walled hyphidia;
cystidia absent; basidioles septate, 15-30 x 3.5-5 um, usually yellowish, later
walls often thickened at base, yellow or brownish and granulose; basidia
subclavate or subutriform, 15-30 x 3.8-6 4m, sometimes with thickened basal
walls; sterigmata 4, 4-5 um long; spores short cylindrical, some slightly
curved, or almost ellipsoid with one side flattened, 4.5-6.5(-7) x 1.8-2.8(-3.2) .
pm.
Causes a white rot of wood.
SUBSTRATA IN N. AMERICA. Abies balsamea (1), A. grandis (2), Abies sp.
(1), Acer circinatum (2), A. macrophyllum (1), A. rubrum (3), A. saccharinum (syn.:
A. dasycarpum ) (1), A. saccharum (3), A. spicatum (1), Acer sp. (9), Alnus rubra
(syn.: A. oregona) (2), A. incana ssp. rugosa (4), A. incana ssp. tenuifolia (1), A.
viridis ssp. crispa (Niemela, 1985), Alnus sp. (6), Artemisia tridentata (1), Betula
alleghaniensis (syn.: B. lutea) (4), B. populifolia (1), Betula sp. (1), Carpinus sp. (1),
Carya illinoinensis (1), Ceanothus fendleri (1), C. velutinus (4), Ceanothus sp. (2),
Chilopsis linearis (1), Cornus florida (1), Corylus americana (1), Crataegus
brevispina (= ?) (1), Fagus grandifolia (11), Fagus sp. (6), Fraxinus nigra (2),
Fraxinus sp. (1), Juglans cinerea (1), Juniperus deppeana (1), Liquidambar styraci-
flua (1), Liriodendron tulipifera (3), Maclura pomifera (1), Magnolia grandiflora (1),
Magnolia sp. (3), Ostrya virginiana (2), Ostrya sp. (1), Picea glauca (1), P. x lutzii
(1), P. rubra (1), Pinus aristata (including var. longaeva) (1), P. ponderosa (1),
Platanus occidentalis (1), Populus tremuloides (2), Populus sp. (4), Prosopis
glandulosa (1), Prunus serotina (2), Prunus sp. (1), Pseudotsuga menziesii (1), Quer-
cus agrifolia (5), Q. arizonica (1), Q. emoryi (2), Q. gambelii (3), Q. hypoleucoides
(4), Q. nigra (1), Q. rubra (1), Quercus sp. (12), Rhododendron sp. (3), Ribes flo-
ridum (= ?) (1), Ribes sp. (2), Rosa canina (1), Salix planifolia (Niemela, 1985), Salix
sp. (1), Sequoia sempervirens (1), Symphoricarpos occidentalis (G & L, 1995),
Taxodium sp. (1), Thuja occidentalis (2), T. plicata (14), Thuja sp. (1), Tsuga hetero-
phylla (1), Tsuga sp. (1), Umbellularia californica (1), Vaccinium arboreum (3), Vitis
vinifera (1), Vitis sp. (1).
DISTRIBUTION IN N. AMERICA. Northernmost localities are in Alaska,
Yukon Terr., Labrador Peninsula (Quebec, 55.3° N, 77.8° W), Newfoundland and
South Greenland. Widely distributed in USA, but more rare in South-East; only one
locality known from Mexico. CANADA: BC (11), MB (2), NF (Niemela, 1985), NS
(2), ON (17), PQ (1), YT (1). GREENLAND: southernmost part S of 61°15' N.
(Knudsen, Hallenberg & Mukhin, 1993). MEXICO: OA (1). USA: AK (S)Als(2).
(South) AZ (18), CA (15), CO (2), CT (3), DC (1), FL (5), GA (1), ID (11), IL (2),
IN (1), KS (2), KY (4), LA (6), MA (3), MD (9), MI (16), MN (3), MO (1), MS (5),
MT (9), NC (12), ND (1), NE (2), NH (8), NJ (5), NM (2), NY (45), OH (4), OR
(14), PA (2), SC (2), TN (18), UT (2), VA (2), VT (4), WA (14), WI (1), WV (17).
DISTRIBUTION ELSEWHERE. Not found in other regions, but ssp. cinna-
momea has been observed in: Caribbean: Cuba; Southern America: Argentina, Bra-
zil, Colombia, Ecuador; Europe: common in all countries; Africa: Macaronesia,
Northern Africa, West-Centrai and East Tropical Africa, Southern Africa; Asia-Tem-
perate: Israel, Caucasus, Middle Asia, Siberia, Russian Far East, Turkmenistan,
China, Japan; Australasia: New Zealand. Data on occurrence in Australia are doubtful.
- On numerous species of angiospermic and (more rarely) gymnospermic trees.
143
TYPES STUDIED. H. spreta: New York, Albany Co, Helderberg Mts., on Acer,
Oct 1875 C.H. Peck (NYS, holotype; NY, isotype). H. arida: Finland, P. Karsten 809
(H, holotype).
REMARKS. Subspecies cinnamomea of this species differs in having dis-
tinctly alternating hyphal and setal layers with hyphal layer 50-200 pm thick
and composed of loosely interwoven hyphae; hymenial surface is of lighter
colour, not cracked or with few cracks. Externally similar H. epichlora differs
with its non-layered basidiomata, shorter setae (30-60 x 4.5-9 um) and ellipsoid
spores 3.5-5 x 1.8-2.5 ym. Setae of ssp. spreta are of variable size within one
specimen, but there are always present setae 80 um or more in length.
There are two additional species macroscopically similar to H. cinna-
momea basidiomata. H. rhabarbarina has similar structure but ellipsoidal
spores with mean spore width more than 2.6 um and mean spore length/width
coefficient Q less than 2.1. The other differences are described at this species.
H. burdsallii is characterized by absent or indistinct hyphal layer and broad
ellipsoidal spores (6.5-)7-8(-8.5) x 4.5-5.2(-5.5) wm.
Young specimens of ssp. spreta lack a thickened setal layer (hymenium)
and are of light colour; such specimens are indistinguishable from ssp. cinna-
momea and have been named H. arida in N. American herbaria. Somewhat
older specimens may have a few setal layers with a very thin layer of densely
intertwined hyphae between these; colour is darker and hymenium slightly
cracked; these have usually been called H. cinnamomea. Most of the specimens
have stratified setal layer as described above; in some old specimens collected
mainly in Canada and the States of New York, West Virginia, Idaho, Kansas
and California, two or three of the setal layers have a hyphal layer to 100 wm
thick between these, and in other part of the basidiome the setal strata are
without an intermediate hyphal layer. However, spreta-type of basidiome struc-
ture is absent in specimens collected in Europe or Asia. The dark(er) colour
and deeply fissured hymenium in ssp. spreta is caused by the structure of
basidiomata; presence of soft intermediate hyphal layers protects hymenium
from cracking in ssp. cinnamomea.
Differing from most species of Hymenochaete, about a half of the speci-
mens of H. cinnamomea studied have numerous spores. Obviously, sporulation
period is very long in this species.
Misidentifications. In herbaria, some specimens of H. cinnamomea ssp.
spreta have been filed under the name H. rhabarbarina and several under H.
corrugata. The basidiomata of these species are sometimes externally similar
(brown, densely cracked), but the structure is very different in H. corrugata:
hyphal layer is absent, setae are broad (35-80(-100) x (6-)7-13(-15) wm) and
encrusted or rugose in upper part. - For spreta, three names have been used
erroneously since the early 1900s: Corticium simulans Berk. & Rav. nom.
nudum and based on this name Hymenochaete simulans (Berk. et Rav.) Peck,
1897 non (Berk. & Broome) Bres., 1896, and H. unicolor which is a species of
southern distribution characterized by short setae (25-)40-60 wm long and
ellipsoid spores 4-5 x 2.4-3(-3.5) wm
144
13. Hymenochaete corrugata (Fr.: Fr.) Lév. Figs. 2; 17; 6, 6
Lév., Ann. Sci. Nat. Il 5: 152 (1846); Burt, Ann. Missouri Bot. Gard. 5: 358
(1918); Coker, J. Elisha Mitchell Sci. Soc. 36 (3 & 4): 167, pl. 32 (1921); Reeves &
Welden, Mycologia 59: 1042, f. 1 F (1967); Léger, Hymenochaete 100, f. 26 (1998). -
Thelephora corrugata Fr.: Fr., Observ. mycol. 1: 154 (1815). - Hymenochaete
insularis Berk., Grevillea 1: 165 (1873) nom. nud. - Hymenochaete agglutinans Ellis,
Bull. Torrey Bot. Club 5: 46 (1874); Burt, Ann. Missouri Bot. Gard. 5: 344 (1918);
Coker, J. Elisha Mitchell Sci. Soc. 36 (3 & 4): 168 (1921).
Basidiomata effused, closely adnate, hard when dry, 200-600 pum thick.
0.5-3 cm diam, then confluent and to 30 or more cm long. Hymenium smooth
or minutely granulose, azonate, minutely irregularly cracked (rarely not
cracked), brownish or reddish grey, sometimes with rosy tint, or dark brown or
blackish (M: 2.5 YR 4.5, 10 R 5.5/2 to 2.5 YR 5.5/2, 10 R 2.5/4 to 2.5 YR
3/4; K & W: 7 E 5, 7-8 D 3, 7 E-F 6), without an olive tint; margin thin,
indeterminate, fibrillose or tomentose, 0.2-0.7 mm wide, whitish, then con-
colorous with the hymenium, later as a narrow brown border.
Tomentum absent; cortex absent, but thin dense cortex-like hyphal layer
may be present; context composed of setal layer composed of overlapping rows
of setae; dark line above the hymenium absent. Basal hyphal layer 10-40 pm
thick; context hyphae compactly agglutinated, erect or interwoven.
Hyphal system monomitic; setal hyphae absent; generative hyphae 2.2-4.2
ym diam, brownish to brown, thick-walled, septate, branched; in context and
hymenium crystalline matter absent.
Setal layer 200-550 pm thick; setae numerous, 35-80(-100) x (6-)7-15(-17)
pm, projecting to 50(-60) um above the hymenium, conical to almost fusiform,
at base surrounded with a node of agglutinated hyphae, with blunt or almost
acute easily broken tip, straight, naked, in upper part always encrusted with
scattered amorphous granules or rugose.
Hyphidia and cystidia absent; basidia clavate or subclavate, 15-22 x
3.5-4.5 um; sterigmata 4, 4-5 um long; spores cylindrical, slightly curved, 4.5-
6.8(-7) x 1.5-2.3 um.
Sterile state (H. agglutinans Ellis; H. corrugata f. conglutinans Bourdot &
Galzin, Hymen. Fr. 393, 1928) forms effused round patches 1-3(-5) cm in
diam on living branches where they bind these together in contact zone. The
mycelial pad is up to 2 mm thick, concentrically sulcate, yellowish cream,
grey-cinnamon in centre, later brownish. Hyphae densely interwoven, thick-
walled, 2-4 um in diam; scattered setae present, similar to the hymenial ones.
Sterile state is rarely growing together with basidiomata, but in many cases
separately, and can continue their growth after branches are dead already.
Causes white rot of wood.
CULTURAL CHARACTERS. Nobles, 1948: 339, 1965: 1134.
SUBSTRATA IN N. AMERICA (agglutinans state mentioned by an asterisk °).
Found on more than 70 species of trees and bushes. Of more than 200 specimens with
host data seen, only four have been found on gymnospermic substrata. - Abies balsamea
(1), Acer circinatum (1), A. negundo (G & L, 1995), A. nigrum (G & L, 1995), A.
pensylvanicum (G & L, 1995), A. rubrum (10+5°), A. saccharinum (1+1°), A.
saccharum (1+3°), A. spicatum (4+7°), Acer sp. (20), Aesculus sp. (G & L, 1995),
145
_ Alnus incana (5+2"), A. incana ssp. rugosa (3+1"), A. incana ssp. tenuifolia (1°), A.
serratula (6+2°), Alnus sp. (3+3°), Amelanchier alnifolia (2), A. canadensis (1+1°),
Amelanchier sp. (1), Ampelopsis arborea (syn.: Vitis bipinnata) (2), Andromeda sp.
(Ellis, 1874), Betula alleghaniensis (syn.: B. lutea) (2), B. lenta (2), B. nigra (1°), B.
papyrifera (G & L, 1995), B. populifolia (1), Betula sp. (4+2°), Carpinus caroliniana
(1+2°), Carpinus sp. (2), Carya glabra (1), C. ovata (1°), Carya sp. (3+3"), Castanea
sativa (1), Castanea sp. (1+1°), Celtis sp. (1), Clethra sp. (1°), Cornus stolonifera (3),
Cornus sp. (1°), Corylus cornuta (syn.: C. rostrata) (2+1°), Crataegus sp. (1), Fagus
americana (6), F. atropunica (1°), F. ferruginea (2), F. grandifolia (14+5°), Fagus sp.
(19), Fraxinus americana (1°), F. nigra (1°), Hamamelis virginiana (3+3°), Mex
verticillata (3), Juniperus virginiana (1), Laurus sp. (1), Lindera benzoin (2+1)),
Liquidambar styraciflua (4), Magnolia fraseri (2), Magnolia sp. (1), Malus pumila
(1), Nerium oleander (1), Nyssa sp. (1), Ostrya virginiana (1+1°), Pinus strobus (?
2°), Platanus sp. (1), Populus grandidentata (G & L, 1995), P. tremuloides (2),
Prunus caroliniana (1), P. pensylvanica (4°), P. serotina (2), P. virginiana (1+1)),
Prunus sp. (2+1°), Quercus alba (2+1°), Q. coccinea (1°), Q. digitata (= ?) (1°), Q.
ilicifolia (1), Q. nigra (G & L, 1995), Q. rubra (G & L, 1995), Quercus sp. (13+1)),
Rhododendron maximum (8), Rhododendron sp. (5+1°), Salix bebbiana (1), S. nigra
(1), Salix sp. (1), Thuja occidentalis (G & L, 1995), T. plicata (G & L, 1995), Tilia
americana (1), Toxylon pomiferum (1), Tsuga canadensis (1), Vaccinium sp. (1), Ver-
nicia fordii (1), Viburnum dentatum (1), V. lantanoides (1), Viburnum sp. (1), Vitis
aestivalis (2), V. vulpina (1), Vitis sp. (2).
DISTRIBUTION IN N. AMERICA. Found mainly in South-East and East parts
of the USA; no data on occurrence in Mexico. The agglutinans state (mentioned by an
asterisk °) is distributed mainly in the North-East of the USA. CANADA: MB and NB
(G & L, 1995), NS (1), ON (11+2°), PE (G & L, 1995), PQ (1+1°). USA: AL
(8+17), AR (G & L, 1995), AZ (G & L, 1995), CT (6+187), DC (1+2’), DE (443°),
FL (21), GA (3), ID (1°), IL (1), IN (3), KY (6), LA (14), MA (18+7°), MD (26+2’),
ME (11+8'), MI (6), MN (G & L, 1995), MO (1), MS (10), MT (G & L, 1995), NC
(29+2°), NH (16+14°), NJ (16+6°), NY (51+9°), OH (6+1°), PA (16+3'), RI
(1+3°), SC (6), TN (22), TX (5), VA (18+5°), VT (2+2°), WA (2), WI (1+1°), WV
(6).
DISTRIBUTION ELSEWHERE. Mesoamerica: Costa Rica; Caribbean:
Jamaica, Puerto Rico; South America: Argentina, Brazil, Ecuador, Uruguay; Europe:
Austria, Belgium, France, Germany, Italy, Switzerland, Ukraine, United Kingdom;
Northern Africa: Tunisia; Southern Africa; Asia-Temperate: China, Japan, Russia
(Siberia), Taiwan; Australasia: New Zealand; North-Central Pacific: Hawaii. - On
numerous angiospermic hosts. Sterile state (“H. agglutinans”) has been found in Europe
(England, France) where it is very rare.
TYPE STUDIED. H. agglutinans: New Jersey, Newfield (NY, holotype).
REMARKS. H. agglutinans has been synonymized with H. corrugata by
Reeves & Welden (1967: 1042-1043); presence of this sterile state is a sign that
the species may be called facultative parasite (cf. Graves, 1914). Macroscopi-
cally sometimes similar H. cinnamomea ssp. spreta differs from H. corrugata
by presence of hyphal layer(s) and with long sharp, never incrustated setae (60-
)70-120(-150) x 5-9(-10) um. Misidentifications. In herbaria, filed under the
146
name of H. corrugata are specimens of H. pinnatifida or H. cinnamomea ssp.
spreta, sometimes also H. curtisti or H. jobii.
14, Hymenochaete curtisii (Berk.) Morgan FigssonZi6N3
Morgan, J. Cincinnati Soc. Nat. Hist. 10: 197 (1888); Burt, Ann. Missouri Bot.
Gard. 5: 320, f. 7 (1918); Coker, J. Elisha Mitchell Sci. Soc. 36 (3 & 4): 167, pl. 19,
32 f. 11-12 (1921); DeFigio, Tax. anal. 25, f. 6, pl. 2 f. 6a (1970); Jung, Wood-rott.
Aphyll. s. Appal. 136, f. 43 a-e, pl. 27 A (1987); Chamuris, Non-stipit. stereoid fungi
156, f. 58 C (1988); Léger, Hymenochaete 110, f. 30 (1998). - Stereum curtisii Berk..,
Grevillea 1: 164 (1873).
Basidiome effused to effuso-reflexed or with slightly elevated margins,
attached with umbos, adnate but separable, soft or soft coriaceous and flexible
but not waxy when dry, 100-500 um thick, orbicular, confluent and then to 20
x 2.5 cm. Pilei short and broad, to 0.8 cm long; pileal surface concentrically
(sometimes indistinctly) sulcate, sometimes radiately fibrillose, silky, glabrous
when old, with zones, brown (M: 5 YR 4/4-2, when old 5 YR 5/1; K & W: 5
C 2 or 5-6 C 3 to 5 D 4, 6 D 5-6, brownish orange to light brown, later
grayish); margin lighter coloured than pileal surface (yellowish brown).
Hymenium smooth or velvety, azonate, not cracked, golden brown or greyish
brown (M: 7.5 YR 5/2; K & W: 6 D 4-6, 6 E 3-4 or 6 E 5-8, yellowish brown
or light brown), when sterile Sepia or vivid Umber (M: 7.5 YR 3/6, K & W: 7
E 7), without an olive or lilac tint; context darker than hymenium; margin
cinnamon brown when young (M: 7.5 YR 4-5/6), then concolorous.
Tomentum present, cortex indistinctly present; context composed of hyphal
layer; dark line above the hymenium absent.
Tomentum 50-100 pm thick; cortex thin, composed of darkened
thick-walled densely compacted hyphae; hyphal layer 80-450 um thick, hyphae
compactly longitudinally arranged or interwoven, but not glued together.
Hyphal system monomitic; setal hyphae absent; generative hyphae 2-4 um
diam, subhyaline to brownish, with thickened walls, ramified, septate. In con-
text and hymenium crystalline matter absent.
Setae rare or very rare, 55-75(-100) x (6-)7-10(-12) um, projecting to 50
um above the hymenium, fusiform or subulate, with tip acute, straight, naked
or enmeshed in hyphal sheaths, without incrustation.
Hook-like, curved or coiled hyphal tips absent or rare in specimens having
basidia, but in sterile hymenium very numerous, to 2.5 wm diam, brownish,
with slightly thickened walls, acute; hyphidia absent; basidioles present,
without incrustation; basidia subclavate or (sub)utriform, with walls thickened
and brownish at base, 12-30 x 4.5-5.5 um; sterigmata 4; spores cylindrical,
slightly curved, 5.5-8.3 x 1.5-2.5 um.
SUBSTRATA IN N. AMERICA. Found on more than 30 species of
angiospermic trees and bushes, but of 143 specimens with data on the substrate, only 17
were on other hosts than oak. - Acer sp. (2), Betula nigra (1), Carpinus caroliniana
(1), Castanea dentata (1), Fagus sp. (1), Fraxinus velutina (1), Gordonia sp. (2),
Juglans major (1), J. nigra (1), Ligustrum sp. (1), Populus sp. (1), Quercus alba
(26), Q. coccinea (3), Q. garryana (3), Q. macrocarpa (11), Q. marilandica (G & L,
1995), Q. michauxii (1), Q. minor (2), Q. nigra (G & L, 1995), Q. obtusiloba (2),
147
_Q. palustris (1), Q. platanoides (1), Quercus prinus (1), Q. rubra (2), Q. stellata (9), Q.
toumeyi (2), Q. velutina (3), Q. virginiana (6), Quercus sp. (53), Robinia pseudacacia
(2), Sambucus caerulea (syn.: S. glauca) (1), Ulmus sp. (1).
DISTRIBUTION IN N. AMERICA. CANADA: MB (G & L, 1995).
MEXICO: BS (Santa Catalina Is., 1). USA: AL (8), AR (8), AZ (7), CT (3), DC (4),
DE (2), FL (16), GA (9), IA (5), IL (2), IN (2), KY (G & L, 1995), LA (16), MA (7),
MD (16), MN (3), MO (21), MS (12), NC (14), ND (7), NH (1), NJ (12), NV (G &
DL, 1995), NY (6), OH (6); OK (2), OR (2), PA (7); SC ), TN (7), TX (9), VA (22),
WA (2), WI (9), WY (1).
DISTRIBUTION ELSEWHERE. Mesoamerica: Mexico, Panama, Puerto Rico.
TYPES STUDIED. Stereum curtisii: USA, South Carolina, H.W. Ravenel, Fungi
Carol. III, 26 (NY, lectotype selected by Léger; BPI, isotype).
REMARKS. Crowded vertical hyphae with hooked or bent tips in hymen-
ium are unique in Hymenochaete and enable to identify the species in sterile
state. These hyphae are modifications homologous with hyphidia. When a
specimen is with basidia, these hyphae are not numerous or even rare, and
these specimens are very similar to H. pinnatifida. The last named species
usually has numerous setae which are surrounded by a knot of agglutinated
branched hyphae at base. Misidentifications. This species has been several
times misidentified as H. tabacina or H. corrugata.
15. Hymenochaete damicornis (Link) Lév. Figs. 4, 8; 6, 7
Lév., Ann. Sci. Nat. Bot. III 5: 151 (1846) ut H. damaecornis; Burt, Ann.
Missouri Bot. Gard. 5: 306, pl. 16 f. 1 (1918); Léger, Hymenochaete 112, f. 31
(1998). - Stereum damicorne Link, Mag. Ges. Naturforsch. Freunde Berlin 3: 40
(1809); Lloyd, Mycol. Writ. 4, Stipit. Stereum 41, f. 564 (1913). - Stipitochaete
damicornis (Link) Ryvarden, Trans. Brit. Mycol. Soc. 85 (3): 537, f. 1 (1985).
Basidiome stipitate; stem vertical or sometimes horisontal, usually with 2-5
short branches in the upper part, 2-10 cm high, 2-7(-10) mm diam, at the base
(in section) round, more flattened towards the pilei, finely tomentose, covered
with crowded setae, dark brown (M: 5 YR 5/6-8 to 4/6; K & W: 6 D-E7, raw
Sienna or cognac). Pilei flabelliform to spathulate, 300-700(-1200) um thick, 1-
6 cm long; surface silky to velutinous, densely zonate, slightly radially sulcate,
when young dark Sienna (M: 5 YR 6/8, K & W: 6 C 7, reddish golden), later
Fulvous Umber (M: 5-7.5 YR 5/8; K & W: 6 D 6, cinnamon brown); margin
thin, lobate, wavy, incised or laciniate, in young specimens lighter coloured
than other pileal surface (M: 7.5 YR 8/8; K & W: 5 B 5). Hymenium smooth,
azonate or with few zones near the margin, not cracked, cinnamon buff or
greyish brown (M: 5 YR 5-6/4; K & W: 6 D-E 5, sunburn), without olive or
lilac tint, covered with projecting setae.
Tomentum absent but scattered, thick- or thin-walled, or aborted setae
present on upper surface; cortex absent; context thick, composed of parallel
moderately densely arranged hyphae; setal layer in old specimens present, 100-
200 um thick; dark line in the context or above the hymenium absent. Stipe
composed of densely interwoven hyphae, but in well developed specimens
differentiated into three layers: outer brown part up to 2 mm thick (tomentum)
is composed of almost loosely interwoven hyphae, central yellowish cylinder
148
(core) of parallel hyphae with thin or thickened walls, and this is surrounded by
a thin (100-150 pm) dark brown cortex of densely agglutinated thick-walled
hyphae.
Hyphal system monomitic or subdimitic; setal hyphae absent; generative
hyphae 2.5-6 um diam, pale yellowish brown to rusty brown, with thin or
thickened walls, septate, branched, in the core of the stipe pale golden yellow
and 4-7 ym in diam, in the stipe tomentum with thickened walls, brownish, 3-5
pm diam.
Setae in hymenium rare, scattered or numerous, 90-160(-220) x 8-15 um,
projecting to 150 um, aculeate to narrowly conical, naked or sheathed, straight,
with acute tip, without incrustation; stipe covered with usually very numerous
aculeate thick- or thin-walled setae up to 250 um long; setae on pileal surface
rare or scattered, 60-100 x 8-13 ym, sometimes abortive, thin-walled, cylindri-
cal and with rounded tip, or short (40-50 x 8-10 um).
Hyphidia and cystidia absent; basidioles in sterile hymenium numerous,
subhyaline, with thin or thickened walls, 15-22 x 5-8 wm; basidia subutriform
or subclavate, 15-25 x 5-8 um, with 4 thin sterigmata 4-5 ym long; spores
broadly ellipsoid, with thin or slightly thickened walls, 5.5-8(-8.2) x 4-5.5 um.
SUBSTRATA IN N. AMERICA. Unknown.
DISTRIBUTION IN N. AMERICA. MEXICO: OA (Montepio and NE of
Matias Romero - Welden, Davalos & Guzman, 1979; Marmojelo, Castillo & Guzman,
1979), Vi Cosy,
DISTRIBUTION ELSEWHERE. Mesoamerica: Belize, Costa Rica, Guatemala,
Honduras, Mexico (Chiapas), Panama, El Salvador; Caribbean: Cuba, Dominican
Rep., Guadeloupe, Jamaica, Puerto Rico, Trinidad; South America: Argentina,
Bolivia, Brazil, Colombia, French Guiana, Guyana, Paraguay, Peru, Suriname, Vene-
zuela. - On rotten wood and roots of living deciduous woody plants and Bambusa sp.
Common in Brazilian Amazonia.
TYPE STUDIED. Brazil, Sao Leopoldo, ad terram, Jan 1904 Rick, Fungi aol
tro-Americani no. 10 as Hymenochaete formosa Lév. (BPI, iso-lectotype).
REMARKS. Collected usually on ground but obviously parasitic on roots.
The stipe is sometimes not clearly distinguished from pilei, and is then a pro-
longated narrow base of it. Sometimes the short stipe is horizontally branched.
Structure of a thick, well developed stipe is surprisingly similar to that in ~
Clavariachaete species: in both cases the central cylindric “core” of parallel
hyphae is surrounded by a thin hard cortex and thick tomentum which bears
strong setae. Differs from Clavariachaete in lacking dichotomously branched
hyphae in the tomentum of H. damicornis.
H. damicornis is one of the few species of Hymenochaete which is almost
always fertile; specimens with abundant spores have been collected in Mexico
from July to November. Mean size and Q value of spores is:
6.18 x 4.68 1.32 (XAL, Samp 909)
6°37 x47 7711233 (XAL, Band 281)
6.55 x 4.83 1.36 (XAL, Anell 527)
GS9Fxt 51020 143.1 (XAL, Guzman 30372)
6.71 x 4.92 1.36 (XAL, Samp 984)
149
7.05 x 4.78 1.47 (XAL, Gomez 11)
7.68 x 4.72 1.63 (XAL, Chacon 2327)
16. Hymenochaete epichlora (Berk. & M.A. Curtis) Cooke __ Figs. 2, 6; 5, 4
Cooke, Grevillea 8: 147 (1880); Burt, Ann. Missouri Bot. Gard. 5: 351, f. 20
(1918); Léger, Hymenochaete 130, f. 40 (1998). - Corticium epichlorum Berk. & M.A.
Curtis, Grevillea 1 (12): 178 (1873). - Hymenochaete asperata Ell. & Everh., Bull.
Torrey Bot. Club 27: 50 (1900).
Basidiome effused, 70-180(-230) um thick, soft to coriaceous when dry,
5-10 x i-3 cm, closely or loosely adnate. Hymenium smooth or somewhat
granular, azonate, irregularly, soon densely cracked, greyish Cinnamon to dark
Sienna (M: 5-7.5 YR 6-7/4 to 5/4, or 10 YR 5/6 (when young); K & W: 4 A
4,6C-D5 or 6E5S, light yellow, sunburn or cocoa brown), sometimes with an
olive tint; margin thin, tomentose or indeterminate, sometimes slightly byssoid,
Ochreous or concolorous with hymenium.
Tomentum absent, cortex absent or sometimes as a thin darker band of
more tightly interwoven hyphae next to the substratum; context composed of
hyphal layer; dark line above the hymenium absent; context hyphae rather
densely interwoven.
Hyphal system monomitic or subdimitic (part of the hyphae hyaline, thin-
walled, septate and more branching, others brownish and with thickened walls);
setal hyphae absent; hyphae 2-4 um diam, yellowish, thin-walled or with thick-
ened walls, septate, branched; in context crystalline matter rarely present, in
hymenium absent.
Setae rare or scattered, 30-60 x (4.5-)5.5-9 ym, projecting to 20(-35) um,
fusiform, with tip acute, straight or some slightly curved, some rarely T-
shaped, naked, without incrustation.
Hyphidia and cystidia absent; basidioles present, with slightly thickened
walls, without incrustation; basidia subclavate to (sub)utriform, 10-16 x 4-6
pm; sterigmata 4, 3-4 um long; spores ellipsoid, one side flattened, 3.5-5 x
1.8-2.5 pm.
SUBSTRATA IN N. AMERICA. Ostrya virginiana (1), Quercus virginiana (1),
Sabal palmetto (1), Symplocos sp. (1), Vitis sp. (G & L, 1995).
DISTRIBUTION IN N. AMERICA. MEXICO: VC (Jalapa, 3). USA: AL (type
of C. epichlorum), FL (Highlands Co, Highlands Hammock St. Pk., 29 Jan 1970 H.H.
Burdsall 4835, CFMR; De Soto Co, Arcadia, 19 May 1985 J.P. Lindsey 1331, ARIZ),
LA (type of H. asperata; St. Martinsville, 18 Mar. 31 Aug and 23 Nov 1899 A.B.
Langlois 1751, 2089 and s. n., NY, S; Tammany Par., Indian Village, 1 Feb 1958 D.
Stone, det. A.L. Welden, NY and BPI 278119; St. James Par., near Gramercy, Sept
1961 A.L. Welden, det. F. Reeves, NY and BPI 278116), TX (San Jacinto Co, Little
Thicket Nat. Sanctuary, 25 Aug 1967 H.H. Burdsall 77, CFMR).
DISTRIBUTION ELSEWHERE. Southern America: Argentina, Brazil; Mal-
esia: Java.
TYPES STUDIED. Corticium epichlorum: Alabama, on Symplocos sp., Peters;
Ravenel, Fungi Carol. Exs. V, 24 (2 isotypes in BPI, 1 in S; lectotype not yet selected).
Hymenochaete asperata: Louisiana, St. Martinville, 4 Jan 1898, no. 2647 (NY,
holotype).
150
REMARKS. Similar to H. cinnamomea, but that is usually layered and
with setae (60-)70-120(-150) x 5-9(-10) um. H. rigidula is very similar when
young and thin, but differs in presence of setal hyphae. Misidentifications.
Some specimens collected by Langlois in 1890 and 1899 (BPI 278123, 278858-
859, 278867, 278871) and identified by Burt (?) as H. epichlora are possibly
H. cervina. A specimen of H. asperata from Burt's Herb. (on Fraxinus,
Louisiana, coll. A.B. Langlois 21 Jan 1889, S) is H. pinnatifida.
Mean size and Q value of spores of H. epichlora are:
3 OSEKPL. 2 tna EO h (FL, CFMR 4835)
5.92 x92 BU Mie (Mexico, NY, Murrill 338)
ADL x2: 3 [ae S (TX, CFMR 77)
17. Hymenochaete escobarii Léger Figs. 3, 4; 6, J0
Léger, Cryptogamie, Mycol. 11 (4): 296, f. 5 (1990); Léger, Hymenochaete 134,
f. 42 (1998). - H. dendroidea Escobar nom. nud., Contr. Hymenochaete 92, f. 27
(1978) non Berk. & Broome (= Hypomyces chrysostomus Berk. & Broome 1875,
Hypocreales).
Basidiome with well developed pilei, sometimes seemingly resupinate but
really umbonate-adnate (with free, slightly elevated marginal part), woody hard
and brittle when dry, (150-)300-1500(-2500) um thick. Pilei single or conflu-
ent, imbricate, semicircular, 0.5-2.5 cm long; pileal surface deeply concentri-
cally sulcate, rugose or tomentose, Umber, later dark Umber or blackish (M: 5
YR 4/6 or 4/4; K & W: 7 E'5); margin thin. Hymenium smooth or with scat-
tered rounded collicles, not cracked or with a few deep crevices, Cinnamon to
Fawn, bright Fulvous or dark Sienna (M: 5 YR 5-6/4, 5-6/8 or 5/6; K & W: 7
D 4, sometimes 5 D 8, 5 C 7 or 6 D 7), without olive or without a lilac tint.
Setal layer under looking glass distinctly stratose (with some or numerous dark
lines).
Tomentum and cortex present, later indistinct; context composed of Hyphal
layer and a stratose setal layer; dark line above the hymenium absent.
Tomentum (30-)50-300 mum thick, hyphae loosely intterwoven; in old
specimens disappearing; cortex 25-80 um thick, hyphae parallel densely agglu-
tinated, rust brown; hyphal layer 100-1300 um thick, hyphae more or less
compactly longitudinally arranged.
Hyphal system subdimitic; setal hyphae absent; generative hyphae yel-
lowish, thin-walled, 2-4 sm in diam; skeletoids brownish or brown,
thick-walled, 3-5 tum in diam; in context, setal stratum and hymenium crystal-
line matter locally present.
Setal layer 100-1000 um thick, 3-15 stratose, each composed of old thick-
walled, later agglutinated brownish dendrohyphidia, vertically arranged hyphae
and setae; between strata thin (20-30 ym) layer of densely interwoven brown
hyphae; setae rare or not numerous, (25-)35-80(-100) x (4-)5-8(-9) um, pro-
jecting 20-40 um, subulate, with acute tip, straight, naked or enmeshed in
hyphal sheaths, without incrustation.
Dendrohyphidia in sterile hymenial layer numerous, hyaline or yellowish,
in upper half repeatedly branched (tree-like), up to 45 um long, 1.5-3.5 um in
diam; in fertile (basidia-bearing) hymenium less numerous or very rare, with
151
thick brown walls, agglutinated with brown resinous matter; no cystidia;
basidioles present, 15-18 x 3.5-5 ym, without incrustation; basidia clavate or
almost cylindrical, hyaline or at base with thickened brownish walls, 20-30 x
5.5-7 um; sterigmata 4, 4-5 xm long; spores broadly ellipsoid, with one side
slightly flattened, sometimes with a guttula, (5-)5.2-6.5(-7) x (3-)3.5-4.5(-4.8)
pm.
SUBSTRATA IN N. AMERICA. Cerocarpus sp. (1), Prosopis glandulosa (2).
DISTRIBUTION IN N. AMERICA. USA: AZ (Pima Co, Coronado Nat.
Forest, Lower Bear Canyon and Sabino Canyon, 16 Nov 1972 R.L. Gilbertson 1274,
1277, 5700; Carr Canyon, 3 Oct 1975 R.L. Gilbertson 11418, ARIZ).
DISTRIBUTION ELSEWHERE. Mesoamerica. Costa Rica (Las Tablas
Protector Zone, 24 Jun 1999 K. Haugerud 121, O and TAA; Rio Grande, Luquillo
Mts., 18 Jun 1996 K.H. Larsson 9024, G and TAA); Panama, Canal Zone, Chiriqui,
17-19 Mar 1911 W.R. Maxon 559 (BPI). Caribbean. Dominica (Basin Will [= ?], 19
Aug 1992 M.R. Elliote 356, K); Puerto Rico (30 Apr 1991 Setliff & L. Sevean 1860,
K; P. Roberts 542, K). Northern South America. Venezuela (type).
TYPE STUDIED. Venezuela, Estado Bolivar, Torono-Tepui, Chimanta Massif,
23 Feb 1955 J.A. Steyermark & J.J. Wurdack 1115 (NY, holotype).
REMARKS. Seemingly effused specimens are sometimes very similar to
H. pinnatifida; that species differs with closely adnated truly resupinate basid-
iomata and cylindrical, slightly curved spores 4-6(-7) x 1.5-2.5(-2.8) wm.
The holotype of H. escobarii is sterile; Costa Rican specimen Haugerud
12] has some heavily damaged spores, but three Arizona collections have
numerous, partly undamaged spores. Unique combination of characters (pileate
basidiomata with tomentum, cortex, hyphal and stratose setal layer; presence of
well developed dendrohyphidia) and size of setae, colour of hymenium makes it
possible to assert conspecificy of these collections. Mean size of spores was
5.85 x 3.84, 6.03 x 3.95 and 6.38 x 4.12 um in the Arizona specimens; mean
Q value was 1.52, 1.53 and 1.55. Dendrohyphidia are very distinct in sterile
specimens but agglutinated with brown resinous matter and indistinct in sporu-
lating ones.
18. Hymenochaete fuliginosa (Pers.) Lév. Figs. 4, 4; 6, 4
Lév., Ann. Sci. Nat. III 5: 152 (1846); Léger, Hymenochaete 145, f. 48 (1998) p.
p. - Thelephora fuliginosa Pers. Mycol. Eur. 1: 145 (1822). - Not H. fuliginosa sensu
Berk., 1869, Wakef., 1915 and Burt, 1918.
Basidiome effused, closely adnate, hard when dry, (50-)75-400(-600) wm
thick but usually only up to 300 ym, 0.2-1 cm in diam, then confluent and up
to 10 cm long. Hymenium smooth or slightly uneven, later densely irregularly
cracked, dark Umber or dark chocolate (7.5 YR 4/4; K & W: 7 E 4-5, fawn to
Somalis), without olive or lilac tint; margin thin, abrupt, when young rust
brown and tomentose, then concolorous with hymenium or with a darker zone.
Tomentum absent, cortex absent or indistinct; context composed of setal
layer of overlapping rows of setae, sometimes thin indistinct hyphal layer
present; dark line above the hymenium absent.
12
Cortex 5-25 ym thick when present; hyphae densely interwoven, indistinct,
agglutinated, brown; hyphal layer when present up to 30 um thick, hyphae
compact, longitudinally agglutinated.
Hyphal system monomitic; setal hyphae absent; generative hyphae 2-4 um
in diam, yellowish to brownish, thin-walled or with thickened walls, aggluti-
nated, subindistinct; in context and hymenium crystalline matter absent.
Setal layer 50-575 ym thick; setae numerous, (60-)65-100 x (6-)7-11 um,
partly projecting up to 65 ym, subulate, with acute or very sharp tip, straight,
naked, without incrustation.
Hyphidia not numerous to numerous, hyaline or yellowish, 2.5-3 um in
diam, thin-walled, without incrustation; cystidia absent; basidioles absent or
present, 2.5-3.5 wm in diam, without incrustation; basidia clavate or subcla-
vate, 13-18 x (3.5-)4-5 um; sterigmata 4, about 4 wm long; spores cylindrical,
slightly curved, 5-6.5(-7) x 1.8-2.6(-2.8) ym.
CULTURAL CHARACTERS. Léger & Lanquetin, 1996: 108.
SUBSTRATA IN N. AMERICA. On wood and bark of coniferous trees, except
in Alaska also on birch and in Arizona on poplar. - Abies grandis (3), A. lasiocarpa
var. arizonica (1), Betula sp. (1), Chamaecyparis thyoides (1), Juniperus virginiana
(2), Larix occidentalis (3), Libocedrus decurrens (1), Picea engelmannii (1), P. glauca
(5), P. x lutzii (2), P. mariana (1), Picea sp. (6), Pinus albicaulis (1), P. contorta (4),
P. resinosa (2), Pinus sp. (2), Populus spp. (1), Pseudotsuga macrocarpa (1), P.
menziesii (5), Thuja occidentalis (14), T. plicata (3), Tsuga canadensis (1), T.
heterophylla (4), Tsuga sp. (3).
DISTRIBUTION IN N. AMERICA. CANADA: AB (2), BC (3), ON (2). USA:
AK (10), AZ (4), CA (2), CO (8), ID (8), MD (1), MI (16), MT (12), NC (1), NY
(2), PA (1), TN (2), WA (1).
DISTRIBUTION ELSEWHERE. Europe: Austria, Byelorussia, Czechia,
Estonia, Finland, France, Germany, Norway, Poland, Russia (Komi and Murmansk
Reg., Ural), Slovakia, Sweden, Ukraine (Transcarpatia); Asia-Temperate: Caucasus,
China, Japan, Russian Far East (incl. Kamchatka and Sakhalin Is.), Siberia,
Turkmenistan. - On logs and trunks of coniferous trees; found once also on Salix sp. in
N. Sweden and in Norway.
TYPE. Possibly lost; an unpublished and ill-considered neotype (USA, Ohio, Burt
33121, BPI) designated by DeFigio (1970: 62) belongs to H. jobii, not to H. fuliginosa.
REMARKS. A thin layer of parallel agglutinated hyphae 15-30 pm thick
may be present at base of the basidioma; this may be called cortex, or hyphal
layer equally. Some American authors (Jung, 1987: 136; DeFigio, 1970: 62)
have not distinguished H. fuliginosa and European H. subfuliginosa Bourdot &
Galzin; Léger (1998: 145) considered these names to be synonymous. Closely
related H. jobii differs in its spores (ellipsoid, 4.5-6 x 2.3-3 xm) and substrate
(angiospermic trees, mainly oak). H. fuliginosa is also similar to H. corrugata
which differs in more slender spores 4.5-6.8 x 1.5-2.3 um and setae always
encrusted in upper part with amorphous granules, or with a rugose tip.
H. fuliginosa has been described from N. America and Cuba as growing
on wood of deciduous trees by Burt, 1918: 365 (on wood of Betula,
Rhododendron), or as growing on Betula by Jung (1987: 136), but spores of
the American specimens have been described as 4 x 2 xm (Burt) or 5-6.5 x 3-4
153
pm, broadly suballantoid to ovoid (DeFigio, 1970). The Cuban specimen (MO
55156, BPI) mentioned by Burt (1918) was studied by Reeves & Welden
(1967: 1044); its spores were described by them as 5 x 3 um, ovoid. Possibly
most of the specimens mentioned by these authors belong to H. jobii. H.
fuliginosa has been found on angiospermic trees as an exception in northern
regions (Alaska, Norway, Sweden) where this species is common.
Misidentifications. Several specimens filed under the name H. fuliginosa in
herbaria are misidentified; these belong to H. jobii, others to H. cinnamomea
ssp. spreta, H. corrugata, H. curtisii, H. pinnatifida, H. semistupposa. On the
other hand, several specimens of H. fuliginosa have been filed under the name
H. tenuis.
19. Hymenochaete fulva Burt Figs. 4, 1; 5, 12
Burt, Ann. Missouri Bot. Gard. 5: 354, f. 23 (excl. 23-c) (1918); Reeves &
Welden, Mycologia 59 (6): 1044 (1967); Léger, Hymenochaete 149, f. 49 (1998). - Not
H. fulva sensu Doidge, Bothalia 5: 484 (1950): see Talbot, Bothalia 7: 155 (1958).
Basidiomata effused, closely adnate, coriaceous when dry, 1-1.5 cm in
diam, then confluent and up to 8 cm long, 100-225 pm thick. Hymenium
smooth, not cracked or with few deep crevices, Cinnamon (light) brown (M:
7.5 - 10 YR 5-6/5-6; K & W: 5-6 D 6, cinnamon brown or oak brown),
without olive or lilac tint; margin abrupt, distinctly limited, yellowish
Ochraceous (M: 7.5-10 YR 8/6-7; K & W: 5 B 5, dull apricot yellow).
Tomentum absent, cortex present; context composed of hyphal layer com-
posed of loosely interwoven hyphae; dark line above the hymenium usually
present.
Cortex 12-30 ym thick, hyphae tightly interwoven, thick-walled, 2.5-4
pm.
Hyphal layer 40-50 um thick.; hyphal system monomitic; setal hyphae in
hyphal layer absent; generative hyphae with thickened walls, brownish,
branched, septate, 2.5-4 um in diam, some encrusted with resinous matter; in
hymenium crystalline matter present, sometimes forming agglomerates up to 20
pm in diam.
Setae in hymenium numerous, (60-)70-90(-95) x (6-)7-9(-10.5) um, pro-
jecting up to 60 pm, subulate to subfusiform, straight, without or with a hyphal
sheath, without incrustation, tips acute.
Hyphidia absent; heavily encrusted cystidia-like hyphal ends with a con-
glomerate of crystals 20-30 x 6-10 wm sometimes present; basidioles present;
basidia clavate, hyaline, 18-25(-30) x 5-6 wm; sterigmata 4, 3-4 um long;
spores broadly ellipsoid, (4.8-)5-6(-6.2) x 3.2-4 ym.
SUBSTRATA IN N. AMERICA. Unknown.
DISTRIBUTION IN N. AMERICA. MEXICO: VC (Botanical Garden, near
Xalapa, 1300 m, 6 Jan 1992 M. Palacios-Rios 3453, XAL; TAA 174363). - The col-
lection from USA, Louisiana mentioned in the original description of the species by
Burt (1918: 335) is a mixture of H. pinnatifida and H. episphaeria according to DeFigio
(1970: 66).
DISTRIBUTION ELSEWHERE. Caribbean: Jamaica (holotype). Mentioned by
Doidge (1950) from Southern Africa, possibly erroneously.
154
TYPE STUDIED. Jamaica, Cinchona, W.A. & E.L. Murrill 645 (NY; the
basidiome, less than 1 cm in size, was not studied microscopically).
REMARKS. Externally similar and possibly related to H. cinnamomea
which differs in lack of cortex and spores 4.5-6.5(-7) x 1.8-2.8(-3) pm.
Cystidia of H. fulva described and figured by Burt (1918) and Léger (1998) are
actually encrusted tips of hyphae, only slightly differentiated and of little use in |
identification of this species. Spore size of the holotype was described as 4-5.5
x 3-4 wm by Léger (1998: 149), 6 x 3-3.5 wm by Reeves & Welden (1967:
1045) and 5-6.2 x 3-4 um by D.J. Job (note with the type in NY). Mean spore
size of the Mexican specimen is 5.44 x 3.63 wm; Q = 1.50.
20. Hymenochaete jobii Parmasto Figs. 3, 9; 5, 10
Parmasto, Folia Cryptog. Estonica 37: 62, f. 1, 5 (2001). - H. corticolor sensu
Reeves & Welden, Mycologia 59 (6): 1043 (1967) and Job, Mycol. Helvet. 4 (1): 16
(1990). - H. ungulata Burt, Ann. Missouri Bot. Gard. 5: 338 (1918).
Basidiomata effused, closely adnate, hard when dry, 0.5-1.5 cm in length,
then confluent and up to 15 cm, (150-)300-1000(-3000) ‘um thick. Hymenium
usually with scattered or densely situated low rounded tubercles, azonate, not
cracked or with not numerous irregular cracks, greyish brown (M: 5 YR 5/4;
K & W: 6 D 3-4, camel or café-au-lait), later brown or dark chocolate brown
(M: 7.5 YR 4/4-7; K & W: 6 F7 - 6 E 3, chestnut brown to greyish brown),
without olive or lilac tint; margin fibrillose when young, 0.5-1 mm broad,
whitish or yellowish brown (M: 7.5 YR 5/8-10; K & W: 6 D 7), then
disappearing, concolorous with hymenium or more clearly brown (without a
grey tint).
Tomentum absent; cortex absent but when basidiome young, a thin (10-50
ym) basal layer of parallel densely packed hyphae present; context composed
of setal layer as overlapping or distinct rows of setae; dark line above the
hymenium present or absent.
Cortex (when present) hyphae interwoven, brown, agglutinated; context
hyphae compactly arranged, erect.
Hyphal system monomitic with indistinct differentiation to generative and
pseudoskeletal hyphae; setal hyphae absent; generative hyphae 2-4.5 wm in
diam, yellowish to brownish, with thickened walls, ramified, usually distinct; in
context of old specimens agglomerates of crystalline matter.
Setal layer 200-3000 mm thick; setae numerous, (50-)60-110(-120) x
7-12(-15) pm, projecting up to 60 ym, subulate, with acute tip, straight or some
with slightly curved tip, naked or with a hyphal sheath, without incrustation or
sometimes encrusted with small crystals at tip.
Cystidia absent; hyphidia not numerous to numerous, hyaline or yellowish,
2-3 wm in diam, thin-walled, without incrustation, but rarely with slightly thick-
ened and granulose walls; basidia clavate or subclavate, 15-25 x 3.5-5 um; ste-
rigmata 4, 3-5 um long; spores ellipsoid, with one side flattened, 4.5-6 x
2.2-3.2(-3.5) wm.
Causes a white pocket rot of wood.
SUBSTRATA IN N. AMERICA. Acer sp. (7), Alnus oblongifolia (1), Betula
sp. (1), Castanea sp. (1), Fagus grandifolia (2), Fagus sp. (3), Juglans major (2),
ja
_ Populus tremuloides (1), Populus sp. (1), Quercus arizonica (1), Q. hypoleucoides (3),
Q. reticulata (1), Q. rubra ( syn.: Q. borealis) (4), Quercus sp. (15).
DISTRIBUTION IN N. AMERICA. CANADA: ON (5), PQ (1). USA: AZ
(10), CT (1), KY (1), LA (1), MD (1), ME (1), MI (16), NC (9), NY (4), OH (1), PA
(1), TN (2), VA (2), VT (4), WI (4).
DISTRIBUTION ELSEWHERE. Caribbean: Cuba, Jamaica; South America:
Brazil, Ecuador.
TYPES STUDIED. H. jobii: USA, New York, Schuyler Co, Van Etten, Arnot
Forest, on Betula sp., 19 Sep 1970 H.H. Burdsall 4932 (TAA 171182, holotype;
CFMR, BPI, isotypes). H. ungulata: Mexico, Jalapa, 12-20 Dec 1909 W.A. & ELL.
Murrill 176 (NY, holotype; BPI 348551, isotype).
REMARKS. The name H. corticolor Berk. & Ravenel has been misused
for this species in many cases; unfortunately, the type of the first belongs to H.
cervina. Both species as well as H. unicolor are closely related sibling species;
the differences are described under H. cervina. Macroscopically the very
similar H. fuliginosa differs in cylindrical slightly curved spores 5-6.5(-7) x
1.8-2.6(-2.8) jm, broader setae and growing on conifers. Resupinate
basidiomata of H. rubiginosa also grow on oak wood and are sometimes quite
similar to H. jobii, but differ in free margins of easily separable from
substratum basidiomata, by presence of tomental and basal hyphal layers and
spores (3.5-)3.8-5.5 x (1.8-)2-2.8(-3) um.
In Europe, a possibly very closely related species H. subfuliginosa Bourdot
& Galzin has been found growing on wood of Quercus spp.
The basidiomata of H. jobii are usually resupinate but sometimes with
thickened, somewhat reflexed black upper margin (e. g., specimens from Nova
Scotia, L.E. Wehmeyer 628, NY and Florida, N.L.T. Nelson, BPI 329792).
H. ungulata Burt is possibly based on such an old and weathered specimen.
The type of that species is sterile; whitish gray colour of its hymenial surface is
caused by numerous crystals and agglutinated hyphae; setae are sheathed with
hyphae, 60-95 x 9-12 um, with indistinct contours; it is possible that the sterile
when collected specimen has been preserved in alcohol. Lindblad & Ryvarden
(1999 ) described a specimen under the name H. ungulata from Costa Rica, but
it has small setae 30-50 x 6-8 wm and spores 4-5.2 x 2.3-2.8(-3) wm, both
typical for H. unicolor.
Many of the speciemens mentioned in literature as H. fuliginosa or H.
fusca (P. Karst.) Sacc. collected on wood of deciduous trees and having
ellipsoid or ovoid spores may belong to H. jobii. Misidentifications. H. jobii
has sometimes been filed in herbaria under the names H. corrugata and H.
rubiginosa.
21. Hymenochaete leonina Berk. & M.A. Curtis Figs .2312; 634) 1
Berk. & M.A. Curtis, J. Linn. Soc. Bot. 10 (46): 334 (1868); Burt, Ann. Missouri
Bot. Gard. 5: 353, f. 22 (1918); Reaves & Welden, Mycologia 59 (6): 1045 (1977);
DeFigio, Tax. anal. 44, f. 15, pl. 4 f. 15a (1970); Léger, Hymenochaete : 174, f. 62
(1998).
Basidiomata effused, adnate but separable when moist or as pieces when
dry, soft coriaceous when dry, 100-800 um thick, 0.5-2 cm in diam, when con-
156
fluent up to 10 cm in extent. Hymenium smooth, azonate, not cracked, Isabel-
lous Cinnamon, darker in center (Sienna to Umber or cocoa brown) (M: when
young 7.5 YR 6/8, then 5-7.5 YR 4-5/6-7 to 6/10; K & W: 6 D-E4-6E/7,
camel to cognac), sometimes with an olivaceous tint; margin thin, up to 2 mm
wide, abrupt, sometimes tomentose or indeterminate, lighter coloured than
hymenium, Fulvous (M: 7.5 YR 7/8-10; K & W 5 B 6, apricot yellow) or con-
colorous.
Tomentum absent or present as the upper part of the hyphal layer; cortex
present as a dark line up to 55 ym thick in the middle of the seemingly duplex
hyphal layer dividing it into two parts of more or less the same thickness;
context composed of hyphal layer and a setal layer; upper and lower part of the
hyphal layer similar in texture; setal layer present as overlapping or indistinct
rows of setae; dark line above the hymenium present or absent.
Hyphal layer 100-700 um thick; hyphae loosely interwoven, in the lower
part somewhat descending; hyphal system monomitic; setal hyphae absent; gen-
erative hyphae 2.5-4 wm in diam, yellowish or brownish, with thickened walls
or thick-walled, septate, rarely branched; in context, setal stratum and
hymenium crystalline matter absent.
Setal layer 50-250 um thick, darker than hyphal layer; setae numerous, in
1-4 indistinct rows, 40-80(-90) x (6-)7-13(-14) um, projecting up to 30-60 um,
conical to slightly fusiform, with almost blunt or acute tip, straight or some
with slightly curved tip, enmeshed in hyphal sheaths or naked, without incrus-
tation; in marginal part of the basidiome sometimes embedded curved setae up
to 120 um long.
Hyphidia in fertile hymenium absent, in sterile hymenium numerous
(sometimes rare), yellowish, cylindrical or slightly conical, with almost blunt
conical tip, 2-3 wm in diam, with thickened walls, without incrustation;
basidioles present, without incrustation; basidia clavate or subclavate,
14-20(-25) x 4-6 wm; sterigmata 4, 4-5 wm long; spores short-cylindrical,
slightly curved, or ellipsoidal with one side slightly flattened, 3.8-5.5 x (1.8-)2-
3(-3.2) pm.
SUBSTRATA IN N. AMERICA. Fraxinus velutina (G & L, 1995), Juglans
major (1), Liquidambar styraciflua (2), Quercus arizonica (G & L, 1995),
Rhizophora sp. (1).
DISTRIBUTION IN N. AMERICA. MEXICO: OA (San Pedro Yolox)
(Escobar, 1978), SI (San Blas, 12 Jun 1970 C.K. Sylber 322, BPI 277515), VC
(Lanborn, C.R. Orcut 1920, NY, K). USA: AR (Burt, 1918: 354), AZ (Santa Cruz
Co, Coronado Nat. Forest, 12 Aug 1971 H.H. Burdsall 6006, 6008, CFMR), KY
(DeFigio, 1970: 46, but the cited specimen not found in BPI), LA (St. Martin Parish, N
of Chacaoula, 14 Oct 1956 A.L. Welden 1028, NY; near St. Martinsville, 4 Aug 1889
A.B. Langlois 2091, BPI and NY, and Nov 1899 A.B. Langlois, K), NC (Haywood
Co, Baxter Creek Trail, 6 Jul 1970 H.H. Burdsall 4207, CFMR). .
DISTRIBUTION ELSEWHERE. Caribbean: Cuba, Jamaica, Guadeloupe,
Trinidad; South America: Argentina, Bolivia, Brazil, Colombia, Ecuador, French
Guiana, Guyana, Uruguay, Venezuela; East Tropical Africa: Kenya; Southern
Africa; Asia Tropical: India, Sri Lanka. Mentioned also from Great Britain but these
/,
data are doubtful. - On angiospermic trees (Aspidosperma sp., Nectandra sp. et al.);
most collections are from unknown substrata.
TYPE STUDIED. Cuba, C. Wright 532 (K, holotype; “Cuba Orientalis, 1856-7
C. Wright 423”, FH 3027, isotype 2).
REMARKS. Easily distinguishable by soft loose subiculum and a dark
line in the middle of context (“hyphal layer”); however, it is sometimes
lacking, especially in young specimens; sometimes there are 2-4 lines. This line
~ is homologous with cortex, and there is no duplex hyphal layer in this species:
the upper part of the context is tomentum, not an “upper” part of the hyphal
layer. Misidentifications. In some cases H. corrugata, H. pinnatifida and H.
tabacina have been misidentified as this species.
Mean spore size and Q value of the specimens studied:
4.08 x 2.31 1.77 (NC, CFMR 4207)
4.28 x 2.53 1.69 (AZ, ARIZ 6008)
4.38 x 2.31 1.89 (CFMR 3927)
4.53 x 2.34 1.94 (Jamaica, K, Roberts GA627)
4.57x 2.84 1.61 (AZ, CFMR 6006)
22. Hymenochaete luteobadia (Fr.) Ho6hn. & Litsch. Bisse 230.0)
Hohn. & Litsch., Sitzungsber. K. Akad. Wiss. Wien, Math.-nat. KI. I 116: 750
(1907); Burt, Ann. Missouri Bot. Gard. 5: 323, f. 8 (1918); Reeves & Welden,
Mycologia 59 (6): 1045, f. 1 B (1967); DeFigio, Tax. anal. 48, f. 17, pl. 5 f. 17a
(1970); Léger, Hymenochaete 184, f. 67 (1998). - Thelephora luteobadia Fr., Linnaea
5: 526 (1830). - Stereum laetum Berk., J. Acad. Nat. Sci. Philadelphia 2: 279 (1853). -
Stereum pulchrum (Schwein. ex Cooke) Cooke in Sacc., Syll. fung. 6: 561 (1888). -
Hymenochaete reflexa Burt, Ann. Missouri Bot. Gard. 5: 336, f. 12 (1918). -
Hymenochaete cubensis Burt, Ann. Missouri Bot. Gard. 5: 327, f. 13 (1918).
Basidiome effuso-reflexed or sessile-pileate, coriaceous when dry,
185-700(-1000) um thick. Pilei single or a few growing together to confluent,
imbricate, flabelliform to dimidiate, 0.2-3 cm long, up to 6(-8) cm broad,
somewhat flexible or brittle when dry; pileal surface concentrically sulcate and
zonate, velutinous or tomentose to strigose with glabrous zones, becoming
glabrous or radially fibrillose when old, reddish brown or brown (M: 5-5 YR
5/7 or 4.5/6 or 2.5 YR 4-5/6; K & W:6D6-6F 6,5 B2 -5B 3, cinnamon
brown to burnt umber, rarely with orange grey to brownish grey concentric
bands); margin thin, entire or lobate, ruffled, concolorous with the pileal sur-
face or lighter coloured (yellowish brown). Hymenium smooth, azonate or
faintly zonate, not cracked, greyish orange to pale reddish brown or dark ful-
vous; rusty brown in old specimens (M: 7.5 - 10 YR 6-6.5/4-6 or 7.5 YR 6/6 -
5/8; K& W:5B3-5B6to5 C4-5C 6, greyish orange to brownish
orange), sometimes with an olive tint; margin concolorous with hymenium or
lighter coloured (when young: whitish orange).
Tomentum present or almost indistinct (as abhymenial hairs); cortex pres-
ent; context composed of hyphal layer or hyphal and setal layer of overlapping
rows of setae; dark line above the hymenium absent.
Tomentum 50-400 pum thick, consists of loose spongy tissue of more or
less erect and somewhat entwined hyphae with brownish thickened walls,
158
septate, 2.2-3.3 wm in diam; cortex 20-65 um thick, its hyphae densely parallel
or interwoven; hyphal layer 200-500 pm _ thick, hyphae compactly
longitudinally arranged.
Hyphal system monomitic; setal hyphae absent; generative hyphae 2.5-3.5
ym in diam, brownish or brown, with thickened walls or thick-walled; in con-
text, setal stratum and hymenium crystalline matter absent.
Setal layer (when present) 80-400 pum thick; setae not numerous,
(25-)40-60 x 5-8 um, projecting to 35 um, distinctly fusiform, with acute tip,
straight or some slightly curved or falcate, enmeshed in hyphal sheaths, without
incrustation.
Hyphidia usually numerous, brownish, slightly conical, 2-3 um in diam,
with (sometimes unevenly) thickened walls to thick-walled, without incrustation
or in upper part with small brown granules which may dissolve in KOH
solution; cystidia absent; basidioles present, without incrustation; basidia
clavate or subclavate, 15-20 x 4-5 um; sterigmata 4, 4-5 ym long; spores
oblong-ellipsoid, one side flattened, 4-5(-5.5) x 1.8-2.5 um.
CULTURAL CHARACTERS. Boidin & Lanquetin, 1984: 214; Job, 1986: 228.
SUBSTRATE IN N. AMERICA. Unknown.
DISTRIBUTION IN N. AMERICA. MEXICO: VC (Uxpanapa reg., Cam-
pamento Hermanos Cedillo, 14 Jul 1976 A.L. Welden 3677, XAL).
DISTRIBUTION ELSEWHERE. Mesoamerica: Mexico (Campeche and Yuka-
tan), Belize, Costa Rica, Panama; Caribbean: Cuba, Dominica, Jamaica, Grenada,
Guadeloupe, Puerto Rico, Santa Lucia, Trinidad; South America: common - Argen-
tina, Bolivia, Brazil, Colombia, Galapagos, Guyana, Paraguay, Peru, Suriname,
Venezuela; Africa: Angola, Burundi, Central African Republic, Ethiopia, Kenya,
Madagascar, Rwanda, South African Republic, Tanzania, Uganda, Zaire, South Africa;
Asia-Temperate: China; Asia Tropical: India, Malaysia (Sabah), Nepal, Philippines,
Thailand, Vietnam; Australasia: Australia, Tasmania. - On rotten wood of angiosper-
mic trees; host of most collections unknown (some few hosts mentioned, e. g., Acacia
arabica).
TYPES STUDIED. H. cubensis: Cuba, Alto Cedro, March 1903 L.M. Under-
wood & F.S. Earle 1491 (NY); A. reflexa: Jamaica, 12-14 Jan 1909 W.A. Murrill &
W. Harris 989 (NY).
REMARKS. Characteristic for H. luteobadia are relatively small distinctly
fusiform setae, presence of numerous brownish encrusted hyphidia with thick-
ened walls, presence of tomentum and cortex, and dull grayish-yellowish or
ochraceous colour of hymenium. Most of the specimens of this species studied
by me are sterile; in one collection from Mexico (Yucatan, Quintana Roo, Guz-
man 20791, XAL) the mean spore size is 4.56 x 2.26 um; Q = 2.02.
23. Hymenochaete pinnatifida Burt Figs: 2,-97529
Burt, Ann. Missouri Bot. Gard. 5: 355, f. 24 (1918); DeFigio, Tax. anal. 23, f. 5,
pl. 2 f. Sa (1970); Léger, Hymenochaete 218, f. 83-84 (1998).
Basidiomata effused, adnate, sometimes with separable margins, coria-
ceous when dry, growing as small patches 0.5-1.5 cm in diam, then confluent
and up to 10 cm in length, 100-350 um thick. Hymenium smooth or with scat-
tered low tubercles, azonate, when old irregularly cracked, greyish brown or
159
light brown (M: 7.5-5 YR 6/2 to 5/4; K & W: 6 D 2-4), then cocoa brown,
chestnut brown or dark brown (M: 7.5 YR 4/6-7, 4-5/4 or 6/6; K & W: 6 E-F
5-7, teak brown to dark brown); margin finely fibrillose, 0.5-1 mm broad,
whitish or light brownish orange (M: 5 YR 5/6 to 7.5 YR 6/8; K & W: 6 C-D
5-6 or 6 D 4), later concolorous with hymenium or brown without a grey tint.
Tomentum absent; cortex present; basidiome composed of hyphal and one
setal layer, rarely 2-3 alternating hyphal and setal layers present; dark line
above the hymenium present, about 12-32 um thick, composed of thick-walled
agglutinated hyphae 2-3 um in diam.
Cortex 15-25 pm thick, hyphae parallel or interwoven, dark reddish
brown, thick-walled, agglutinated, 2-2.5(-3) um in diam.
Hyphal layer 40-300 um thick, hyphae loosely longitudinally arranged or
interwoven; hyphal system subdimitic; setal hyphae absent; generative hyphae
1.8-2.7 wm in diam, hyaline or subhyaline, thin-walled, septate, ramified;
skeletoids numerous, yellowish brown, 2.3-3.8 um in diam, thick-walled; setal
stratum and hymenium contain crystalline masses 10 - 20 x 10 um.
Setal layer 30-100(-250) ym thick, with a few or up to 10 overlapping
rows of setae; setae of two types: numerous setae 15-40 x 3-6 wm, embedded;
not numerous big setae 40-70 x 5-8(-10) um, projecting to 40 ym, both conical-
fusiform, with acute tip, straight, naked or enmeshed in hyphal sheaths, without
incrustation.
Simple hyphidia absent or present, 2-3 um in diam, walls brownish, thick-
ened; dendrohyphidia with thickened brownish walls, stem 12-22 x 2-3(-6) um,
in upper half or uppermost part repeatedly branched, with pinnatifid tips;
cystidia absent; basidioles present, without incrustation; basidia not numerous,
clavate or subclavate, 14-18 x 3-4.5 um; sterigmata 4, about 3.5-4 um long;
spores cylindrical, slightly curved, 4-6(-7) x 1.5-2.5(-2.8) wm.
CULTURAL CHARACTERS. Job, 1986: 223; Léger & Lanquetin, 1989: 328
and 1996: 115.
SUBSTRATA IN N. AMERICA. Abies fraseri (1), Acer negundo (1), A.
rubrum (1), Alnus rugosa (G & L, 1995), Alnus sp. (1), Betula populifolia (1), Carya
sp. (3), Celtis laevigata (1), Elaeagnus umbellata (G & L, 1995), Fagus sp. (3),
Fraxinus velutinus (2), Fraxinus sp. (1), Gordonia lasianthus (1), Ilex vomitoria (1),
Jugians major (1), Juniperus deppeana (1), Liquidambar styraciflua (2), Magnolia
virginiana (1), Magnolia sp. (1), Micropholis guyanensis (syn.: M. chrysophylloides)
(1), Myrica cerifera (1), Parthenocissus sp. (1), Persea sp. (1), Prunus sp. (2),
Quercus falcata (1), Q. nigra (1), Q. prinus (1), Quercus sp. (12), Sabal palmetto (1),
Salix sp. (2), Taxodium sp. (1), Ulmus sp. (1).
DISTRIBUTION IN N. AMERICA. MEXICO: NL (Escobar, 1978), VC (1).
USA: Rather rare, mainly found in the southern part of the USA. AK (1), AL (2), AR
(1), AZ (3), CA (2), FL (47), GA (5), IL (3), LA (12), MA (1), MD (1), MS (14), NC
(2), NM (1), NY (3), OH (2), PA (5), SC (1), TX (2), VA (2), VT (1).
DISTRIBUTION ELSEWHERE. Mesoamerica: Mexico (Chiapas, Escobar,
1978), El Salvador; Caribbean: Cuba, Jamaica, Dominica, Grenada, Guadeloupe,
Puerto Rico, Santa Lucia; South America: Argentina, Brazil, Ecuador, Guyana, Peru,
Venezuela; Africa: Central African Republic, Gabon, Réunion, South Africa; Asia
Temperate: China (Hainan); Asia Tropical: India (Tamil Nadu St.). Data on
160
collections from Philippines are doubtful. - On bark of fallen limbs, on many
unidentified substrata, and on Carapa procera.
TYPES STUDIED. Paratypes: Florida, G.C. Fischer (Lloyd Herb. 8238) and
W.W. Calkins 22 (both: BPI); Georgia, E. Bartholomew 5675 (BPI).
REMARKS. Setae of this species are of two types; embedded setae are
usually only up to 35 um long. Between the two types there are usually a few
intermediates. Dendrohyphidia are abundant in mainly sterile specimens, rare
or easily overlooked in fertile ones. Another species with dendrohyphidia, H.
escobarii has sometimes seemingly resupinate but actually umbonate-adnate
basidiomata and broadly ellipsoid spores (5-)5.2-6.5 x (3-)3.5-4.5(-4.8) um. H.
pinnatifida is sometimes very similar to specimens of H. jobii and H. curtisii
which lack characteristic dendrohyphidia. Misidentifications. Many specimens
of this fungus have been misidentified in herbaria as H. asperata Ell. & Everh.
(= H. epichlora), H. cinnamomea, H. corrugata, H. curtisii, H. episphaeria,
H. insularis (= H. corrugata), H. rubiginosa, and H. spreta (= H.
cinnamomea ssp. spreta).
24. Hymenochaete rhabarbarina (Berk.) Cooke Figs. 4, 6; 5, 9
Cooke, Grevillea 8 (48): 148 (1880); Léger, Hymenochaete 233, f. 89 (1998). -
Corticium rhabarbarinum Berk. in Hooker, Fl. Nov.-Zel. 2: 184 (1855).
Basidiome effused, closely adnate, soft or almost coriaceous when dry,
100-300(-700) um thick, at first as numerous scattered patches 2-5 mm in
diam, then merging to form areas up to 15 x 5 cm. Hymenium smooth or
sometimes slightly tuberculate, azonate, not cracked, when old sometimes
irregularly cracked, Fulvous to dark Sienna (M: 7.5 YR 6/6-6/8 or 5 YR 5/8,
then 5/4; K & W: 5-6 D-E 5-6, 6 C-D 7 or 5-6 C 5, brownish orange to cocoa
brown or Pompeian yellow), without lilac tint; margin indeterminate, thin,
lighter coloured than hymenium when young (M: 7.5 YR 7/8-9; K & W: 5 B
6, apricot yellow), then concolorous and abrupt.
Tomentum and cortex absent; context composed of hyphal layer, or hyphal
layer and thin setal layer; dark line above the hymenium usually present.
Hyphal layer 60-300(-600) um thick; context hyphae loosely arranged,
interwoven; hyphal system monomitic; setal hyphae absent; generative hyphae
2.5-4(-4.5) um in diam, brownish, thin-walled or with thickened walls, septate,
ramified at right angle; in context crystalline or amorphous matter usually pres-
ent, some part of hyphae sometimes covered with brownish resinous granules.
Setae scattered (sometimes numerous), (50-)60-100(-120) x 5-8(-9.5) um,
projecting to 60-80 um, subulate or subfusiform, with acute tip, straight or
some with slightly curved tip, usually enmeshed in hyphal sheath, this usually
encrusted with amorphous yellow or brownish granules in upper half.
Hyphidia absent or not numerous, hyaline or yellowish, 1-1.5 wm in diam,
thin-walled, without incrustation; cystidia absent; basidioles 7-12 x 3.5-5 um,
with thickened walls, without incrustation; basidia (sub)utriform, with walls
thickened at base, 15-22 x (4-)5-6(-7) ym; sterigmata 4, 3-5 wm long; spores
ellipsoid to broadly ellipsoid, with one side flattened, (4.5-)4.8-6 x 2.3-3.3 ym.
CULTURAL CHARACTERS. Léger & Lanquetin, 1987: 29.
SUBSTRATA IN N. AMERICA. Taxodium sp., ? Populus sp.
161
DISTRIBUTION IN N. AMERICA. MEXICO: NL (Escobar, 1978), OA (on
road from Oaxaca to Valle Nacional, 10 Aug 1963 K.P. Dumont, CUP-ME 165, NY).
USA: AZ (Pima Co, Coronado Nat. Forest, on aspen (?), 22 Jul 1980 H.H. Burdsall
10883, CFMR); LA (on cyprus tree, Humphrey 2516, BPI 278128; East Feliciana
Parish, Idlewild, 27 Aug 1994 E. Parmasto, TAA 153146; St. Tammany Parish, Pearl
River Wildlife Area, 28 Aug 1994 E. Parmasto, TAA 153238; Baton Rouge, Burton
Plantation, 24 and 30 Aug 1994 E. Parmasto, TAA 153001, 153251).
DISTRIBUTION ELSEWHERE. South America: Argentina, Brazil, Colombia,
Venezuela; Africa: Burundi, Kenya, Réunion, Tanzania; Asia-Tropical: Sri Lanka;
Australasia: Australia, New Zealand. - On bark of dead trunks and branches of numer-
ous angiospermic and coniferous hosts.
TYPE STUDIED. Corticium rhabarbarinum: New Zealand, Colenso (K, holo-
type).
REMARKS. Some old specimens have setae arranged in two or three
obscure layers. Incrustation of setae and hyphae with reddish brown granules, a
character stressed by Léger (1998), are not always both present. Spores of this
species have been described as oval to ellipsoidal, 4-5.5 x 2.2-3 ym by Job
(1990), ovoid to ellipsoidal, 4.5-5(-5.5) x 2.5-3.5 um by Léger (1998). The
species is very closely related to H. cinnamomea (ssp. spreta) which differs in
almost cylindrical spores 4.5-6.5(-7) x 1.8-3(-3.2) wm, more slender setae
(60)70-120(-150) x 5-9(-10) um and (usually) several or many alternating
layers of setae and hyphae (H. rhabarbarina has sometimes two layers of
setae).
The type of H. rhabarbarina has been synonymized with H. cinnamomea
by P. Corfixen (note at the holotype in K). I have had great difficulties with
identification of A. rhabarbarina and was inclined to agree with Corfixen.
Nevertheless, there is a small difference in spore form and mean size which is
considerably larger than “normal” variability of spores of a species in
Hymenochaetales. Mean width of spores of H. cinnamomea is 1.93-2.63(-2.79)
pm, mean Q value is (1.83-)2.05-2.79 (35 collections from Europe, Asia,
Australasia, North and South America). The extreme values indicated in
parentheses have been observed in specimens collected in Argentina and
Louisiana, i.e., in regions where H. rhabarbarina has also been found.
Mean size of spores and mean Q value of the specimens of H.
rhabarbarina studied are:
52252624 1.99 (Argentina, BAFC 30328)
J 2a8ke mest (LA, TAA 153098)
DEP! 96 Sateteh ov! bce) (AZ, CFMR 10883)
5.43 x2.95 1.84 (LA, TAA 153146)
52a x: 3:05eele 73 teen (CATA AG 53001)
25. Hymenochaete rheicolor (Mont.) Lév. Bigs A/a
Lév., Ann. Sci. Nat. II 5: 151 (1846); Graff, Bull. Torrey Bot. Club 45: 458
(1918); Léger, Hymenochaete 235, f. 90 (1998). - Stereum rheicolor Mont., Ann. Sci.
Nat. Bot. II 18: 23 (1842). - Hymenochaete sallei Berk. & M.A. Curtis, J. Linn. Soc.
Bot. 10: 333 (1868); Burt, Ann. Missouri Bot. Gard. 5: 314 (1918); Lentz, Agric.
Monogr. 24: 18 (1955); Reeves & Welden, Mycologia 59 (6): 1048 (1967).
162
Basidiome sessile-pileate (rarely umbonate-sessile and then sometimes
seemingly effuso-reflexed), closely adnate, soft or papery-coriaceous and flexi-
ble when dry, (150-)250-800(-900) ym thick. Pilei 1-3.5(-5) cm long, flabelli-
form to dimidiate, confluent, imbricate or in rosettes up to 10 cm in diam; pil-
eal surface densely concentrically sulcate and zonate, radiately fibrillose, silky
or velutinous, dull or shiny, Fulvous to dark Sienna (M: 5 YR 4-5/8-10; K &
W: 6 C-D 7-8, reddish golden to light brown), old specimens more greyish (M:
5 YR 6/4-6); margin thin, lobate, sometimes plicate, concolorous with the pil-
eal surface or lighter coloured. Hymenium smooth, not cracked, Fulvous to
dark Sienna, almost concolorous with pileal surface (M: 5-7.5 YR 4-5/6-8; K
& W: 6 D 6-5, cinnamon brown to sunburn or 6 D-E 7-8, cognac to light
brown), when sporulating sunburn (M: 5 YR 5/4-5; K & W: 6 D 5), without
olive or lilac tint; margin concolorous but may be yellowish when young (M: 5
YR 7/10; K & W: 6 B 7, carrot red).
Tomentum of abhymenial hairs or almost indistinct; cortex absent; context
composed of hyphal layer or (in some old specimens) of hyphal layer and a
thickening setal layer; dark line above the hymenium absent.
Tomentum (when present) 20-50(-350) um thick; hyphal layer 230-800 pm
thick, hyphae rather loosely longitudinally arranged, in thin subhymenium
adscending and more densely packed. Hyphal system monomitic; setal hyphae
absent; generative hyphae 2.5-5 ym in diam, yellowish to brownish, with thick-
ened walls to thick-walled, septate, branched usually at right angle; in context,
setal stratum and hymenium crystalline matter absent.
Setal layer (when present) 50-100 um thick; setae scattered, sometimes
numerous, (60-)70-110(-135) x (8-)9-15 um, projecting 35-90 um, broadly
subulate to conical, with almost blunt or acute tip, usually enmeshed in very
thin hyphal sheaths (hyphae 1-2 xm in diam), without incrustation.
Hyphidia and cystidia absent; basidioles present, in sterile specimens very
numerous, 10-20 x 2.5-3.5(-4) wm, with slightly thickened yellowish or
brownish walls at base, in old specimens brownish and with thickened in whole
length walls and sometimes finely encrusted; basidia clavate or subclavate,
subhyaline, 15-20 x 3.5-5 wm; sterigmata 4, 3-5 um long; spores cylindrical,
curved, 4.5-7(-7.2) x 1.5-2.5 pm.
CULTURAL CHARACTERS. Boidin & Lanquetin, 1984: 193; Job, 1986: 223.
SUBSTRATA IN N. AMERICA. Ilex vomitoria (1), Myrica cerifera (2),
Quercus virginiana (1), Quercus sp. (2).
DISTRIBUTION IN N. AMERICA. MEXICO: DU (1), JA (1), M-MO and NL
(Mamolejo, Castillo & Guzman, 1981), OA (1), PU (1), SL (1), TA (Guzman, 1972),
VC (14). USA: FL (16), MS (2), NC (G & L, 1995), SC (1).
DISTRIBUTION ELSEWHERE. Mesoamerica: Mexico (Chiapas, Yucatan),
Costa Rica, El Salvador, Guatemala, Honduras, Panama; Caribbean: Cuba, Dominica,
Grenada, Guadeloupe, Jamaica, Leeward Is., Puerto Rico, St. Lucia, St. Vincent,
Trinidad; South America: Argentina, Brazil, Chile, Colombia, Ecuador, Guyana,
Paraguay, Venezuela; Africa: Rwanda; Asia-Temperate: China, Japan, Taiwan; Asia-
Tropical: India, Indonesia (Java), Malaysia (Pahang), Nepal, Pakistan, Philippines, Sri
Lanka, Thailand, Vietnam; Australasia: New Zealand; Southwestern Pacific: Fiji,
Tonga. - Found on mainly angiospermic trees and bushes.
163
TYPES STUDIED. Stereum rheicolor: "Mont. orig., Nilghery, Perrotet" (S, iso-
type) and "Stereum. 31. Authentic" (BPI, Lloyd Herb. 29711, isotype). H. sallei:
Cuba, Cordova, 1854 Sallé 278 (K, Herb. Berk. 1879; isotypes in BPI, "ex Herb.
Bresadola" and Lloyd Herb. 29726, "Authentic").
REMARKS. Characteristic for this species are thin, flexible, silky,
densely zonate basidiomata, lack of cortex, broad setae, and basidioles with
thickened walls. Seemingly effused basidiomata with elevated margins are rare;
I have seen only two such specimens both collected in Florida. Most specimens
studied are sterile; the few specimens with spores seen by me have been
collected in Mexico in March, August and October. Mean spore measurements
and Q value are:
4.10x 1.81 2.26 (MS, CFMR 13017)
4.27 x 1.94 2.20 (FL, BPI 278538)
4.75 x 1.92 2.48 (Mexico, XAL 104)
4.75 x 1.96 2.43 (Mexico, XAL, Guzman 23553)
4.80 x 1.95 2.47 (Mexico, XAL 2612)
4.85 x 1.94 2.50 (Mexico, XAL 1599)
ANS 7 X02513-02129 (Mexico, TENN 18369)
5.09 x 2.01 2.54 (Mexico, XAL, Chacon 1008)
5.40 x 2.06 2.62 (FL, CFMR 17364).
Among the specimens from the tropics identified as H. tenuissima (Berk.)
Berk. (= H. rheicolor) and in some herbaria in USA, there are many collec-
tions of H. luteobadia and H. villosa (Lév.) Bres. Misidentifications. Some
specimens of this fungus have been misidentified as H. tabacina or H. badio-
ferruginea (= H. tabacina), including Ravenel, Fungi Americi Exsiccati no.
718.
26. Hymenochaete rigidula Berk. & M.A. Curtis Figsa 2) 28526
Berk. & M.A. Curtis, J. Linn. Soc. Bot. 10 (46): 334 (1868); Burt, Ann. Missouri
Bot. Gard. 5: 318, f. 6 (1918); Reeves & Welden, Mycologia 59 (6): 1047, f. 1 E
(1967); DeFigio, Tax. anal. 46, f. 16, pl. 4 f. 16a (1970); Léger, Hymenochaete 239
(1998).
Basidiome effused or effuso-reflexed with slightly elevated margins, coria-
ceous to hard and brittle when dry, 200-600(-700) wm thick, resupinate part up
to 4 cm long; reflexed part short and broad, 0.5-1 cm long. Pileal surface
radiately fibrillose, velutinous or strigose, shiny, with concentric zones, Umber
(M: 7.5 YR 8/4; K & W: 6 E 8, hazel) with Ochreous (5 B 4, greyish orange)
bands; margin thin, entire or lobate, not plicate, concolorous with the pileal
surface. Hymenium smooth or slightly tuberculate when old, sometimes slightly
irregularly cracked, dark Cinnamon to Umber (M: 5-7.5 YR 5.5/6-8, later
darker, 4/6 to 4/4; K & W: 5-6 C 7, yellow ochre to reddish golden, or 6 D 6,
cinnamon brown, then 6 E 6-7, tan to cognac), without olive tint; resupinate
margin distinct (abrupt), up to 1 mm wide, lighter coloured (5 YR 7/8), then
concolorous with the hymenium.
Tomentum absent, cortex or cortex-like dark line in the middle of hyphal
layer sometimes present, then 20-80 ym thick and composed of interwoven
hyphae; dark line above the hymenium sometimes locally present.
164
Hyphal layer 100-450 pm thick, with infrequent horizontal setal hyphae;
hyphal system monomitic; generative hyphae loosely to compactly arranged, in
upper part longitudinally arranged, in the lower part interwoven, 3-4.5 um in
diam, yellowish, with thickened walls or thick-walled, septate, infrequently
branched; setal hyphae up to 150 pm long and 4-10 pm in diam, brownish;
crystalline matter absent.
Setal layer 30-250 ym thick; setae numerous, (35-)40-60(-80) x 7-12(-18)
ym, projecting to 40 um, fusiform, straight, not sinuate, naked, tip acute,
without incrustation or slightly encrusted with small crystals; embedded setae
sometimes with bulbous base.
Hyphidia and cystidia absent; basidioles present, thin-walled, without
incrustation; basidia clavate or subclavate, 16-22 x 5-7 wm; sterigmata 4;
spores short-cylindrical or cylindrical and slightly curved, 3.7-5(-5.5) x
1.5-2.3(-2.5) wm.
SUBSTRATE IN N. AMERICA. Quercus sp.
DISTRIBUTION IN N. AMERICA. USA: MS (Harrison Co, Harrison Exp.
Forest, 2 Dec 1989 H.H. Burdsall 13049, CFMR), TN (Knox Co, New Hopewell, 18
Mar 1945 L.R. H[esler], TENN 16741), TX (Hardin Co, Lumberton, 20 Sep 1981
R.L. Gilbertson 13242, ARIZ).
DISTRIBUTION ELSEWHERE. Caribbean: Cuba, Grenada, Guadeloupe,
Jamaica; South America: Brazil, British Guyana, Colombia, Venezuela; Africa:
Kenya. - On dead wood and bark of frondose species.
TYPES STUDIED. Cuba, La Perla, C. Wright 529 (FH, holotype; S, isotype).
REMARKS. All three specimens from USA and one from Jamaica studied
by me have spores; mean size and Q value of these are:
4.01 x 1.87 2.15 | (MS, CFMR 13049)
4.08 x 1.98 2.06 (AZ, ARIZ 13242)
4.64 x 1.60 2.89 (Jamaica, XAL, Welden 931)
5817x2243 52713 (TN, TENN 16741).
27. Hymenochaete rubiginosa (Dicks.: Fr.) Lév. Figs wa Neato,
Lév., Ann. Sci. Nat. Bot. II 5: 151 (1846); Brown, Mycologia 7 (1): 1-20, f. 1-
30 (1915); Burt, Ann. Missouri Bot. Gard. 5: 332, f. 11 (1918); Davidson, Campbell &
Vaughn, Tech. Bull. U.S. Dept. Agric. 785: 22, f. 3 M (1942); DeFigio, Tax. anal.
51, f. 18, tab. 5 f. 18a (1970); Chamuris, Non-stipit. stereoid fungi 157, f. 58 D
(1988); Léger, Hymenochaete 242, f. 92 (1998). - Helvella rubiginosa Dicks.: Fr.,
Plant. Crypt. Brit. 1: 20 (1785).
Basidiome effuso-reflexed, usually with well developed pilei, sometimes
umbonate-adnate or seemingly effused, but fixed to the substratum with an
umbonate point; resupinate part up to 4 cm in diam; woody hard and brittle
when dry, (300-)400-1200(-2000) um thick. Pilei single or a few growing
together to confluent, imbricate, reniform, 0.5-3.5 cm long; pileal surface
concentrically sulcate and zonate, not radiately fibrillose or rugose; velutinous
or tomentose, later glabrous, reddish brown or brown to blackish (M: 5 YR 4/8
when young, then 2.5 YR 4/4-6, when old 5 YR 3-4/2; K & W:6D6-6B3,
light brown to dark brown); margin thin to thick, entire or lobate, not plicate,
lighter coloured than pileal surface, bright Fulvous or ochraceous brown, rust
165
brown, later concolorous; adaxial surface of the effused basidiome
concentrically zonate and sulcate, tomentose or velutinous. Hymenium smooth
or with scattered round semispherical tubercles, not cracked or deeply scantily
irregularly creviced when old, reddish brown or brown to blackish (M: 2.5-5
YR 3-5/4; K & W:6E4-7D3to7 E 6, chocolate or bistre with reddish
tinge, greyish brown to orange brown), without olive tint, with or without a
lilac tint; margin of the resupinate part abrupt, lighter coloured than hymenium
or concolorous.
Tomentum 50-250 um thick, darker than context; cortex (20-)40-55 um
thick, hyphae densely parallel or interwoven, agglutinated, rust brown; hyphal
and setal layers present; dark line above the hymenium absent.
Hyphal layer 100-500 um thick, hyphae more or less compactly longitudi-
nally arranged; hyphal system dimitic, but difference between skeletals and
generative hyphae small; setal hyphae absent; generative hyphae 2-3.5 wm in
diam, subhyaline, thin-walled; skeletal hyphae numerous, brown, (2.5-)3-5 um
in diam, thick-walled; in context, setal stratum and hymenium crystalline matter
absent.
Setal layer 70-500 ym thick, composed of overlapping rows of setae; setae
very numerous, 40-80(-100) x (6-)8-10(-12) wm, projecting (20-)40-60 um,
conical to fusiform, with acute tip, straight or some with slightly curved tip,
naked or very rarely enmeshed in hyphal sheaths, without incrustation.
Hyphidia present but usually not well differentiated, hyaline or yellowish,
1.5-3 wm in diam, thin-walled; cystidia absent; basidioles present, 8-18 x 3.5-4
pm, without incrustation; basidia clavate or subclavate, hyaline or yellowish,
15-25(-30) x 4-6(-7) um; sterigmata 4, 4-5 um long; spores elongated ellipsoid,
with one side flattened, (3.5-)3.8-5.5 x (1.8-)2-2.8(-3) wm.
Causes a white pocket rot of wood.
CULTURE CHARACTERS. Davidson, Campbell & Vaughn, 1942: 22; Boidin,
1958: 213.
SUBSTRATA IN N. AMERICA. Found on about 30 species of trees and bushes,
but mainly on Quercus spp. and Castanea. Mentioned by Lowe (1977) also on Abies
lasiocarpa, but this is obviously erroneous. - Acer saccharum (1), Castanea dentata
(38), Castanea sp. (14), Fraxinus velutina (1), Holodiscus discolor (G & L, 1995),
Juglans major (G & L, 1995), Liriodendron tulipifera (2), Myrica cerifera (G & L,
1995), Ostrya virginiana (1), Platanus occidentalis (1), Prosopis glandulosa (G & L,
1995), Prunus sp. (1), Quercus agrifolia (G & L, 1995), Q. alba (71), Q. bicolor (2),
Q. coccinea (1), Q. gambellii (4), Q. garryana (6), Q. hypoleucoides (1), Q.
macrocarpa (2), Q. palustris (2), Q. prinus (1), Q. rubra (1), Q. rubra var. ambigua
(syn.: Q. borealis) (1), Q. stellata (1), Quercus sp. (48). Rhamnus crocea ssp. insula
(G & L, 1995), Rhamnus sp. (1), Robinia pseudacacia (4), Sambucus caerulea (syn.:
S. glauca) (G & L, 1995), Tilia sp. (1), Ulmus americana (2).
DISTRIBUTION IN N. AMERICA. Common everywhere Quercus grows.
CANADA: NF (DeFigio, 1970: 54), ON (4). MEXICO: BS (Santa Catalina Is, 2), M-
MI (1), M-MO (Cuernavaca; Guzman, 1972 and Escobar, 1978). USA: AL (1), AR
(6), AZ (2), CA (2), CO (6), CT (16), DC (3), DE (1), FL (3), GA (3), IA (1), IL (1),
IN (12), KS (7), KY (1), LA (2), MA (18), MD (10), MI (2), MN (1), MO (3),
166
MS (6), NC (27), NE (1), NJ (5), NM (4), NY (25), OH (10), OK (1), OR (2), PA
(24), SC (2), TN (10), TX (2), VA (33), VT (1), WA (4), WI (6), WV (8).
DISTRIBUTION ELSEWHERE. Mesoamerica: Costa Rica, El Salvador; Car-
ibbean: Cuba; South America: Argentina (incl. Patagonia), Chile, Colombia, Ecua-
dor, Peru; Europe: all countries where Quercus spp. grow; Asia-Temperate: Cauca-
sus, Japan, Russian Far East, Turkey; Africa: Kenya, Morocco, South Africa; Asia-
Tropical: Borneo (Sarawak), India, Pakistan, Philippines, Vietnam; Australasia: New
Zealand. - Mainly on Quercus spp., also on Castanea sativa; rarely on some other
deciduous species (Calycophyllum sp., Fagus orientalis, F. sylvatica, Carpinus betulus,
Nectandra sp., Rhamnus sp.).
TYPE. Possibly lost; neotype of H. rubiginosa (not Helvella rubiginosa!) is col-
lected by Lloyd (no. 3910 in FH) in USA, Ohio, designated by DeFigio (1970: 52) and
published by Job (1990: 39). |
REMARKS. Resupinate basidiomata of this species are similar to H. jobii
which is always closely adnate (also in marginal part) and lacks hyphal layer.
Misidentifications. Several specimens filed in herbaria under the name H.
rubiginosa are misidentified and belong to H. tabacina, H. curtisii, H. jobii, H.
pinnatifida or to H. rhabarbarina.
28. Hymenochaete tabacina (Sowerby: Fr.) Lév. Figsy 4537099,
Lév., Ann. Sci. Nat. Bot. III 5: 145 (1846); Burt, Ann. Missouri Bot. Gard. 5:
325, f. 9 (1918); DeFigio, Tax. anal. 37, f. 12, pl. 3 f. 12a (1970); Jung, Wood-rott.
Aphyll. s. Appal. 137, f. 43 n-q (1987); Chamuris, Non-stipit. stereoid fungi 158, f. 58
C (1988); Léger, Hymenochaete 270, f. 105 (1998). - Auricularia tabacina Sowerby,
Col. fig. Engl. fungi 1, pl. 25 (1797). - Thelephora imbricatula Schwein., Trans. Am.
Phil. Soc. N.S. 4: 166 (1832). - Hymenochaete imbricatula (Schwein.) Lév., Ann. Sci.
Nat. Bot. III 5: 152 (1846). - Stereum badioferrugineum Mont., Ann. Sci. Nat. Bot. II
20: 367 (1843). - Hymenochaete badioferruginea (Mont.) Lév., Ann. Sci. Nat. Bot. Ii
5: 152 (1846); Burt, Ann. Missouri Bot. Gard. 5: 330, f. 10 (1918). - H. borealis Burt,
Ann. Missouri Bot. Gard. 5: 317, f. 5 (1918); Chamuris, Non-stipit. stereoid fungi 155,
f. 58 A (1988); Léger, Hymenochaete 78 (1998). - H. obesa G. Cunn., Trans. R. Soc.
New Zeal. 85 (1): 15, f. 4, pl. 1 f. 3 (1957); DeFigio, Tax. anal. 40, f. 13, pl. 4 f. 13a
(1970).
Basidiome effuso-reflexed or effused, closely adnate, soft coriaceous but
brittle when dry, 100-600(-700) um thick. Pilei confluent, imbricate, dimidiate
or short and broad, 0.3-1.5 cm long; pileal surface radiately fibrillose, silky,
glabrous when old, with concentric zones, rust brown, grayish or dark brown
(M: 5-7.5 YR 4-5/6; K & W: 6D 6-6 F 8, 7 E 4-6, cinnamon brown to deep
dark brown); margin thin, entire, sometimes torn, plicate or crispate, lighter
coloured (golden yellow), concolorous with the pileal surface when old.
Hymenium smooth but uneven, usually concentrically zonate and sulcate,
sometimes only with some broad zones, rarely tuberculose, radially or plumo-
sely cracked (not cracked in var. badioferruginea (Mont.) Pilat), yellowish or
golden brown, brownish with grey or slightly rosy tint, then Umber (M: 7.5
YR 4-5/4, or 6.5/5 or 7/8 when young and sporulating; K & W: 5 B 3, 6 C 3
or 6 D 4-5, greyish orange, deep bownish grey or sunburn); without a lilac tint;
167
margin of the resupinate part fibrillose or abrupt, lighter coloured, then con-
colorous with the hymenium (bright Fulvous, K & W: 5 A 3, pale orange).
Tomentum present but in old specimens sometimes almost indistinct; cor-
tex present (in some young specimens absent); context composed of hyphal
layer, or hyphal layer and one setal layer with overlapping rows of setae; thin
dark line above the hymenium usually present.
Tomentum (20-)30-50(-100) um thick, sometimes with few setal hyphae;
cortex (15-)20-50 ym thick, hyphae tightly interwoven, thick-walled; hyphal
layer 50-300 um thick, lighter coloured than other layers, orange-yellow,
hyphae longitudinally loosely to (towards the hymenium) compactly arranged.
Hyphal system subdimitic; setal hyphae present in hyphal layer but not
numerous, 120-250 wm long, 7-13 wm in diam, dark brown, with very thick
walls, sometimes in young basidiomata absent; generative hyphae (2.5-)3-5 um
in diam, yellowish, thin-walled or with thickened walls, septate, branches usu-
ally diverging at a right angle; skeletoids brown, thick-walled, with scarce
septa; in context and hymenium crystalline matter absent.
Setal layer (when present) up to 150(-300) wm thick; setae in 2-5 overlap-
ping rows, numerous, (50-)60-120(-150) x 7-15(-16) um, projecting to 50(-70)
pm, very rarely bifurcate at base, fusiform, with acute tip, straight or rarely
some few slightly curved, naked or enmeshed in hyphal sheaths, finely
encrusted with hyaline or yellowish amorphous granules or crystals in upper
part.
Hyphidia and cystidia absent; basidioles present, 10-14 x 3.5-4 ym, with-
out incrustation; basidia clavate or subclavate, 15-25 x 3.5-5 um; sterigmata 4,
up to 4(-5) ym long; spores cylindrical, slightly curved, (4.3-)4.5-7 x 1.2-2.2(-
2.5) pm.
Causes white rot of wood. Experimental study on wood rot has been made
by Job & Keller, 1988.
CULTURAL CHARACTERS. Nobles, 1948: 340, 1965: 1134; Boidin, 1958:
210;
SUBSTRATA IN N. AMERICA. Found on nearly 155 species of trees and
bushes. Of 560 specimens with known substrata seen, 23% were on gymnospermic sub-
strata; among these, more than one third on Thuja, next is Abies. Most common hosts
are Acer spp., next are Alnus spp. and Betula spp. Rare on Quercus (as well as in
Europe). Larix is a usual host in North and East Asia; in N. America I have seen 6
collections from British Columbia, Idaho and Montana (on elev. of about 9,000 ft). -
Abies balsamea (8), A. canadensis (= ?) (1), A. concolor (1), A. firma (1), A. grandis
(13), A. lasiocarpa (G & L, 1995), Abies sp. (2), Acer circinatum (7), A. glabrum
(19), A. glabrum var. douglasii (2), A. glaucum (2), A. grandidentatum (1), A. macro-
phyllum (1), A. negundo (G & L, 1995), A. pensylvanicum (5), A. rubrum (21), A.
saccharinum (1), A. saccharum (22), A. spicatum (27), Acer sp. (43), Alnus crispa (1),
A. fruticosa (G & L, 1995), A. incana (12), A. incana ssp. rugosa (1), A. rubra (syn.:
A. oregona) (6), A. sitchensis (1), A. sinuata (4), A. tenuifolia (20), Alnus sp. (12),
Amelanchier alnifolia (4), A. canadensis (1), Amelanchier sp. (1), Arbutus menziesii
(1), Arctostaphylos patula (1), Aristolochia californica (3), Betula alleghaniensis
(syn.: B. lutea) (9), B. glandulosa (Niemela, 1985), B. lenta (3), B. nana (2), B.
occidentalis (syn.: B. fontinalis) (2), B. papyrifera (4), B. populifolia (2), Betula sp.
168
(10), Carpinus caroliniana (1), Carya alba (1), Carya sp. (5), Castanea dentata (1),
Castanea sp. (1), Castanopsis chrysophylla (G & L, 1995), Ceanothus velutinus (4),
Ceanothus sp. (1), Cerasus sp. (1), Chamaecyparis nootkatensis (1), C. thyoides (1),
Clethra alnifolia (1), Cornus stolonifera (2), Corylus cornuta (syn.: C. californica, C.
rostrata) (9), Corylus sp. (4); Crataegus sp. (3), Fagus sylvatica var. atropunicea (3),
F. grandifolia (7), Fagus sp. (5), Fraxinus americana (1), F. nigra (2), F. sambucifolia
(1), Gaultheria shallon (1), Hamamelis virginiana (1), Heteromeles arbutifolia (1),
Holodiscus discolor (2), Hex verticillata (5), Juniperus communis (1), J. virginiana —
(3), Juniperus sp. (1), Larix laricina (G & L, 1995), L. lyallii (1), L. occidentalis (5),
Lindera benzoin (2), Liriodendron tulipifera (1), Lithocarpus densiflorus (3),
Lonicera involucrata (1), L. periclymenum (1), Lonicera sp. (1), Lyonothamnus
floribundus (1), Magnolia sp. (1), Myrica sp. (1), Nemopanthus canadensis (= N.
mucronatus?) (1), Oplopanax horridus (2), Opulaster sp. (1), Ostrya virginiana (8),
Paxistima myrsinites (1), Physocarpus malvaceus (G & L, 1995), Picea abies (3), P.
engelmannii (G & L, 1995), P. glauca (1), P. x lutzii (4), P. mariana (Niemela, 1985),
P. rubens (2), P. sitchensis (1), Picea sp. (5), Pinus contorta (1), P. ponderosa (G & L,
1995), P. rigida (1), P. strobus (3), Pinus sp. (1), Platanus occidentalis (1), Populus
balsamifera (2), P. balsamifera ssp. trichocarpa (2), P. grandidentata (2), P. tremuloi-
des (4), Populus sp. (3), Prunus emarginata (G & L, 1995), P. pensylvanica (3), P.
serotina (1), P. virginiana (2), P. virginiana var. melanocarpa (1), Prunus sp. (5),
Pseudotsuga menziesii (syn.: P. taxifolia) (6), P. mucronata (= ?) (1), Pyrus malus
(1), Quercus alba (1), Q. coccinea (1), Q. gambelii (2), Q. garryana (G & L, 1995),
Q. rubra (1), Q. stellata (G & L, 1995), Quercus sp. (2), Rhododendron canadense
(1), R. maximum (2), R. viscosum (1), Rhus diversiloba (1), Rosa nutkana (G & L,
1995), Rubus sp. (G & L, 1995), Salix alaxensis (1), S. alba (1), S. bebbiana (2), S.
laevigata (1), S. scouleriana (1), Salix sp. (10), Sambucus sp. (1), Sequoia semper-
virens (3), Shepherdia canadensis (1), Sorbus americana (1), S. scopulina (G & L,
1995), Spiraea alba (1), S. douglasii (1), S. pyramidata (1), Symphoricarpos albus
(syn.: S. racemosus) (3), Syringa vulgaris (1), Taxus brevifolia (G & L, 1995), T.
canadensis (G & L, 1995), Thuja gigantea (= ?) (1), T. occidentalis (7), T. plicata
(33), Thuja sp. (1), Tilia americana (1), Tsuga canadensis (1), T. heterophylla (17),
Ulmus americana (4), U. rubra (1), Ulmus sp. (1), Umbellularia californica (1), Vac-
cinium corymbosum (1), V. membranaceum (1), V. parvifolium (1), V. pensylvanicum
(= ?) (1), Vaccinium sp. (5), Viburnum dentatum (3), V. lantanoides (syn.: V. alni-
folium) (2), V. nudum var. cassinoides (2), Viburnum sp. (2), Vitis labrusca (1), Vitis
sp. (1).
DISTRIBUTION IN N. AMERICA. Rare or very rare in the southern USA
(except California) and in Mexico, common northwards. Northernmost localities are in
Alaska, Yukon Terr. (61°11' N, 129°07' W), in Mackenzie Distr. of Northwest Terr.,
in Labrador Peninsula (Quebec, 55.3° N, 77.8 W and Newfoundland, 53.5° N, 64.5°W)
and South Greenland. CANADA: AB (G & L, 1995), BC (24), NB (3), NF (6), NT
(Distr. Mackenzie; G & L, 1995), NS (4), ON (30), Prince Edward Is. (2), PQ (18),
YT (1). GREENLAND: sothernmost part south of 61°15' N (Knudsen, Hallenberg &
Mukhin, 1993). MEXICO: BS (Santa Catalina Is., 1), OA (Guzman, 1972; Escobar,
1978; Welden & Guzman, 1978), VC (1). USA: AK (35), AL (1), AR (G & L, 1995),
CA (31), CO (1), CT (11), DE (1), FL (2), GA (G & L, 1995), ID (72), KY (G & L,
1995), LA (4), MA (30), MD (3), ME (43), MI (50), MN (5), MT (49), NC (10),
169
ND (G&L, 1995), NH (47), NJ (20), NM (1), NY (99), OK (G & L, 1995), OR (21),
PA (27), RI (2), SC (1), TN (5), UT (11), VA (13), VT (34), WA (64), WI (10), WV
(6), WY (3).
DISTRIBUTION ELSEWHERE. Mesoamerica: Costa Rica, Panama; Carib-
bean: Trinidad; South America: Argentina, Guyana, Brazil, Venezuela; Europe: Aus-
tria, Belgium, Czechia, Denmark, Estonia, Finland, France, Germany, Hungary, Italy,
Latvia, Lithuania, the Netherlands, Norway, Poland, Portugal, Romania, Russia, Slo-
vakia, Spain, Sweden, Switzerland, Ukraine, United Kingdom; Asia-Temperate:
China, Japan, Russia; Africa: Rwanda, Tunisia, Zaire; Asia Tropical: India, Indonesia
(Jawa), Malesia, Nepal, Pakistan; Australasia: Australia, New Zealand. - On
numerous deciduous, more rarely on coniferous trees and bushes. Common in Eurasia
on Salix spp.
TYPES STUDIED. Auricularia tabacina: holotype possibly lost; neotype of H.
tabacina (not Auricularia tabacina!) collected by W.B. Cooke 13 Jun 1948 (NY) in
USA, Idaho, designated by DeFigio (1970: 37) and published by Job (1990: 44) as if
collected by Cooke on 6 Jun 1948. H. borealis: Canada, Ontario, London, 15 Oct 1889,
J. Dearness 1017 (NY, BPI, paratypes; setal hyphae present!), USA, New Jersey, New-
field, March-April J.B. Ellis (NY, BPI, paratypes).
REMARKS. Externally very variable species. Easily recognizable thanks
to presence of tomentum, cortex, and presence of setal hyphae in context. Setal
hyphae are sometimes quite rare. Young and small, usually effused specimens
of this species with undeveloped dark line between hyphal and setal layers have
been described as H. borealis by Burt in 1918.
H. tabacina is rare in southern States of USA and in Mexico; data on
occurrence in South America are partly doubtful: in southern part of this con-
tinent it is replaced by its vicarious counterpart H. australis Greslebin & Par-
masto.
Most of the specimens studied are without basidia and spores; the time or
season of sporulation period is unknown.
Misidentifications. Several specimens filed under the name H. tabacina
are misidentified; these are H. cinnamomea ssp. spreta, H. curtisiit, H. rhe-
icolor and (most frequently) H. rubiginosa. On the other hand, H. tabacina has
been sometimes misidentified as H. curtisii.
29. Hymenochaete tenuis Peck Figse2 4/66
Peck, Ann. Rep. N. Y. St. Mus. Nat. Hist. 40: 57 (1887); Burt, Ann. Missouri
Bot. Gard. 5: 364, f. 31 (1918); Léger, Hymenochaete 278, f. 107 (1998). - Hymeno-
chaete multisetae Burt, Ann. Missouri Bot. Gard. 5: 357, f. 25 (1918); Reeves & Wel-
den, Mycologia 59 (6): 1046 (1967).
_ Basidiomes effused, closely adnate, coriaceous when dry, velvety, thin,
50-400(-1000) pm thick, becoming confluent, 2-10 x 1-2 cm. Hymenium
smooth, finely tuberculate, azonate, when old sometimes irregularly cracked,
brown, very dark brown or almost black, sometimes cinnamon brown (M: 5-
7.5 YR 4-5/4 or 4/6 to 5/8 (according to Léger, 1998: 5 YR 2-3/2-4); K & W:
5 F 8, 6 E-F7 or 6 F 8, 6 D 8, raw umber, cognac or deep dark brown, or 6 C
6, caramel brown, rarely 5 C 4-5, brownish orange), without olive or lilac tint;
170
margin thin, indeterminate, then determinate (abrupt), concolorous with
hymenium.
Tomentum and cortex absent; context composed of setal layer of overlap-
ping rows of setae (or only one layer of setae); dark line above the hymenium
absent.
Hyphal system monomitic; setal hyphae absent; generative hyphae com-
pactly agglutinated, erect or interwoven, 2.5-4(-4.5) um in diam, yellowish to
brownish, with thickened walls to thick-walled, branched, septate; in context
and hymenium crystalline matter absent.
Setae very numerous, (25-)30-60 x (5-)6-10(-12) um, projecting to 40 um,
fusiform-conical or subulate, with acute or very sharp, some with slightly
curved tip, not sinuate or sinuate (sometimes some twisted), naked, without
incrustation.
Hyphidia and cystidia absent; basidioles present, without incrustation;
basidia clavate or subclavate, 12-20 x 4-5.5 ym; sterigmata 4, 3-4.5 ym long;
spores ellipsoid or subcylindrical, one side flattened or slightly concave,
4.5-5.5 x 2-2.5 um.
SUBSTRATA IN N. AMERICA. Sabal serratula (3), Thuja sp. (1), Tsuga
canadensis (4), Tsuga sp. (1). Mentioned also by G & L, 1995 on Abies balsamea, A.
lasiocarpa, Picea glauca, Picea sp., Pinus ponderosa, Pseudotsuga menziesii, Thuja
occidentalis.
DISTRIBUTION IN N. AMERICA. USA: AL (Reeves & Welden, 1967), FL
(3), MI (2), NY (2), PA (2). Mentioned also by G & L, 1995: AR, AZ, MS, NM, VT.
DISTRIBUTION ELSEWHERE. Mesoamerica: Costa Rica; Caribbean: Cuba,
Jamaica, Puerto Rico, Trinidad; South America: Brazil, Colombia, Venezuela. - On
bark and decorticated wood of fallen limbs of coniferous and deciduous trees.
TYPES STUDIED. H. tenuis: USA, New York, Edmond ponds, on Thuja, June
Peck (NYS, lectotype selected by Léger, 1998). H. multisetae: Cuba, Cellabos, 12/11
1914 C.J. Humphrey 2808 (BPI 348562).
REMARKS. Externally similar to H. fuliginosa and H. jobii but setae of
these species are much longer, 60-110 x 7-11 um. Basidiomata of H. tenuis
have been described as only up to 120(-200) um thick, but specimens collected
on Thuja are sometimes very thick, up to 1 mm. Mean size and Q value of
spores are:
5.14 x 2.29 2.24 (CFMR 3560)
5320; x2) 29,287 7, (CFMR 3318)
Misidentifications. Most specimens filed under the name H. tenuis in her-
baria have been misidentified; these belong mainly to H. fuliginosa, some to H.
Jobii or H. cinnamomea.
30. Hymenochaete unicolor Berk. & M.A. Curtis Figss2; 10,693
Berk. & M.A. Curtis, J. Linn. Soc. Bot. 10: 335 (1868); Burt, Ann. Missouri
Bot. Gard. 5: 342, f. 16 (1918); Reeves & Welden, Mycologia 59 (6): 1048, f. 1 I
(1967); Léger, Hymenochaete 283, f. 109 (1998). - Hymenochaete fuliginosa Berk. &
M.A. Curtis, J. Linn. Soc. Bot. 10: 335 (1868) non (Pers.) Lév. (1846).
Basidiome perennial, effused, sometimes with thickened (reflexed) black
densely sulcate upper margin, closely adnate, coriaceous to woody hard when
171
dry, brittle, (100-)350-700(-1300) um thick; at first as numerous orbicular
patches 2-15 mm in diam, then merging and up to 20 x 5 cm; margin thin, later
thick and abrupt. Hymenium smooth, azonate, irregularly cracked, sometimes
lifting at the crevice edges and scaling off, Cinnamon Umber or yellowish
brown (M: 7.5 YR 4.5-6/6 or 5 YR 4/4-6; K & W: 6 D 8, 6-7 E 4-5 or 6 F 8,
Camel or Somalis brown), without olive or lilac tint; margin indeterminate,
fibrillose or abrupt, concolorous or lighter coloured than hymenium (fulvous).
Tomentum and cortex absent; context composed of thin hyphal layer 10-
200 (-300) um thick and a thickening setal layer of indistinct overlapping rows
of setae; dark line above the hymenium absent, or present as a narrow zone of
intertwined hyphae of deep colour.
Hyphal system monomitic; context hyphae compactly arranged, at base
interwoven; setal hyphae absent; generative hyphae 2-4.5 wm in diam, yel-
lowish, with thickened walls; in context and setal stratum crystalline matter
absent, or present in dark bands between setal rows, in hymenium absent or
present.
Setae numerous, (25-)35-60 x 5-7.5(-8) um, projecting to 40 wm, not
bifurcate at base, subulate or fusiform, straight, some with slightly curved tip,
not sinuate, naked or enmeshed in hyphal sheaths, without incrustation, tips
acute.
Hyphidia present, not numerous, hyaline or yellowish, cylindrical or
slightly conical, 2.3-3 wm in diam, thin-walled, without incrustation; cystidia
absent; basidioles present, 6-10 x 3.5-4, without incrustation; basidia clavate or
subclavate, 12-18 x 4-5 ym; sterigmata 4, 3.5-5 m long; spores ellipsoid, (3.5-
)4-5 x 2.4-3.2(-3.5) wm.
DISTRIBUTION IN N. AMERICA. Not yet found.
DISTRIBUTION ELSEWHERE. Mesoamerica: Costa Rica, El Salvador; Car-
ibbean: Cuba, Jamaica, Puerto Rico; South America: Brazil, Colombia, Ecuador,
Juan Fernandez Is., Venezuela; Asia-Temperate: Japan; Australasia: Australia, New
Zealand. - On dead frondose wood (Nectandra sp., Nothofagus sp.), on bark of dead
branches or leaf bases of palmae (Rhopalostylis sapida) and on unknown frondose
substrata.
TYPES STUDIED. H. unicolor: Cuba, C. Wright 541 (K). H. fuliginosa: Cuba,
C. Wright 188 (K).
REMARKS. Thick specimens of H. unicolor are externally very similar to
H. cervina and H. jobii which differ in large setae (55-110 x 7-15 wm) and dif-
ferent spore size (4.5-5.5 x 2.2-3.2 um in H. jobii, 5-7.5 x 3.5-4.3 mp in H.
cervina). Misidentifications. Most specimens filed under the name H. unicolor
in herbaria belong to H. cinnamomea ssp. spreta; however, Massee (1890:
108) indicated H. spreta as a synonym of H. unicolor. This misinterpretation
has been followed by several authors of “floristic” lists.
172
DUBIOUS SPECIES
31. Hymenochaete episphaeria (Schwein.: Fr.) Massee
Massee, J. Linn. Soc. Bot. 27: 111 (1890); Burt, Ann. Missouri Bot. Gard. 5:
302-91 28 4 1918))DeFigio, Lax. s anal 9,6 f.7 19, plet) 1.) boa" (1910) tegen.
Hymenochaete 132, f. 41 (1998). - Thelephora episphaeria Schwein. in Fr., Elench.
fung. 1: 225 (1828).
Basidiome effused, closely adnate, coriaceous to hard when dry, 80-120
um thick, 2-5 x 1-2 cm; margin thin. Hymenium smooth, azonate, irregularly
cracked, orange, yellowish or golden brown or brown (yellowish brown, light
brown to brown; Ridgway: Buckhorn-brown to Tawny olive or Verona
brown), sometimes with olive tint; margin indeterminate, concolorous with
hymenium or lighter coloured.
Tomentum and hyphal layer absent; context composed of cortex and a setal
layer, or setal layer only; setal layer present as a layer of hyphae with scattered
setae in all levels of it; dark line above the hymenium absent.
Cortex 30-40 ym thick; hyphae very compactly interwoven (cemented),
with thick brown walls.
Hyphal system monomitic; setal hyphae absent; generative hyphae 2.5-4
vm in diam, red-brown, thick-walled; in context and hymenium crystalline
matter absent.
Setal layer 70-110 ym thick; setae numerous, 60-90(-110) x 7-12(-14) um,
projecting to 50 um, subulate to fusiform, with almost blunt tip, straight, naked
or enmeshed in hyphal sheaths, encrusted with amorphous granules or crystals
in upper part.
Hyphidia absent or not numerous to numerous, cylindrical or slightly coni-
cal, to 3 wm in diam, thin-walled, without incrustation; cystidia absent; basidia
subclavate or (sub)utriform, 15-21 x 3.5-4(-6) um; sterigmata 4; spores cylin-
drical or ellipsoid, 4-6.5 x 1.5-2.2 um. (Description based on the literature data
cited above.)
SUBSTRATE IN N. AMERICA. Diatrype sp. (Fungi, Ascomycetes).
DISTRIBUTION IN N. AMERICA. MEXICO: VC (Orizaba, J.G. Smith 571,
BPI 278133; see remark below). USA: PA (type specimen, see below).
TYPES STUDIED. Thelephora episphaeria: USA, Pennsylvania, Bethelem, in
Diatrype, Schweinitz (PH, holotype; BPI, isotype).
REMARKS. The type is up to 100 pm thick, effused, closely adnate.
Hyphal system monomitic; generative hyphae 2.5-4 um in diam, with thickened
or thick walls, sparsely branched, septate. Setae broadly conical, with obtuse
tip, 45-70 x 10-15 um. No cystidia or hyphidia; basidia not developed, no
spores.
The type of this species is sterile, as well as most other specimens identi-
fied as this species and studied later by Léger (1998: 132) or by me. DeFigio
(1970) and Léger (1998) described a cortex present in this species; in the
specimens studied by me, this layer may be called a hyphal layer. DeFigio
described the species as having urniform basidia with thickened at the base
walls and spores 6.0-8.5 x 2.5-3.5 ym; these characteristics have not been
mentioned by other authors.
173
The identity of this dubious species is unknown; it is possible that its type
and several specimens described under this name are a young state of H. corru-
gata. The other specimens studied by me are possibly young or/and sterile
states of following species:
H. cervina (? H. jobii): New York, McLean, the Lloyd-Cornell Preserve, 5 Sep
1952 J.A. Stevenson & M. O'Brien (BPI 278134).
H. cinnamomea ssp. spreta: NY, Albany, Castanea dentata, Oct 1907 C.G. Lloyd
7120 and 44562 (BPI 278135 and 330868); Vermont, Middlebury, Oct 1907 C.G.
Lloyd 7221 and 20605 (BPI 278126 and 330867); Wisconsin, LaCrosse Co, Gundersen
Arboretum, 21 Sep 1979 W.B. & V.G. Cooke 57561 (BPI 299846).
H. corrugata: MA, Weston, A.B. Seymour (MOBG 18358 / BPI 0278130); [PA,
Trexlertown ?] Dr. Herbst (Lloyd 20601, BPI 330866); OH, Cincinnati, A.P. & L.V.
Morgan (BPI 278132).
H. rhabarbarina (?): LA, St. Martinsville, on living cypress tree, 20 Jun 1914
G.J. Humphrey 2516 (BPI 278128).
H. tenuis: TN, Memphis, 18 Feb 1914 C.L. Shear (BPI 278127).
A specimen named as H. episphaeria has well developed basidia and
spores 5-6(-7) x 1.5 um, slightly allantoid: Mexico, Orizaba, J.G. Smith 571
(BPI 278133). This specimen has brownish basidia with slightly thickened on
base walls; possibly the description of basidia by DeFigio (1970: 56) is based
on it. Identity of this collection is unknown.
32. Hymenochaete opaca Burt
Burt, Ann. Missouri Bot. Gard. 5: 364 (1918); Reeves & Welden, Mycologia 59:
1046 (1967); DeFigio, Tax. anal. 57 (1970); Léger, Hymenochaete 205, f. 76 (1998).
Basidiome effused, closely adnate, 100-300 um thick; hymenium smooth,
azonate, sometimes irregularly cracked, brown or dark brown, without olive or
lilac tint; margin thin, abrupt, concolorous with hymenium or lighter coloured.
Tomentum and cortex absent; context composed of setal layer of overlap-
ping rows of setae only; dark line above the hymenium absent.
Hyphal system monomitic; setal hyphae absent; generative hyphae 2-3 um
in diam, yellowish to brownish, septate, branched.
Setal layer 100-300 um thick; setae numerous, (60-)70-90 x (7-)8-11 um,
projecting to 65 ym, fusiform, straight, encrusted in uppermost part with small
crystals.
Hyphidia and cystidia absent; basidia 15-18 x 3.5 um; spores cylindrical,
slightly curved, 5.5-7(-7.5) x 2-2.2(-2.5) um. (Description adopted from the
book by Léger, 1998.)
DISTRIBUTION IN N. AMERICA. Mentioned from AL, FL, LA and Mexico
by. Reeves & Welden (1967: 1047), but presumably erroneously (Léger, 1998: 205-
207).
DISTRIBUTION ELSEWHERE. Caribbean: Jamaica.
REMARKS. A doubtful species, possibly closely related to H. jobii or H.
tenuis.
174
ACKNOWLEDGEMENTS
I am much indebted to my colleagues for help by supplying data, literature
and specimens, and for encoura ng. my study: to Drs. M. Blackwell, H.H
Burdsall, Jr., R.L. Gilbertson, J. H. Ginns, A. Greslebin, G. Guzman, R.
Halling, D.J. Job, J.C. Krug, J.-C. Léger, R.H. Petersen, M. Rajchenberg, A.
Rossman, L. Ryvarden and G. Samuels. Curators of the following Havoatia
kindly loaned specimens for this study: BPI, CFMR, FH, GB, H, K, LA, LE,
NY, NYS, O, PC, PDD, S, TENN, TRTC, TUR, UPS, XAL. M.J. Dallwitz
has given me the possibility to use the program DELTA since 1988 already.
The study has been granted by the Hesler Endowment Fund (Knoxville), Open
Estonia Foundation and Estonian Science Foundation (Grant no. 2145). The
Royal Society, London, Swedish Academy of Sciences and Swedish Institute
(Stockholm) supported my studies in Kew and in Swedish herbaria. I am
grateful to J.H. Ginns for revising the English of the manuscript.
LITERATURE
Banker, H.J. 1914. Type studies in the Hydnaceae - VII. The genera Asterodon and
Hydnochaete. Mycologia 6 (5): 231-234.
Boidin, J. 1958. Essai biotaxonomique sur les Hydnés résupinés et les Corticiés. Rev.
Mycol., Mém. hors-sér. 6: 1-387.
Boidin, J. & Lanquetin, P. 1984. Répertoire des données utiles pour effectuer les tests
d’intercompatibilité chez les Basidiomycétes. III. - Aphyllophorales non porées.
Cryptogamie, Mycol. 5: 193-245.
Brown, H.P. 1915. A timber rot accompanying Hymenochaete rubiginosa (Schrad.)
Lév. Mycologia 7 (1): 149-151.
Burt, E.A. 1918. The Thelephoraceae of North America. X. Hymenochaete. Ann. Mis-
souri Bot. Gard. 5: 301-372, 17 pl.
Burt, E.A. 1924. The Thelephoraceae of North America. XIII. Ann. Missouri Bot.
Gard. 11: 1-36, 1 pl.
Chamuris, G.P. 1988. The non-stipitate stereoid fungi in the northeastern United States
and adjacent Canada. Mycologia Memoir 14: 1-247.
Coker, W.C. 1921. Notes on the Thelephoraceae of North Carolina. J. Elisha Mitchell
Sci. Soc. 36 (3 & 4): 146-196, pl. 30-35.
Corner, E.J.H. 1948. Asterodon, a clue to the morphology of fungus fruit-bodies: with
notes on Asterostroma and Asterostromella. Trans. Brit. mycol. Soc. 31: 234-245.
Cunningham, G.H. 1963. The Thelephoraceae of Australia and New Zealand. New
Zeal. Dept. Sci. Agr. Res. Bull. 145: 1-359.
Dallwitz, M.J. 1980. A general system for coding taxonomic descriptions. Taxon 29
(1): 41-46.
Dallwitz, M.J., Paine, T.A. & Zurcher, E.J. 1993. User’s guide to the DELTA
system: a general system for processing taxonomic descriptions. 4th ed.
[See: http://biodiversity.uno.edu/delta]
Davidson, R.W., Campbell, W.A. & Vaughn, D.B. 1942. Fungi causing decay of
living oaks in the eastern United States and their cultural identification. USDA
Tech. Bull. 785. Washington, D.C. 65 pp + 3 pl.
DeFigio, D.A. 1970. A taxonomic analysis of the corticate species of the genus Hyme-
nochaete. A dissertation ... of Doctor of Philosophy, Illinois State University.
University Microfilms, Ann Arbor. 204 pp.
Doidge, E.M. 1950. The South African fungi and lichens. Bothalia 5: 1-1094.
Donk, M.A. 1931. Revisie van de Nederlandse Heterobasidiomycetae (uitgez.
Uredinales en Ustilaginales) en Homobasidiomycetae-Aphyllophoraceae. Deel I.
Meded. Nederl. Mycol. Vereeniging 19-20: 65-200.
Donk, M.A. 1948. Notes on Malesian fungi. I. Bull. Bot. Gdns. Buitenzorg I 17 (4):
473-483.
LD
_ Escobar, G.A. 1978. Contributions towards a monograph of the Neotropical species of
Hymenochaete. A dissertation ... of Doctor of Philosophy, University of Washing-
ton. University Microfilms, Ann Arbor. 227 pp.
Farr, D.F., Bills, G.F., Chamuris, G.P. & Rossman, A. 1989. Fungi on plants and
plant products in the United States. APS Press, St. Paul. 1252 pp.
Fiasson, J.-L. 1982. Distribution of styrylpyrones in the basidiocarps of various
Hymenochaetaceae. Bioch. System. Ecol. 10 (4): 289-296.
Fiasson, J.-L. & Niemela, T. 1984. The Hymenochaetales: a revision of European
poroid taxa. Karstenia 24: 14-28.
Gilbertson, R.L. & Bigelow, D.M. 1998. Annotated checklist of wood-rotting Basidi-
omycetes of the Sky Islands in southeastern Arizona. J. Arizona-Nevada Ac. Sci.
31 (1): 13-36.
Gilbertson, R.L. & Lindsey, J.P. 1978. Basidiomycetes that decay junipers in Arizona.
Il. Great Basin Naturalist 38 (1): 42-48.
Ginns, J.H. 1986. Compendium of plant disease and decay fungi in Canada 1960-1980.
Agriculture Canada, Ottawa. 416 pp.
Ginns, J.H. & Lefebvre, M.N.L. 1993. Lignicolous corticioid fungi (Basidiomycota) of
North America. Mycol. Memoir 19: V + 1-247.
Graves, A.H. 1914. Parasitism in Hymenochaete agglutinans. Mycologia 6 (6): 279-
284, pl. 145.
Guzman, G. 1972. Macromicetos Mexicanos en el herbario The National Fungus
Collections de E.U.A. Bol. Soc. Bot. México 32: 31-55.
Hollis, S. & Brummitt, R.K. 1992. World geographical scheme for recording plant dis-
tributions. Plant Taxonomic Database Standards No. 2. Version 1.0, January 1992.
Hunt Institute for Botanical Documentation, Pittsburgh. 105 pp.
Holmgren P.K., Holmgren N.H. and Barnett L.C. (eds.) 1990. Index Herbariorum.
Part I: The herbaria of the World. 8th ed. New York Botanical Garden, Bronx,
NY. 693 pp.
Jahn, H. 1971. Stereoide Pilze in Europa. Westf. Pilzbr. 8: 69-176.
Job, D.J. 1986. Cultural and cytological studies in the genus Hymenochaete Lév. Myco-
taxon 24: 223-235.
Job, D.J. 1990. Le genre Hymenochaete dans les zones tempérées de I'hemisphére sud.
Mycol. Helvet. 4 (1): 1-51.
Job, D.J. & Keller, J. 1988. Morphology and cultural studies of Hymenochaete
attenuata. Mycol. Helvet. 3: 99-110.
Jiilich, W. 1982 (“1981”). Higher taxa of Basidiomycetes. Bibliotheca Mycologica 85:
1-485.
Jung, H.S. 1987. Wood-rotting Aphyllophorales of the southern Appalachian spruce-fir
forest. Bibliotheca Mycologica 119: 1-260.
Kartesz, J.T. 1994. A synonymized checklist of vascular flora of the United States,
Canada, and Greenland. 2nd ed. Vol. 1 - Checklist. Timber Press, Portland,
Oregon. 622 pp.
Knudsen, H. 1995. Taxonomy of the basidiomycetes in Nordic Macromycetes. Symb.
Bot. Ups. 30 (3): 169-208.
Knudsen, H., Hallenberg, N. & Mukhin, V.A. 1993. A comparison of wood-inhabiting
basidiomycetes from three valleys in Greenland. - Arctic and alpine Mycology 3.
Bibliotheca Mycologica 150: 133-145.
Kornerup, A. & Wanscher, J.H. 1967. Methuen handbook of colour. 2nd ed. Methuen
& Co, London. 243 pp., 30 pl.
Léger, J.C. 1990. Etude critique et validation des espéces nouvelles d’Hyme-
nochaetaceae décrites par G.A. Escobar. Cryptogamie, Mycol. 11 (4): 289-312.
Léger, J.-C. 1998. Le genre Hymenochaete Léveillé. Bibliotheca Mycologica 171: 1-
S19:
Léger, J.C. & Lanquetin, P. 1987. Basidiomycétes Aphyllophorales de l’ile de la Réun-
ion. VII (1) - Le genre Hymenochaete Lév. Bull. Soc. Mycol. France 103: 19-53.
176
Léger, J.C. & Lanquetin, P. 1989. Premier Hymenochaete hétérothalle bipolaire: H.
boidinii nov. sp. (Basidiomycetes Aphyllophorales). Cryptogamie, Mycol. 10: 321-
330.
Léger, J.C. & Lanquetin, P. 1996. Contribution a |'étude des charactéres culturaux
chez les Hymenochaetaceae (Basidiomycotina). Cryptogamie, Mycol. 17: 105-121.
Lindblad, I. & Ryvarden, L. 1999. Studies in neotropical polypores 3. New and
interesting Basidiomycetes (Poriales) from Costa Rica. Mycotaxon 71: 335-359.
Lowe, D.P. 1977. Check list and host index of bacteria, fungi and mistletoes of British
Columbia. Canadian Forestry Service, Victoria. Report BC-X-32. (Cited after
Ginns, 1986.)
Maas Geesteranus, R.A. 1974. Studies in the genera Irpex and Steccherinum.
Persoonia 7 (4): 443-581.
Marmojelo, J.G., Castillo, J. & Guzman, G. 1981. Descripcién de especies de
Teleforaceos poco conocidas en México. Bol. Soc. Mex. Micol. 15: 9-66.
Massee, G. 1890. A monograph of the Thelephoreae. - Part II. J. Linn. Soc. Bot. 27:
95-205.
Morgan, A.P. 1887. The mycological flora of the Miami Valley, O. J. Cincinnati Soc.
Nat. Hist. 10: 188-202.
Munsell book of color. 1942. Munsell Color Co., Inc., Baltimore.
Niemela, T. 1985. Mycoflora of Poste-de-la-Baleine, northern Québec. Polypores and
Hymenochaetales. Naturaliste Can. 112: 445-472.
Nobles, M.K. 1948. Studies in forest Pathology VI. Identification of wood- -rotting
fungi. Can. J. Res. C 26: 281-431.
Nobles, M.K. 1965. Identification of cultures of wood-inhabiting Hymenomycetes.
Can. J. Bot. 43: 1097-1139.
Oberwinkler, F. 1977. Das neue System der Basidiomyceten. Jn: Frey, W., Hurka, H.
& Oberwinkler, F. (eds.), Beitrage zur Biologie der niederen Pflanzen. G.
Fischer, Stuttgart, p. 59-105.
Overholts, L.O. 1924. Mycological notes for 1921-1922. Mycologia 16 (5): 233-239.
Parmasto, E. 1970. The Lachnocladiaceae of the Soviet Union. With a key to boreal
species. Tartu. 168 pp.
Parmasto, E. 1995. The genus Hymenochaete (Hymenomycetes): Infrageneric classi-
fication and satellite genera. Documents Mycologiques 25 (98-100): 305-315.
Parmasto, E. 2001. New taxa and two new combinations in hymenochaetoid fungi
(Hymenomycetes). Folia Cryptog. Estonica 37: 55-66.
Parmasto, E. & Parmasto, I. 1979. The xanthochroic reaction in Aphyllophorales.
Mycotaxon 8 (1): 201-232.
Patouillard, N. 1900. Essai taxonomique sur les familles et les genres des Hyménomy-
cétes. Lons-Le-Saunier. 184 pp.
Peck, C.H. 1878. Report of the botanist. Ann. Rep. N. Y. St. Mus. Nat. Hist. 30: 23-
78.
Peck, C.H. 1887. Report of the botanist. Ann. Rep. N. Y. St. Mus. Nat. Hist. 40: 39-
iD
Rayner, R.W. 1970. A mycological colour chart. CBI & BMS. 34 pp., 17 tab.
Reeves, F. & Welden, A.L. 1967. West Indian species of Hymenochaete. Mycologia
59: 1034-1049.
Ryvarden, L. 1982. The genus Hydnochaete (Hymenochaetaceae). Mycotaxon 15: 425-
447.
Ryvarden, L. 1985. Stipitochaete gen. nov. (Hymenochaetaceae, Basidiomycotina).
Trans. Br. Mycol. Soc. 85 (3): 535-539.
Welden, A.L. & Guzman, G. 1978. Lista preliminar los hongos, liquenes y
mixomicetos de las regiones de Uxapana, Coatzacoalcos, Los Tuxtlas, papaloapan
y Xalapa (parte de los estados de Veracruz y Oaxaca). Bol. Soc. Mex. Micol. 12:
59-102.
Welden, A.L., Davalos, L. & Guzman, G. 1979. Segunda lista de los hongos, liquenes
y mixomicetos de las regiones de Uxpanuapa, Coatzacoalcos, Los Tuxtlas, Papa-
loapan y Xalapa (Mexico). Bol. Soc. Mex. Micol. 13: 151-161.
MYCOTAXON
Volume LXXIX, pp. 177-179 July-September 2001
SCUTELLINIA SINENSIS IN EUROPE
STANISLAV GLEJDURA
Forestry and Wood Woorking Museum
nam. SNP 25, SK-960 01 Zvolen, Slovakia
Abstract Five Slovak collections were identified as Scutellinia sinensis, recently
described from China and known previously only from type collection. Additional data to
enhance the original description are presented.
Key words Pezizales, China, Slovakia, new collections
MATERIAL AND METODS
Apothecial morphology and measurements are based on fresh material. Herbarium
specimens were rehydrated in distilled water for 3 hours and subsequently in 8% amonia
solution for one hour. Hand-cut sections were mounted in distilled water, Melzer's
Reagent, and Cotton Blue solution in lactic acid. Measurements of the ascospores, asci
and paraphyses were taken from material mounted in water.
All collections studied are deposited in the herbarium of the Forestry and Wood Working
Museum, Zvolen (,,ZVM*“) and in the herbarium of the Institute of Botany, Bratislava
(SAV).
Scutellinia sinensis M. H. Liu, Acta Mycol. Sinica 15: 98, 1996.
Apothecia 1-2.2 mm diam., sessile, patelliform, hymenium plane, red to brownish-red
when fresh. Receptacle with stiff, yellowish-brown to rustbrown rooting hairs. Marginal
hairs not significantly differing from receptacular hairs, erect, straight or slightly curved,
occasionally ap[ically forked, pointed at the apices, ventricose or gradually extended
below, with simple or bi- to tri-furcate base, 2-11 septate, 135-650 um long (-840 um in
ZVM 885) and 25-40.5 um thick (-92 um in ZVM 1572), with walls 2.5-5.6 tm thick.
Receptacular hairs shorter. In between the marginal hairs short superficial hairs, pointed
or rounded at the top, were rarely observed. Asci 8-spored, operculate, cylindrical with
short attenuated base, 95-214 x 15-27 um, pleurorhynchous. Ascospores globose or
subglobose, 15.8-18.4 um, with one large oil guttule, occasionally with de Bary bubbles,
ornamented. Spore wall with both large, hemisphaerical or ovoid tubercules 2-4.5 um
high, 2.5-5.6 tum across, and small, rounded or irregular warts 0.3-1 um high, 0.3-1.5
across. The outermost spore wall not separating in heated lactic acid. Paraphyses
filiform, septate, enlarged at the apex to 7-12 um.
SPECIMENS EXAMINED: China, Suiyang, Guizou, Liu Mei Hua, 1.VIII.1984 (isotype, SAV):
Slovakia, Zvolen, Arborétum Borova Hora, under Sorbus aucuparia on humus soil in the grass,
178
alt. 325 m, Glejdura, 28.VII.1997 (ZVM 884); Bratislava, Island Sihot’, floodplain forest, on
deposited soil, alt. 137 m, Janéoviéova & Glejdura, 20.VIII.1997 (ZVM 885; Jancovicova,
2000); Zvolen, Arborétum Borova Hora, under Carpinus betulus, on deposited soil, alt. 305 m,
Glejdura, 22. VIII.1997 (ZVM 887); Kovaéova, distr. Zvolen, under Petasites sp., on rich humus
soil, alt. 380 m, Glejdura, 12.[X.1999 (ZVM 1425); Kovacova, under Populus tremula, on
deposited soil, alt. 360 m, Glejdura, 13. VIII.1999 (ZVM 1572).
F
Scutellinia sinensis. Ascospores (bar = 10 um): A (ZVM 885), B (ZVM 884), C (SAV,
isotype). Marginal hairs (bar = 100 um): D (ZVM 884), E (ZVM 1572), F (SAV,
isotype). Superficial hairs (bar = 100 um): G (1572), H (SAV, isotype).
Examination of the isotype of Scutellinia sinesis, which has two pieces of two premature
apothecia (no “free” ascospores observed) showed few discrepances from the original
description and drawings. Liu (1996) illustrated only one type of tubercules on spore
wall. But both the isotype and the Slovak collections, in addition to large tubercules,
have spores with, in addition, small mostly irregular warts. the drawings of hairs in this
paper fits the shape better than those in the original illustration.
Some differences were obsereved in the size of hairs and asci. Hairs of the isotype are
slightly thicker (32-54 tm) than in the Slovak specimens (25-40.5 um). On the other
hand the asci in the type collection are narrower (14 -21 um) than in Slovak collections
(15-27 um). These differences are within the variability of characters and have no
apparent taxonomic significance.
Minute apothecia, relativelly small globose ascospores with large hemisphaerical
tubercules interspersed with small warts, and medium sized, not clearly differentiated
hairs, are the most distinctive characters of S. sinensis. As suggested by Liu (1996) the
179
species seems to be closely related to Scutellinia citrina (Massee) Y. J. Yao & Spooner
(1995) [= S. paludicola (Boud.) Le Gal] that differs in larger ascospores with smaller
tubercules and shorter hairs.
ACKNOWLEDGEMENTS
I thank Drs. Richard P. Korf (Cornell University, Ithaca, USA) and Pavel Lizon (Institute of
Botany, Bratislava, Slovakia) for critical reading of the draft manuscript and presubmision
review. Drs. Wen-Ying Zhuang (Institute of Microbiology, Being, China) and Mei-Hua Liu
(Public health & antiepidemic station, Anshun, China) kindly donated the isotype.
REFERENCES
Janéoviéova, S. 2000. Ekologicka charakteristika hub luznych lesov Sedlackovho ostrova a
ostrova Sihot (Podunajska nizina) [Ecological characteristics of the fungi of flood-plain forests of
the islands Sedla¢tkov ostrov and Sihot? (Podunajska nizina lowland)]. P. [1]-185, PhD thesis,
Faculty of Natural History, Komensky University, Bratislava, ms.
Liu, M.-H. 1996. Scutellinia sinensis, a new sphaerical-spored species of Scutellinia. Acta Mycol.
Sinica 15: 101-104.
Yao, Y.-J., & B. M. Spooner. 1995. New combinations in Melastiza and Scutellinia (Pezizales).
Mycotaxon 53: 467-477.
ie oy A) as
bit ene ae ea, ew
ba Cin
i t,
a> a
ne
Sie 4 alah ie he
: : b E : ei Me +
‘ ; ee ; < t ie ef
( MOE MEINE Cs
y ra Aa ¥ . ai ' 7 )
RAF PS xaeadeg es ir Wr ie Pe a vinigita Tasty
4/9 We ome ane CL PR ie i. t [ebeutwe I wi val gris sl
ROMY Nett a feos oom ae hoe fbb inet, i spo re begin
te
ame | . Wie es Lay ¥
ty RE QUO S61 Nag id Reap tet eas dh a
* ae SOUL ty RL De ahi Lr = \ i Pie vi tia > Bid at Eye
: ; ¢ ’ ' ant © u
iG, are ee ig Pe, ee - ae vite 4
Vise i LA, on, i - . (lanl i seem ones soy yee jee Be: Ae a“ a a - ;
Be mee OSes Bie Atv, Voy eo CRY eee Re mn He ia ef a A ' tha
a Eat , ee rile mm dy Veeee ¥ As Rees & ur
Reet el rome ar aah Marre uta eeu Wane ey ia
ane yA Ones ‘I Br ates rae hae ve Peco a
‘ ; . ,
= ‘1 ra’ ,
7% i ' / . F , We 4 oy
. 3 ' 1 iP oy r ‘by : ur -
, aT)
B! i { ' De eerie =:
- @ ra
1 ’ we ® A 4
| beers ty Bs a Ta ia :
y ie ¥ a }
wit as At) rE) f ae A 7A
7 : iad Md bs y Oe
4 = > i7 Pa ik
‘ v . i i em ; vis 4
i , Le
pre ae ‘ a i “%
Zz P I a ’ 4 P a Oe i J i
-) ae y — i ae
; ates ra Po) te ag t fe
é 9 ‘ { i j : sg
*» <pdcitell Pe Yaa oa
a , ‘ my
; ; a Pe v.
é er te} \ ‘ =i pa . , . }
“T{hh ys Ge rY
: pees é t me e
> i / ‘ gees? i yi , De sf Le re
A Ala t
: 7 i J i : unt . a yep f F Aled >
: é ~f na oe (Ova
at \ ;
4 iv ‘ ie i _e 4
<4 - c® nt Nia ‘ iN , De a yt Paty
pais 9 ed 5 sink ote igs patra
is {gag 3g st he? } , 7 7 7 v } ;
le vA a i J f “ 7 7 vies 7 )
’ wh, Sith ee fi) ‘ Ue an ob 4 ae ; i hae -
Vu : , a , Jp biog, 4 i 7+ ia ‘ rs iP as 4 ive i 7 ge: rv
yor J Abe if or hy Pat ms re Wes sah WG») - T Dat + NOG
F ae ‘ ' a ee eee ae cP Te We ae : as : :
Ais + pie hap «lop, MAPAN” ibe sania ahie al ka> ii reat, fe orf i
; : 4.8 A y am, 2 Pp vo re ir eee ! 7
= l “ia wal : ff \leepeaAans ius “7, er eine .
sf tye PCT Alyy SEERA ES Leek SME ae
ae bh
oo, a om Me 5 tae ;
i ib gh Ria bie Dovieye: a) his salevale pre
A a ‘. ory ae ee c Y Ae
baaag Soraya a alien, aa alee te a
I tal sta +: : . } us
f ie Pe 7 ; ne syn? Ath até ay f vis
Ak arial aah - BU eaulil Lal a.
meee EE Fi i v on were wis Ase OA
veers «4 rite » f 7:
Baers awe premec twhiaer
¥
{ P Wisin ska (oy an i al a
n v a if ares aan i; H - he
rt ae u hi % bas. dues ah view i
4 Pan is "
a?
ae
Wha
1 :
' an
(
Fl a. ae
F
A M
MY COTAXON
Volume LXXIX, pp. 181-187 July-September 2001
TWO NEW SPECIES OF BREVICELLICIUM
AND A SURVEY OF TROPICAL AND SUBTROPICAL
SPECIES IN THE GENUS
(BASIDIOMYCOTINA, APHYLLOPHORALES)
Kurt Hjortstam
Malaregatan 12
S-441 35 Alingsas, Sweden
ABSTRACT
Two new species of Brevicellicium are described from South America
viz.: B. flavovirens typified with a specimen from Argentina and B.
udinum on Podocarpus from Brazil. Brief descriptions with distribu-
tion and a key to the species in the genus are provided.
Keywords: Corticioid fungi, South America.
BREVICELLICIUM XK. H. Larss. & Hjortstam, Mycotaxon 7:117,
1978.
Generic type: Corticium exile H. S. Jacks.
BASIDIOMES resupinate, effused, thin or slightly thickened, pruino-
se, membranous, smooth, granulose or odontioid. CORDS absent.
SUBICULUM generally thin, hyaline or whitish. HYPHAL SYSTEM
monomitic; basal hyphae distinct, with parallel walls and proportio-
nately long elements, subhymenial hyphae short, isodiametric (infla-
ted), all hyphae with clamp-connections. CYSTIDIA lacking, but glo-
boid hyphal outgrowths sometimes present. BASIDIA short, almost
clavate, but often slightly constricted, normally with four sterigmata
and with a basal clamp-connection. SPORES thin-walled or with
slight wall thickening, smooth, usually short-ellipsoid, reniform or
somewhat lacrymoid, generally few in most species, inamyloid, in-
dextrinoid and acyanophilous.
182
The genus is characterized by almost isodiametric subhymenial hyp-
hae, rather short, somewhat doliiform basidia and smooth, often su-
bangular spores with a slight wall thickening. It differs from smooth-
spored species in 7rechispora mainly by rather straight and uniform
basal hyphae, never with ampullate swellings.
Key to species
1, <Clamip-connections absentid 297. inthis. ia. ete ee permodicum
1. Clamp=connections presenti 2 021. 2ne sek hk amide cones cree, 2
2. Basidiome rather thick (100-200 um), with a thin but distinct, more
or less white subiculum, spores narrowly ellipsoid 5-6 x 2.5-2.75
PUTTS ay a oe ra et ig EEC eee cee te eee udinum
2. Basidiome lacking a distinct subiculum, spores subangular, ellip-
Soid of allantoid 2.lc icone eee coc otc cne euts ccs teieraere ae ety peemee 3
3. Spores reniform to allantoid, 4 x 1.5-1.75 pm.......... allantosporum
3 Lopores differentlysshaped niceties cress ee ee eres 4
4. Hymenophores smooth or very slightly verrucose................ Ne ear: 5
4. Hymenophores distinctly grandinioid or odontioid...................:006 7
5. Subhymenial hyphae with small hook-like protuberances, spores 4-
ASS x35 iitmes. CP aa, Gene a sseeeee eae uncinatum
5. Subhymenial hyphae smooth, without such protuberances............. 6
6. Hymenophore yellowish green, spores 4.5-5(-5.5) x 3-3.5 um
RTM eT OY aides oni einer ce, YPM, Uk att ta flavovirens
6. Hymenophore whitish to cream-coloured, spores somewhat lacry-
moid:4.5-97x'2.5-3 (2305 LL eee eee eee eee exile
7. Hymenophore grandinioid, verrucae more or less globose, spores
asymmetric; about) (ml ACkOSSimis eer ese ee olivascens
7. Hymenophore densely odontioid or grandinioid, usually with short
and conicalaculentgii4 We Ah, Fee ee Sr a Pa 8
8. Spores subglobose, somewhat angular, 3.5-4 um diam............ molle
8. Spores reniform to allantoid, 4 x 1.5-1.75 um.......... allantosporum
Brevicellicium allantosporum Hjortstam & Ryvarden, Mycotaxon
12:170, 1980.
BASIDIOME resupinate, loosely adnate, odontioid, aculei small,
subulate, 0.1-0.3 mm long, whitish to greyish-white or pale ochrace-
ous. HYPHAL SYSTEM monomitic; basal hyphae thin-walled 2.5-4
um wide, subhymenial hyphae isodiametric, 7-8(-10) um
wide, all hyphae with clamp-connections. CYSTIDIA absent. BASI-
DIA 10-12 x 4 um. SPORES reniform to allantoid, thin-walled,
183
often with two oildrops in the protoplasm, 4 x (1.25-)1.5-1.75 pm.
Distribution: Known from the type-locality in Tanzania and from Bra-
zil, Colombia and recently collected by P. Roberts 356/B, K(M)
26812 from Borneo (Sabah).
Brevicellicium exile (H. S. Jacks.) K. H. Larss. & Hjortstam, Myco-
taxon 7:118, 1978.
Basionym: Corticium exile H. S. Jacks Can. J. Res. C, 28:721, 1950.
BASIDIOME resupinate, thin to moderately thin, especially when yo-
ung almost athelioid, with age sometimes moderately flocculose,
smooth or with small rounded elevations, whitish to creamish, in the
herbarium often ochraceous. HYPHAL SYSTEM monomitic; basal
hyphae thin-walled or with a slight wall thickening, uniform, subhy-
menial hyphae isodiametric, up to 10 um wide, all hyphae with clamp-
connections. CYSTIDIA absent. BASIDIA short, almost cylindrical,
12-15 x 5-7 um, with four sterigmata and a basal clamp-connection.
SPORES as a rule few in specimens, globoid, short-ellipsoid, often
with a slightly lacrymoid appearance, 4.5-5 x 2.5-3(-3.5) um.
Originally described from Canada and seems to be a rare species in
the Northern Hemisphere. Reported from Colombia (Hjortstam and
Ryvarden 1997) and from the Canary Islands (Ryvarden 1976).
Brevicellicium flavovirens Hjortstam nov. sp. Fig. 1 E-G
Basidioma resupinatum, arcte adnatum, continuum, membranaceum,
leve vel leniter tuberculatum. Color flavovirens vel ravum. Systema
hyphale monomiticum; hyphae basales tenuitunicatae, rectae; parieti-
bus fere parallelis, usque ad 4 yum latis; hyphae subhymeniales plus
minus indistinctae; cellulis brevibus; hyphae omnes fibulatae. Basidia
subclavata, brevia, plus minus doliiformia, 10-12 x 5-6 um, 4 sterig-
matibus. Sporae ellipsoideae, tenuitunicatae, leves, paucae, 4.5-5(-
5.5) x 3-3.5 um
Holotype: Argentina, prov. Misiones, Iguazu Nat. Park, on deciduous
wood, 1-5 March 1982, L. Ryvarden 20086 K(M) 80082.
Paratypes: Brazil, Sao Paulo, Cananeia, Ilha do Cardoso, 2-5 Feb.
1987, Ryvarden 24872 (GB); Bahia, leg. Thomas Laessge 53195 (K)
BASIDIOME resupinate, closely adnate, continuous, membranous,
smooth or slightly tuberculate, yellowish green. HYPHAL SYSTEM
184
monomitic; basal hyphae few, straight and uniform, hyaline, 2.5-4 um
wide, subhymenial hyphae indistinct, isodiametric, 4-7 um wide, for-
ming a rather dense tissue; all hyphae with clamp-connections. CYS-
TIDIA absent. BASIDIA short-clavate, more or less doliiform, 10-12
x 5-6 pm, with four sterigmata and a basal clamp-connection. SPO-
RES few, broadly ellipsoid, smooth, thin-walled, 4.5-5(-5.5) x 3-3.5
um, adaxial side convex but frequently slightly depressed near the
apex.
This species is closely related to B. exile, but the latter is thinner, dif-
ferently coloured white or grey, and has ellipsoid or slightly lacrymoid
spores.
Brevicellicium mellinum (Bres.) Hjortstam & Ryvarden, Mycotaxon
10:269, 1980. Corticium mellinum Bres., Annls mycol. (Berlin) 18:47,
1920.
According to K. H. Larsson (thesis 1992) this is a species of 7rechis-
pora P. Karst.
Brevicellicium molle Hjortstam & Ryvarden Mycotaxon, 12:170,
1980.
BASIDIOME resupinate, loosely adnate, at first composed of thin
threads, then continuous and slightly grandinioid with small, more or
less globose verrucae. HYPHAL SYSTEM monomitic; basal hyphae
straight and uniform, up to 4 um wide, subhymenial hyphal elements
isodiametric, 7-8 um wide, all hyphae with clamp-connections. CYS-
TIDIA lacking, but occasionally with protruding hyphal in the basidial
layer. BASIDIA short-clavate, about 10 x 6 um, with four sterigmata
and a basal clamp-connection. SPORES subglobose, subangular, thin-
walled, smooth, 3.5-4 um diam.
Distribution: Tanzania (type-locality), Colombia on wood and Brazil
on Dicksonia sp.
Brevicellicium olivascens (Bres.) K. H. Larss. & Hjortstam, Myco-
taxon 7:119, 1978. Odontia olivascens Bres., Fungi Trid. 2:36, 1898.
BASIDIOME resupinate, closely adnate, thin to moderately thick,
normally grandinioid, more or less ceraceous when fresh, when dried
almost membraneous, cream, sometimes yellowish or even sulphure-
ous. HYPHAL SYSTEM monomitic; basal hyphae uniform,
185
thin to moderately thick-walled, 3-3.5(-4) um wide, subhymenial hyp-
hae short-celled, typically isodiametric, 5-10 um wide, all hyphae with
clamp-connections. CYSTIDIA absent, but globoid hyphal outgrowths
present, normally 5-10 um wide. BASIDIA short-cylindric, 12-20 x 7
um, with a slight median constriction, with four sterigmata and a basal
clamp-connection. SPORES with a rhomboid appearance, hyaline and
smooth, thin-walled, usually with one or several oil-drops in the pro-
toplasm, approximately 5 um diam.
Distribution: Known at least from Argentina, Brazil and Venezuela in
South America, also from the Canary Islands and additionally from
Burundi and India.
Brevicellicium permodicum (H. S. Jacks.) Ginns & Lefebvre, Mycol.
Mem. 19:31, 1993. Corticium permodicum H. S. Jacks. Can. J. Res. C
2872 VUN950:
This species lacks clamp-connections and was originally compared
with Corticium exile. It fits somewhat within the generic description
of Brevicellicium by its subhymenial hyphae and the appearance of its
spores. It is known from three specimens in Canada and was reported
from New Zealand by Cunningham (1963), but no specimens have
been examined.
Brevicellicium udinum Hjortstam nov. sp. Fig. 1 A-D
Basidioma resupinatum, arcte adnatum, continuum, membranaceum,
leviter rimosum, leve vel interdum modice tuberculatum. Color palli-
doluteum. Systema hyphale monomiticum; hyphae basales tenuituni-
catae, rectae, 3-3:5(-4) um latae; hyphae subhymeniales indistincte
isodiametrae, 5-6(-8) um latae; hyphae omnes fibulatae. Basidia cla-
vata, plus minus doliiformia, 16-20(-25) x 5-6 um, 4 sterigmatibus.
Sporae anguste ellipsoideae, tenuitunicatae, leves, 5-5.5(-6) x 2.5-
2.75 yam.
Holotype: Brazil, Sao Paulo, Paraiba, Campos do Jordao, Parge Esta-
dos de Campos do Jordfo, on decayed trunk of Podocarpus, in a moist
place, 8 July 1985, Hjortstam 16124 K(M) 80083
BASIDIOME resupinate, closely adnate, continuous, membranous,
cracking, 100-150(-200) um thick, smooth or moderately tuberculate,
pale yellow. HYPHAL SYSTEM monomitic; basal hyphae more or
less loosely arranged in a thin, whitish tissue, 3-3.5(-4) um wide, other
186
hyphae of variable appearance and width, some subhymenial hyphae
isodiametric and 5-6(-8) jm across, all hyphae with clamp-
connections. CYSTIDIA absent. BASIDIA clavate, somewhat dollii-
form, 15-17(-20) x 5-6 um, with four sterigmata and a basal clamp-
connection. SPORES narrowly ellipsoid, smooth, thin-walled, rather
few, 5 5.5(-6) x 2.5-2.75 um.
Brevicellicium udinum is distinguished from other species in the genus
by its rather thick basidiome with a thin, whitish subiculum and nar-
rowly ellipsoid spores, but the isodiametric subhymenial hyphae are
less conspicuous than in the generic type
Fig. 1. Brevicellicium udinum. Holotype, Hjm 16124 A) different
kind of hyphae B) inflated hyphae in the subhymenium C) basidium
D) spores. Brevicellicium flavovirens. Holotype, Ryv. 20086 E) subi-
cular hyphae F) basidia G) spores.
187
Brevicellicium uncinatum Hjortstam & Ryvarden, Mycotaxon
12:171, 1980.
BASIDIOME resupinate, effused, closely adnate, smooth or slightly
farinaceous, whitish to greyish. HYPHAL SYSTEM monomitic; basal
hyphae few, straight or widened near the septum, about 3 um wide,
subhymenial hyphae
isodiametric and sometimes up to 10 um wide, provided with unci-
form protuberances. CYSTIDIA absent. BASIDIA subglobose, 7-9 x
5-6 um, with four sterigmata. SPORES subglobose, thin-walled,
smooth, 4-4.5 x 3.5 um, with distinct apiculus.
The unciform outgrowths and small spores distinguish this species.
Known only from the type locality in Tanzania.
REFERENCES
Cunningham, G. H. 1963. The Thelephoraceae of Australia and New Zea-
land. N. Z. Dep. sci. industr. Res. Bull. 145, 359 p.
Hjortstam, K. and Ryvarden, L. 1997. Corticioid species (Basidiomycoti-
na, Aphyllophorales) from Colombia collected by Leif Ryvarden. Mycotaxon
64:229-241.
Larsson, K.H. 1992. The genus 7rechispora (Corticiaceae, Basidiomycetes).
Dep. Syst. Bot. Univ. Géteborg, Sweden.
Ryvarden, L. 1976. Studies in the Aphyllophorales of the Canary Islands. 3.
Some species from the western islands. Cuad. Bot. Canar. 26/27:29-40.
ave Npins taker TiC
r AN:
| ira red lg r ve ¥ i ihe vw
Baty say Us te =f RUONS ie Gi i
haa ae RAG. \ 7a js ary
erst ay % ‘ wh _ f ue
a(t ee a Pe Pa “a fie
: bd a ye : pice my et ne A ay ts
ee Ad P eee
Crash iri shun biasing be seh eh? Piya!
ii, sie HKU Rte OnE: Fe Wind HiAonsbron a ‘a TRA es lr eg eh pe A
FP FH ik pracsiib NERY Neviomerben ero ainsi etn dine) ‘
7 e Hi he 7 | Oe diab fot ae ae iaiuad oii HT Fe “ ? stheieryet ut 4
"on eiicer ue ate i itis aun
Be i ca a ssi lel el Se peat ct ahs
a eh ai i Vivien St dhe : i ie an eran is ca
iy Sewn
Cae achaataage aed? eo aepitnete dbewn il aes |
Bocas Ciba iad “ sinntas Tat jon oe et met elon an os
- Le al ees ua rea | at RG eRe te Urea
Ney es aed is ie ea ‘ et ; alae a
Net aed, . AL ioe Ms aie Drs } ath a hg
y be ues way y My : a ia 2:
iM “+4 + AM et i rarad nah he Dae ee f
2 tha ay Bie wpa eye cian ne
i SA oe aaa sh ae |
ia ic potnevg RAED: costae Peace Vent
Oneren wit Ric ens? ryt Xe ae
A ead |
= Pile
seni i inva rie) roe
LN ee Bonar ice aes ait ne
| Dnseth X en Dy Se ied sh aa yas eco ai eile ¥
net
i gt 1 +h i ; ve ee |
. i ay ea Ne ted As by FOREN dtr ee uri & ok v's)
i va ‘m= Pt ae hay Os ro
, i¥ A eek: ters oe file oe nN i me & a Y - : ar 1 one
i Pe, >" ofa ar My AR a? ae $8 j tis
=a A Fa E ) a. A ae f }
‘ot i Bhs ean he Dey
wer, ‘ has Ab rtehes Ty, ; x :
" Weaeie i lg
i! Tee ‘ ey = nf : Lite ae hy 9 anil
cn a ' ay e i a iA Rade bse Vise or aye
Mi re Couey A
rere Cue rary my ; Wil thé ae Teh he
Lae eS len . vy ,s r : ek ayes |
An Wires Aa , a to ”~ hd ’ y Prey ' ap? o (Se a yy Oe Pure.
my :
Al -
a nie Pr Ah Aes 7 af *
‘| 2 @ i} mit is ¢ ; - 4 fi it y (
1) 7 A Oe ee (|
a i » ‘df ; t
a , - ee
Pe (ie aye
: we ..!
MY COTAXON
Volume LXXIX, pp. 189-200 July-September 2001
CORTICIOID SPECIES
(BASIDIOMYCOTINA, APHYLLOPHORALES)
FROM COLOMBIA III
KURT HJORTSTAM
Malaregatan 12, S-441 35 Alingsas, Sweden
and
LEIF RYVARDEN
Department of Botany, University of Oslo, P.O. Box 1045,
Blindern, N-0316 Oslo, Norway
ABSTRACT
6 species are reported as new for Colombia of which Botryobasidium
botryoideum and Corneromyces kinabalui are previously not known
from South America. Athelopsis colombiensis, Radulomyces subsig-
moideus, the genus Minostroscyta typified with Minostroscyta discoi-
dalis are proposed as new taxa. The invalid generic name Mutatoder-
ma is briefly discussed and Hyphoderma brunneocontextum Galan is
considered as a substitute for Mutatoderma brunneocontextum
Gomez.
Keywords: Corticiaceae, South America.
INTRODUCTION
This is the third paper in our series on the corticoid fungi of Colombia
(Hjortstam & Ryvarden 1997, 2000). The reader is referred to Hjort-
stam & Ryvarden (1997) for details concerning the expedition in
which the collecting was undertaken. The numbers are those of Leif
Ryvarden. To avoid excessive citations of locality names, the fol-
lowing list indicates where the cited collections were made.
190
15913-16101: Magdalena province, San Lorenzo, Station Reservo,
Sierra Nevada, 2100 m, 16 —17 June 1978; 16102-16242: Magdalena
province, San Lorenzo, Refugio de la Sierra, 1800 m, 18-19 June
1978; 16243-16310: Magdalena province, San Lorenzo, Campanero,
1200 m, 20 —21 June 1978.
Symbols
* New to Colombia
! Holotype studied
LIST OF SPECIES
Athelopsis colombiensis Hjortstam & Ryvarden nov. spec. Fig. 1 A-D
Basidioma resupinatum, pelliculare, leve, albidum. Margo indis-
tinctus. Rhizomorphae absentes. Systema hyphale menomiticum, hyp-
hae basales tenuitunicatae vel leviter crassiusculae, raro incrustatae,
strictae, uniformes, 1.75-2(-3) um latae, hyphae subhymeniales tenu-
itunicatae, irregulares, hyphae omnes fibulatae. Cystidia abunda,
hyalina, leve, tenuitunicata, 25-30 x 4-6 um. Basidia fere cylindracea,
tenuitunicata, leviter constricta, 10-12 x 5 um, 4 sterigmatibus. Sporis
laevibus, hyalinis, ellipsoideis, tenuitunicatis, 5 x 2.75 um, inamyloi-
deis, indextrinoideis, acyanophilis.
Holotype: Colombia, Magdalena province, San Lorenzo, Station Re-
servo, Sierro Nevada, 1900 m, on fern, 19 June 1978, L. Ryvarden
16145 (O)
BASIDIOME resupinate, loosely adnate, pellicular. Subiculum very
thin, consisting of thin-walled or slightly thick-walled, rather straight
hyphae. MARGIN not differentiated. Cordons absent. HYMENO-
PHORE smooth, whitish, HYPHAL SYSTEM monomitic; basal hy-
phae thin to moderately thick-walled, straight and uniform, 1.75-2(-3)
uum wide, moderately branched and with distant clamp-connections,
rarely encrusted, forming a very thin subiculum. Subhymenial hyphae
thin-walled, irregular, slightly broader. All hyphae with clamp-
connections. CYSTIDIA abundant, hyaline, smooth, thin-walled or in
age with somewhat thickened wall, moderately sinuous, obtuse or
more rarely with subulate appearance, 25-30 um long and 4-6 um
wide in the middle part. BASIDIA short, almost cylindric, but some-
what pedunculate and often with a slight median constriction, 10-12 x
191
5 um, with four sterigmata and a basal clamp-connection. SPORES
smooth, rather few in the specimens, thin-walled, narrowly ellipsoid to
ellipsoid, 5 x 2.75 um, normally single, inamyloid, indextrinoid and
acyanophilous.
This species should be easily recognized by its narrow hyphae, short
nearly cylindric basidia, small spores and by the abundant cystidia. It
differs from the generic type Athelopsis glaucina (Bourd. & Galzin)
Parmasto primarily by the occurrence of cystidia.
Fig. 1. Athelopsis colombiensis. Holotype. A) Cluster of basidia and
cystidia B) Cystidia C) Basidia D) Spores (del. Ryvarden).
192
*Botryobasidium botryoideum (Overh.) Parmasto, Eesti NSV Tead.
Akad. Toim. biol., seer. 14:220, 1965. — Corticium botryoideum
Overh., Mycologia 26:510, 1934.
Specimen: 16121/B.
Never reported from tropical areas, but a rather well known species
from the Northern Hemisphere, see G. Langer (1994). |
Ceraceomyces cfr. simulans (Berk. & Broome) Hjortstam, Kew Bull.
44:312, 1989. — Corticium simulans Berk. & Broome, J. Linn. Soc.
Bot. 14:72, 1875.
Specimen: 16084.
Description of the Colombian specimen, which is similar to the holo-
type, the latter having longer spores, (5-)6-7 x 2(-2.5) um.
BASIDIOME loosely adnate and easily detached from the substratum,
at first pellicular, then membraneous, commonly wrinkled (merulioid)
and ochraceous to pale brown, margin whitish or concolorous, thin-
ning out or slightly fribrillose and now and then cordonic. HY PHAL
SYSTEM monomitic; subiculum whitish and consisting of thin-walled
or slightly thick-walled hyphae, loosely intertwined, 5(-6) um wide,
smooth and hyaline, next to the substratum often considerably wider,
6-8(-10) um across, subhyaline to pale yellowish, all hyphae with
clamp-connections. CYSTIDIA absent. BASIDIA elongate-clavate,
slightly constricted, 17-20 x 4-5 um, with four sterigmata and a basal
clamp-connection. SPORES subcylindrical to somewhat fusoid, usu-
ally slightly curved or with sigmoid appearance, most matured spores
5 x 2(-2.5) um, with a rather distinct apiculus, inamyloid, indextrinoid
and acyanophilous.
Ceraceomyces simulans is extremely similar to C. borealis (Romell) J.
Erikss. & Ryvarden, a species well known from the northern parts of
Scandinavia. The spores of the latter are in general up to 8 pm long.
Another similar species, is Leptosporomyces septentrionalis (J.
Erikss.) Krieglst. (Athelia septentrionalis J. Erikss.). This can, how-
ever, be distinguished by its basidiome which when dried is smooth
and pellicular and nearly always with a rosy tint; when fresh and fully
developed it is more or less merulioid. The spores are almost navicular
and slightly narrower, 5-6.5 x 1.5-2 um.
13
*Corneromyces kinabalui Ginns, Mycologia 68:970, 1976.
Specimen: 16070.
Described from Borneo (Sarawak) and one specimen from same lo-
cality was reported by Hjortstam, Spooner and Oldridge (1990). We
have also seen material from Ecuador, Nufies No. 304 (QO).
*Hyphoderma brunneocontextum Galan, Darwiniana 32:239, 1993.
A substitute for Mutatoderma brunneocontextum Gomez in Gomez &
Loewenbaum, Bol. Soc. Argent. Bot. 17:347, 1976. Holotype: Argen-
tina, Buenos Aires, Punta Lara, on Pouteria salicifolia, April (on the
label) 1975 Gomez 2587 (BACF 24060)! However, it should be noted
that Galan did not mention nom. nov., but in our opinion it can clearly
be interpreted as a such.
The generic name Mutatoderma (Parmasto) Gomez (Gomez &
Loewenbaum 1976) was not validly published according to the ICBN
33:2 because the basionym was omitted. Consequently, the new spe-
cies M. brunneocontextum and all combinations on page 346 in that
paper are also invalid i.e. M. mutatum, M. heterocystidium, and M.
populneum.
BASIDIOME resupinate, effused. HYMENOPHORE more or less
smooth, greyish. SUBICULUM distinct, more or less tomentous,
brownish, HYPHAL SYSTEM monomitic; subicular hyphae
brownish, thick-walled, 4-5(-6) tm wide, smooth or slightly en-
crusted, subhymenial hyphae hyaline 4-5 um wide, thin-walled to
moderately thick-walled, all hyphae with clamp connections. CYS-
TIDIA of two kinds; 1) METULOIDS rather common, thick-walled,
20-40(-50) um long, hyaline, subhyaline or pale yellowish brown. 2)
thin-walled cystidia more or less clavate, hyaline, up to 100 um long
and approximately 10-12 um wide in the middle part. BASIDIA 25-35
x 5-8 um, with four sterigmata and a basal clamp connection.
SPORES cylindric, sometimes suballantoid, (7.5-)8.5-11 (-12.5) x
(3.25-)3.5-3.75(-4.5) um, inamyloid, indextrinoid and acyanophilous.
The species should be easy to recognize by its brown and felted su-
biculum, two kinds of cystidia and relatively large and cylindric
spores. An extremely similar species is Hyphoderma variolosum Boi-
din et al. described from Africa (Central African Republic), but sepa-
rated by its lack of felted subiculum and longer spores, generally up to
194
15 um long. See further Boidin, Lanquetin and Gilles (1991). Hypho-
derma variolosum also occurs in Argentina and Colombia (Hjortstam
& Ryvarden 2000) and was reported from Taiwan by Wu (1997). Hy-
phoderma brunneocontextum has not previously been reported from
Colombia. |
*Hyphodontia gamundiae Greslebin & Rajchenberg, Mycologia
92:1159, 2000.
Specimen: 15655/B (Colombia, Cundinmarcha, Paramo, Summa Paz
3800 m.a.s.1., L. Ryvarden 7.VI.1978).
This specimen was erroneously reported as Hyphodontia wrightii by
Hjortstam and Ryvarden (1997).
*Hypochnicium punctulatum (Cooke) J. Erikss., Symb. bot. ups.
16:101, 1958. — Corticium punctulatum Cooke, Grevillea 6:132, 1878.
Specimen: 16099.
A cosmopolitan species, but variable especially with regard to the size
of the spores.
Minostroscyta Hjortstam & Ryvarden nov. gen.
Basidioma disciforme, hymenophoro levi vel subtiliter rugoso, syste-
mate hyphali dimitico, hyphis tenuitunicatis, hyalinis, fibuligeris, hyp-
his sceleticis moderate ramosis, crassitunicatis, cyanophilis, cystidiis
levibus, tenuitunicatis, basidiis clavatis, 4 sterigmatibus, sporis subfu-
siformibus, levibus, tenuitunicatis, in typo 15-18 x 4-6 um, inamyloi-
deis, indextrinoideis, acyanophilis.
Typus generis: Minostroscyta discoidalis Hjortstam & Ryvarden
Minostroscyta discoidalis Hjortstam & Ryvarden nov. spec.
Fig. 2 A-D
Basidioma disciforme, laxe adnatum, leve, subiculo byssaceo, albido,
margo leviter filamentoso, hymenophoro levi vel subtiliter rugoso,
systemate hyphali dimitico, hyphis tenuitunicatis, hyalinis, 3-4(-5) um
latis, fibuligeris, hyphis sceleticis moderate ramosis, crassitunicatis,
1.5-2 um latis, cyanophilis, cystidiis levibus, tenuitunicatis, tubulari-
bus, constrictis et sinuosis, 50-100(-120) um. Basidia clavata, 40-50{-
80) x 5-7 um, 4 sterigmatibus, sporis subfusiformibus, levibus, tenui-
tunicatis, 15-16(-18) x (4-)4.5-5(-6) um, Let errs indextrinoideis,
acyanophilis.
195
Fig. 2. Minostroscyta discoidalis. Holotype. A) Cluster of basidia and
gloeocystidia B) Gloeocystidia C) Basidia D) Spores (del. Ryvarden).
196
Fig. 3. Radulomyces subsigmoideus. Holotype. A) Cluster of basidia
and (gloeo)cystidia B) Basidia C) Spores (del. Ryvarden).
197
Holotypus: Colombia, Magdalena, Sierra Nevada de Santa Marta, Re-
serva Forestal San Lorenzo, 19 June, 1978, leg. L. Ryvarden 16081
(O).
Etymology: Minostroscyta (anagram of Scytinostroma) and discoida-
lis (orbicular).
BASIDIOMES apparently originating from bark cavities, more or less
discoid, about 1 cm diam., rather soft, that of the holotype less than 2
mm thick. SUBICULUM distinct, cottony, whitish. MARGIN coated
with short filaments, concolorous or paler than the fertile part. HY-
MENOPHORE creamy, smooth to slightly tuberculate or finely wrin-
kled. HYPHAL SYSTEM dimitic; generative hyphae thin-walled,
hyaline, 3-4(-5) um wide, with clamp-connections; skeletal hyphae
few, hyaline, moderately branching, thick-walled, 1.5-2 um wide, with
cyanophilous wall, indextrinoid and inamyloid. CYSTIDIA abundant,
smooth, arising from the subhymenial layer and forming together with
the basidia a rather dense hymenial palisade, in shape tubular, thin-
walled, constricted and sinuous, oleous, 50-100(-120) um long and
normally ca. 10 pm in the middle part, negative in sulfovanillin. BA-
SIDIA clavate, narrowing towards the base, 40-50(-80) um long and
about 5-7 um below the four sterigmata, with a basal clamp-
connection. SPORES subfusiform in face view, often with a distinct
concavity near the apiculus, smooth, thin-walled, with homogeneous
contents, 15-16(-18) x (4-)4.5-5(-6) um, inamyloid, indextrinoid,
acyanophilous.
The disciform basidiome, dimitic hyphal system with cyanophilous
skeletal hyphae, large cystidia and proportionately big and subfusi-
form spores constitute a unique combination of characteristics, which
justify both a new genus and species. It may be recognized in the field
by its small-sized basidomes living on bark, under a microscope char-
acterized chiefly by the large basidia and characteristic spores.
Radulomyces subsigmoideus Hjortstam & Ryvarden nov. spec.
Fig. 3 A-C
Basidioma resupinatum, arcte adnatum, continuum, membranaceum,
leviter rimosum. Color fere stramineus. Systema hyphale monomiti-
cum, hyphae basales tenuitunicatae vel modice crassitunicatae, hyali-
nae, 4-5 um latae; hyphae subhymeniales aliquantum irregulares;
198
hyphae omnes fibulatae. Cystidia numerosa, 80-100 x 7(-10) ym, pal-
lide lutea in KOH. Basidia primus unciformia, 50-70 x 6-8 yum, 4
sterigmatibus. Sporae fere amygdalifomes, leviter sigmoidea, tenuitu-
nicatae, leves, 12-14 x 4.5-5 um, apiculo indistincto.
Holotype: Colombia, Magdalena, Sierra Nevada de Santa Marta, Re-
serva Forestal San Lorenzo, 19 June 1978, L. Ryvarden 16093 (O).
Paratypes (O and Hym priv. herb.): 16107, 16156 (rather poor).
BASIDIOME resupinate, closely adnate, continuous, membranous,
somewhat cracking, 100(-200) um thick. HY MENOPHORE smooth,
yellowish-brown. SUBICULUM distinct, whitish to pale ochraceous.
HYPHAL SYSTEM monomitic; hyphae thin-walled to moderately
thick-walled, hyaline, about 4-5 1m wide, in the subhymenium some-
what irregular with variable width; all hyphae with clamp connections.
CYSTIDIA numerous, 80-100 um long and 7(-10) um wide in the up-
per part, often originating from the subicular layer and then reminding
of oleaginous hyphae, pale yellowish in KOH, negative in sulphova-
nillin. BASIDIA initially often with a basal hook, up to 50-70 x 6-8
um, with four sterigmata and a basal clamp-connexion. SPORES al-
most almond-shaped, with a sigmoid appearance, broader towards the
base, smooth, thin-walled, 12-14 um long and 4.5-5 um near the base,
with an indistinct apiculus, inamyloid, indextrinoid, acyanophilous.
In the morphology of the hyphal system, basidia and spores this new
species shows affinity with the type of Radulomyces (R. confluens
(Fr.:Fr.) M.P. Christ.), except that cystidia occur. The somewhat
hooked (sublateral) basidia also recall Uncobasidium Hjortstam &
Ryvarden, but in that genus the basidia are much more pronounced
with a distinct lateral hook and the clamp-connection is lacking in its
normal place, see further description and illustration of Uncobasidium
luteolum Hjortstam & Ryvarden (Hjortstam & Ryvarden 1978).
*Rogersella griseliniae (G. Cunn.) Stalpers. New Zeal. J. Bot. 23:305,
1985. — Corticium griseliniae G. Cunn., N.Z. Dept. sci. industr. Res.
Bull. 145:330, 1963. — Rogersella asperula Liberta & Navas, Can. J.
Bot. 56:1780, 1978. Holotype: Venezuela, Liberta & Navas 21-51,
ISU 1640 (ISU). — Hyphodontia griselinae (G. Cunn.) E. Langer, Bibl.
Mycol. 154:120, 1994.
Specimens: 16153, 16244.
199
Mainly due to the ornamented spores we prefer to use the generic
name Rogersella instead of Hyphodontia, see further E. Langer
(1994). It should be noted that in 16153 there are projecting out-
growths, obviously a hyphomycetous fungus, but very similar to la-
genocystidia such as in Hyphodontia alutaria (Burt) J. Erikss. It is dif-
ficult to discern the origin of these elements, but apparently they are
growing from clampless hyphae in the hymenial layer, not belonging
to R. griselinae.
*Scytinostroma galactinum (Fr.) Donk, Fungus 26:20, 1956. — Thele-
Phora galactina Fr., Acta R. Soc. Sci. Upsal. III, 1:136, 1851. — Corti-
cium galactinum (Fr.) Burt, in Moffatt Chicago Acad. Sci. Bull. 7:137,
1909.
Specimens: 16094, 16106 and probably 15951.
The known tropical distribution of S. galactinum s.\. seems to be USA
(Florida), Mexico, Hawaii, Venezuela, Brazil and Australia. It should
be noted that Boidin and Lanquetin (1987) described several ultraspe-
cies of which S. neogalactinum Boidin & Lanq. is distributed in Cen-
tral America (Guadeloupe and Martinique).
* Scytinostroma ochroleucum (Bres. & Torrend) Donk, Fungus 26:20,
1956. — Gloeocystidium ochroleucum Bres. & Torrend, Broteria Ser.
DotnLE8 519 13:
Specimen: 16200.
This seems to be a cosmopolitan species, but nowhere common. In
South America further known from Guadeloupe (Boidin & Lanquetin
1987), Argentina (Tierra del Fuego, Iguazu) and Brazil.
ACKNOWLEDGEMENT
Dr. B. Spooner, Kew Gardens, London, has acted as prereviewer and
we are grateful for his valuable comments and suggestions for im-
proving the manuscript.
References
Boidin, J. and Lanquetin, P. 1987. Le Genre Scytinostroma Donk (Basidi-
omycetes, Lachnocladiaceae). Bibl. Myc.114:1-130.
200
Boidin, J., Lanquetin, P. and Gilles G. 1991. Les Peniophoraceae de la
zone intertropicale (Basidiomycetes, Aphyllophorales). A. Especes Paleo-
tropical. Bull. Soc. Mycol. Fr. 107:91-156.
Gomez, C. E. and Loewenbaum, M. 1976. El genero Peniophora (Cooke)
Donk (Basidiomycetes-Aphyllophorales) de los alrededores de Buenos Aires.
Darwiniana 20:189-209.
Hjortstam, K. and Ryvarden, L. 1978. Notes on Corticiaceae (Basidiomy-
cetes) III. Mycotaxon 7:407-410.
Hjortstam, K. and Ryvarden, L. 1997. Corticioid species (Basidiomycoti-
na, Aphyllophorales) from Colombia collected by Leif Ryvarden. Mycotaxon
64:229-241. |
Hjortstam, K. and Ryvarden, L. 2000. Corticioid species (Basidiomyco-
tina, Aphyllophorales) from Colombia I. Mycotaxon 74:241-252.
Hjortstam, K., Spooner, B. M. and Oldridge, S. G. 1990. Some Aphyllo-
phorales and Heterobasidiomycetes from Sabah, Malaysia. Kew Bull.
45:303-322.
Langer, E. 1994. Die Gattung Hyphodontia John Eriksson. Bibl.Mycol.
154:1-298.
Langer, G. 1994. Die Gattung Botryobasidium Donk (Corticiaceae, Basidi-
omycetes). Bibl. Mycol. 158:1-459.
Wu, Sheng Hua. 1997. New species and new records of Hyphoderma (Ba-
sidiomycotina) from Taiwan. Bot. Bull. Acad. Sinica 38:63-72.
MYCOTAXON
Volume LXXIX, pp. 201-213 July-September 2001
HYPHOMYCETES FROM LEAF LITTER OF MICONIA CABUSSU IN THE
BRAZILIAN ATLANTIC RAIN FOREST
LUIS FERNANDO PASCHOLATI GUSMAO
Universidade Estadual de Feira de Santana — UEFS
Departamento de Ciéncias Bioldgicas
Caixa Postal 252, 44.03 1-460
Feira de Santana, BA, Brazil
(lgusmao@mail.uefs.br)
and
ROSELY ANA PICCOLO GRANDI
ADAUTO IVO MILANEZ
Instituto de Botanica, Segao de Micologia e Liquenologia
Caixa Postal 4005, 01061-970
Sao Paulo, SP, Brazil
ABSTRACT
55 Hyphomycetes were recorded during an inventory of microfungi associated
with leaf litter of Miconia cabussu in the Brazilian Atlantic rain forest fragment in
the State of Sao Paulo. Beltrania malaiensis, Chaetendophragmia triangularia,
Chalara cylindrosperma, C. microspora, Endophragmiella boewei, Heniscospora
coronata, Menisporopsis pirozynskii, Rhinocladiella selenoides, Selenodriella
perramosa, Selenosporella curvispora, Speiropsis scopiformis, Subulispora
longirostrata, Triramulispora gracilis and Zygosporium echinosporum were
collected for the first time in Brazil. Descriptions and comments are provided for
the aforementioned taxa.
_ Key words: microfungi, mitosporic fungi, South America, “Serra do Mar”.
INTRODUCTION
This mycological investigation was carried out in the Biological Reserve of
Paranapiacaba, situated in the Municipality of Santo André, State of Sao Paulo, Brazil
(23°46’S lat.; 46°18’W long.), with an area of 336ha (Domingos et al., 1994). The
Reserve is situated on the edge of a plateau, next to the “Serra do Mar’ Complex in a
202
Koppen system, the local climate is Cfb, with mean annual precipitation of 3381 mm, a
relative humidity of about 100% and an average annual temperature of 18°C (Struffaldi-
De Vuono, Domingos & Silveira-Lopes, 1989).
The Reserve represents a transitional region between the tropical humid and
subtropical forests, with a typical Atlantic Rain Forest vegetation, originally with high
species richness (trees, lianas and epiphytes) and complex structure (Coutinho, 1962).
The local vegetation is characterized as secondary, and is seriously affected by
atmospheric pollution from the industrial complex of Cubataéo (Strufaldi-De Vuono et
al., 1989; Leitéo Filho et al., 1993) with 23 industries, that expel into the atmosphere,
approximately 230 distinct pollutants (Domingos et al., 1994). The main ones are
fluoride gases, sulfur dioxide, nitrogen oxide, ammonia, hydrocarbons and particulate
materials (Klumpp et al., 1996).
Miconia cabussu Hoehne (Melastomataceae) is a pioneer heliophytic species and
is very frequent in Atlantic Rain Forest secondary vegetation (Medeiros, 1993). This
Species is recommended for vegetational recomposition of “Serra do Mar” region
(Bononi et al., 1989) and as a possible passive biomonitor organism (Domingos et al.,
1994).
Some work on fungal taxonomy and ecology has been performed in this Reserve
(Grandi, 1998; 1999; Grandi & Gusmao, 1996; Schoenlein-Crusius & Milanez, 1998),
but few new records for Brazilian mycota were discovered. The present work
contributes to a better knowledge of microfungal geographical distribution and species
richness associated with leaf litter of MZ cabussu, a plant that has never been studied
before in this aspect.
MATERIAL AND METHODS
Leaf litter was collected in six distinct stations of the Reserve for 1 year
(October/1995-October/1996) every two months. The leaves were washed thirty times
with sterile distilled water and then incubated in moist chambers (Harley & Waid,
1955). As the fungi developed, sporulating structures were mounted on permanent slides
with PVL resin (Trappe & Schenck, 1982) and deposited in the Herbarium “Maria
Eneyda P. Kauffmann Fidalgo” of the “Instituto de Botanica” (SP).
DESCRIPTIONS OF SPECIES
Beltrania malaiensis E. M. Wakefield, Kew Bull. 4: 204. 1931.
Setae not observed. Conidiophores arising from radially lobed basal cells, solitary or
numerous, determinate, erect, straight or flexuous, unbranched, smooth, brown at the
base and light brown at the apex, 64.5-250 X 3.5-6 um. Conidiogenous cells integrated,
terminal, poliblastic, denticulate, light brown. Separating cells oval or globose, 1-
denticulate at each end, light brown, 11.5-16.5 X 6-9.5 um. Conidia arising from the
conidiogenous cells or the separating cells, solitary, biconic, continuous, smooth, light
brown, with a hyaline transverse equatorial band, 26-37.5 X 13-22 um; apex of conidia
with a small conical appendix, smooth, pale brown, 5-10 X 2-2.5 um.
nS ee
;
:
:
203
Material examined: BRAZIL, Sao Paulo, Biological Reserve of Paranapiacaba, L.F.P.
Gusmao, 30 Dec. 1995, SP251233; L.F.P. Gusm4o, 22 Apr. 1996, SP251234.
The first record of B. malaiensis is from 1924, isolated on Dichopsis gutta in Malaya
territory (Pirozynski, 1963). Vittal & Dorai (1995) recorded this species on Eucalyptus
tereticornis from India. Our record is the third for the world and the first outside Asia.
Known distribution: Malaya (Pirozynski, 1963), India (Vittal & Dorai, 1994/1995).
The material collected in Brazil has longer separating cells and wider conidia.
This species is characterized by its conidial morphology, with a small conic apical
appendage. The other species of this genus have a longer appendage, except B. africana
Hughes, which has a small one (up to 2m). The presence of setae is a common feature
of Beltrania species, except in B. malaiensis where they are rather infrequent
(Pirozynski, 1963). Another interesting observation on the Brazilian material is the
presence of 2-6 denticles on the conidiogenous cells, a feature not previously observed
in this species. According to Pirozynski (1963) only one, or rarely two, denticles have
been observed on the type material.
Chaetendophragmia triangularia Matsush., Microfungi of the Solomon Islands and
Papua-New Guinea, Kobe, p. 12. 1971.
Conidiophores solitary, erect, unbranched, straight or flexuous, septate, fertile an apex,
light brown, 39.5-80 X 3.5-4 um. Conidiogenous cells with annellidic percurrent
proliferation; distance between annellations, 11.5-14 um. Conidia solitary, triangule to
obclavate, base truncate, apex and lateral with an appendage, smooth, 4-septate, light
brown, 27.5-32.5 X 5.5-8 um; apical appendage, subulate, hyaline, 15-30 X 1.5-2 um;
lateral appendage arising at quarter basal cell, 0-2 in number, hyaline, 23-29.5 X 1.0-
125m,
Material examined: BRAZIL, Sao Paulo, Biological Reserve of Paranapiacaba, L.F.P.
Gusmao, 04 Jul. 1996, SP251242.
Known distribution: Papua-New Guinea (Matsushima, 1971), Japan (Matsushima,
1975), Taiwan (Matsushima, 1980) and Peru (Matsushima, 1993).
The genus Chaetendophragmia was described by Matsushima from the type
species C. triangularia isolated on leaves of Castanopsis sp., in Papua-New Guinea
(Matsushima, 1971). This species was later isolated on other substrates by the same
author: Matsushima (1975, 1980, 1993). The material examined on M. cabussu has
smaller conidiophores and conidia. The isolate from Quercus glaucae (Matsushima,
1975) is more similar to the Brazilian material. Up to now, four species and one variety
are recognized in this genus. Chaetendophragmia triangularia is distinguished from
other species by the shape of conidia and the number and position of appendices .
Chalara cylindrosperma (Corda) Hughes, Can. J. Bot. 36: 747. 1958.
Conidiophores simple, erect or flexuous, septate, smooth, brown, 57.5-96.5 um long
(including phialide); conidiogenous cells phialidic, lageniform, pale brown, 32-40 um
204
long; venter ellipsoid, 12.5-15 X 5.5-7 um; collarette cylindrical, 19-21 X 2.5-3 pm;
abrupt transition between venter and collarette. Conidia solitary or on persistent
catenate, cylindrical, rounded at the apex and truncate at the base, aseptate, smooth,
hyaline, 10.5-19 X 1.5-2u1m.
Material examined: BRAZIL, Sao Paulo: Biological Reserve of Paranapiacaba, L.F.P.
Gusmao, 22 Apr. 1996, SP251247.
Known distribution: Italy (Lunghini & Quadraccia, 1991) and Austria, Canada, Czech
Republic, Cuba, United States of America, France, India, Poland, New Zealand, Great
Britain, Russian (Mercado Sierra, Holubova-Jechova & Mena Portales, 1997).
This species probably has a cosmopolitan distribution (Mercado Sierra et al.,
1997) and has been isolated from numerous substrates (Nag Raj & Kendrick, 1975;
Holubova-Jechova, 1984). The Brazilian material is similar to the specimen observed by
Nag Raj & Kendrick (1975). The morphology and dimensions of the conidiophores and
conidia are typical for this species.
Chalara microspora (Corda) Hughes, Can. J. Bot. 36: 747. 1958.
Conidiophores not produced. Phialide arising directly on vegetative hyphae or basal
cell, solitary or aggregated in a few groups, cylindrical, obclavate to lageniform, simple,
erect, smooth, pale brown, 35.5-58 um long; venter subcylindrical, 19-30 X 2.5-6 um;
collarette cylindrical, 13.5-20.5 X 1.5-2 wm; gradual transition between venter and
collarette. Conidia cylindrical with truncate ends, persistent catenate, aseptate, smooth,
hyaline, 7-14 X 1-1.5 um.
Material examined: BRAZIL, Sao Paulo, Biological Reserve of Paranapiacaba, L.F.P.
Gusmao, 13 Nov. 1995, SP251246.
Known distribution: Argentina (Arambarri, Gamundi & Bucsinszky, 1981), Czech
Republic, United States of America, Poland (Holubova-Jechova, 1984).
C. microspora has been isolated from many substrates: old members of
Hydnaceae (Basidiomycetes) and Quercus sp. (Nag Raj & Kendrick, 1975), Fraxinus
excelsior, Picea abies (Holubova-Jechova, 1984) and Nothofagus dombeyi (Arambarri
et al., 1981). The Brazilian material presents longer venter and conidia. The most
closely related species is C. austriaca (Fautr. & Camb.) Nag Raj & Kendrick; however,
in this species the conidia are smaller and the color is dark brown. The main
characteristics are the catenate conidia and the morphology of phialides. According to
Nag Raj & Kendrick (1975) the gradual transition between venter and collarette is rare
in this species, a feature observed on Brazilian material.
Endophragmiella boewei (Crane) Hughes, N. Z. Jl. Bot. 17:147. 1979.
Conidiophores solitary, simple, erect, straight or flexuous, septate, smooth, brown at
the base, light brown at apex, 134.5-291 X 4-5.5 um. Conidiogenous cells cylindrical,
integrated, monoblastic, percurrently proliferated, with constrictions at each succession
pole, light brown, 6.5-19 X 2.5-3 um. Conidia pyriform, smooth, 1-septate, distal cell
larger than proximal cell, light brown, 17-20 X 11-13 tum; truncate base of the proximal
cell, 2-2.5 um wide.
205
‘Material examined: BRAZIL, Sao Paulo, Biological Reserve of Paranapiacaba, L.F.P.
Gusmao, 23 Jan. 1996, SP251257.
Known distribution: Japan (Matsushima, 1975), United Kingdom (Sutton, 1978),
Taiwan (Matsushima, 1980), Cuba (Castafieda Ruiz, 1986), Formosa, New Caledonia,
Italy, United States of America (Mouchacca & Zucconi, 1994) and South Africa (Crous,
Seifert & Castafieda Ruiz, 1996).
Sutton (1978) mentioned that E. boewei was observed from several substrates.
The Brazilian material fits well to the descriptions provided by the literature, except for
the longer conidiophore and smaller conidiogenous cells. Mulas, Pasqualetti & Rambelli
(1993) tested the influence of seven different types of substrates on the morphology of
E. boewei and reported that there was not a great influence on the morphology. In
natural conditions, this species is characterized by the morphology of conidia and the
typical percurrent proliferation.
Henicospora coronata Sutton & Kirk, Trans. Brit. Mycol. Soc. 75: 249. 1980.
Conidiophores not observed. Conidia solitary, cylindrical, rounded at apex, closed or
opened at the base (resulted of rhexolytic detachment), with 3 dark transverse septa, the
upper two cells are divided in two delimited hyaline vacuoles and lower cells in only
one, smooth, pale brown, 18.5-25.5 X 3.5-5 uum.
Material examined: BRAZIL, Sao Paulo, Biological Reserve of Paranapiacaba, L.F.P.
Gusm4o, 22 Apr. 1996, SP251262.
Known distribution: Australia, United States of America (Hawaii), Western Samoa,
Trinidad (Kirk & Sutton, 1980), Cuba (Castafieda Ruiz & Arnold, 1985), India (Dorai &
Vittal, 1987), South Africa (Sinclair, Eicker & Morgan-Jones, 1990), New Caledonia
(Mouchacca & Zucconi, 1994).
Up to now, this species was only collected on leaf litter of Eucalyptus ssp.
(Mouchacca & Zucconi, 1994). The Brazilian material has smaller conidia than those
described in the literature and it does not always have a distinctly coronate apex, as
Sinclair et al. (1990) mentioned. The conidia are very typical of this species, mainly
because of the presence of three dark thickened transverse septa and rhexolytic
detachment.
Menisporopsis pirozynskii Varghese & Rao, Bot. Notiser 131: 215. 1978.
Conidiomata synnematous; with a prominent central seta, solitary, smooth, septate,
brown, 132-202 X 5-6.5 um. Conidiophores aggregated in parallel fascicles, ascendant
around central setae, pale brown, 60.5-148 tum (including conidiogenous cells).
Conidiogenous cells integrated, terminal, monophialidic, pale brown. Conidia
aggregated in slimy masses around apex of conidiomata, fusiform to allantoid, solitary,
0-septate, smooth, hyaline, 15.5-19 X 3-4.5 um, with 2-4 appendages at each end of
conidia; appendages with varying length, hyaline, 6-10.5 um .
Material examined: BRAZIL, Sao Paulo, Biological Reserve of Paranapiacaba, L.F.P.
Gusmao, 24 Jan. 1996, SP251265; L.F.P. GusmAo, 28 Oct. 1996, SP307229.
206
Known distribution: India, New Caledonia (Mouchacca, 1990b), Argentina (Cabello,
Cazau & Arambarri, 1993), Malaya (Matsushima, 1996) and Cuba (Castafieda, Cano &
Guarro, 1997).
The number, disposition and length of the appendages of the conidia are the
main characteristics of this species (Castafieda et al., 1997). These same authors
reported that these features are a unique configuration of M. pirozynskii. The closest
related species is M. pleiosetosa Vasant Rao & de Hoog, (Rao & de Hoog, 1986) and it
is separated by its elliptical conidia, the uniform number and the equal length of the
appendage at both poles (Castafieda et al., 1997).
Rhinocladiella selenoides (de Hoog) Onofri & Castagnola, Mycotaxon 18(2): 342.
1983.
Conidiophores straight or flexuous, septate, smooth, pale brown, 30-36.5 X 3-3.5 um.
Conidiogenous cells integrated, terminal, sympodially proliferated, denticulate;
Conidia solitary, selenoid, apiculated apex, base with plane scars, gutulate, 0-septate,
smooth, brown, 17-20.5 X 6-7um.
Material examined: BRAZIL, Sao Paulo, Biological Reserve of Paranapiacaba, L.F.P.
Gusmao, 22 May 1996, SP307237.
Known distribution: Tanzania (Pirozynski, 1972), India (Subramanian & Sudha, 1978),
Taiwan (Matsushima, 1980), Ivory Coast (Onofri & Castagnola, 1983), Australia
(Matsushima, 1989) and Ecuador and Peru (Matsushima, 1993).
The Brazilian specimen has shorter conidiophores and conidia when compared to
the previously described material (Matsushima, 1980; 1993; Onofri & Castagnola, 1983;
Subramanian & Sudha, 1978). R. selenoides is characterized by the morphology of
conidium and the presence of denticles at the apex of the conidiophore. Subramanian &
Sudha (1978) reported that there are two types of conidia, lenticular and selenoid. This
distinct morphology is probably related to variation conidiogenesis, as observed in R.
aquaspersa (Iwatsu et al., 1987). In the Brazilian material, only selenoid conidia were
observed.
Selenodriella perramosa Kendrick & Castafieda Ruiz, Univ. Waterloo Biol. Ser. n° 33:
36. 1990.
Conidiophores erect, straight or flexuous, verticillate conidiogenous cells or branches,
septate, smooth, brown at the base, light brown at the apex, 122-176.5 X 5-6 um.
Conidiogenous cells polyblastic, indeterminate, flask shaped, in verticils, simpodially
proliferated, finely denticulate, smooth, light brown, 8-13.5 X 2.5-4 um. Conidia
needle-like or fusiform, 0-septate, smooth, hyaline, 4.5-5.5 X up to 1 um.
Material examined: BRAZIL, S40 Paulo, Biological Reserve of clay | A ae 22
Gusmao, 07 Nov. 1995, SP307238.
Known distribution: Cuba (Castafieda Ruiz & Kendrick, 1990).
This species was originally collected on decaying leaves of Nectandra coriacea
and apparently has a restricted distribution. The conidiophores and conidia are small when
207
~ compared to the material described by Castafieda Ruiz & Kendrick (1990), but the
features observed in Brazilian material forced us to consider it as belonging to S.
perramosa. Bhatt & Kendrick (1993) reported that Selenodriella has reproductive
morphological characteristics quite similar to species of Selenosporella Arnold ex
MacGarvie, and /driella Nelson & Wilhelm, but S. perramosa is distinguished from
other species mainly by the presence of verticillate branches at the conidiophores.
Selenosporella curvispora MacGarvie, Scient. Proc. R. Dubl. Soc., Ser. B, 2: 153.
1968.
Conidiophores, solitary, erect or flexuous, septate, smooth, brown, 42-89 X 4.5-5.5 um
Conidiogenous cells polyblastic, obclavated, up to 4 per verticil, denticulate, smooth,
light brown, 10.5-19 X 3.5-5 um. Conidia fusiform, slightly curved, cylindrical-angular,
0-septate, smooth, hyaline, 4.5-5.5 X 0.5-1 um.
Material examined: BRAZIL, Sao Paulo, Biological Reserve of Paranapiacaba, L.F.P.
Gusmao, 28 Oct. 1996, SP307239.
Known distribution: Japan (Matsushima, 1975), Great Britain (Kirk, 1983), Australia,
France, India, Ireland, Italy (Lunghini & Quadraccia, 1991), Peru (Matsushima, 1993)
and Mexico (Heredia et al., 1995).
The conidiophores are smaller than the previously described material
(MacGarvie, 1968; Ellis, 1971). The disposition of the conidiogenous cells and the
morphology of conidiophores are the main characteristics of this species. Sutton &
Hodges (1977) reported that the conidia is a good characteristic for the separation of the
species from others, but Kirk (1982) revealed that the dimensions and the shape of
conidia are very variable in the strains of S. curvispora collected around the world.
Matsushima (1989) reported that the conidia do not germinated in common culture
media. According Heredia et al. (1995), this species was collected a few times in
neotropical regions.
Speiropsis scopiformis Kuthubutheen & Nawawi, Trans. Br. Mycol. Soc. 89: 584. 1987.
Conidiophores simple, straight or flexuous, septate, smooth, brown, 45.5-80 X 3.5-
5.5um; apex of the conidiophore with small branches in which conidiogenous cells
arise. Conidiogenous cells clavate to lageniform, integrated, polyblastic, sympodially
proliferated, smooth, light brown, 1-3 denticles in the apical region, 5.5-13.5 X 3.5-5.5
um. Conidia unite by an isthmus forming an unbranched chains with 4-7 cells,
cylindrical or cuneiform, simple, 0-septate, smooth, hyaline to light brown, 32.5-50.5
um long; intermediary conidia, cylindrical, 6-9.5 X 3-4.5 wm; terminal conidia,
cuneiform, 5.5-7 X 2.5-3.5 um; catenate conidia difficult to detach.
Material examined: BRAZIL, Sao Paulo, Biological Reserve of Paranapiacaba, L.F.P.
Gusmao, 01 Nov. 1995, SP307240.
Known distribution: Malaysia (Kuthbutheen & Nawawi, 1987), New Caledonia
(Mouchacca, 1990a) and Cuba (Castafieda Ruiz et al., 1998 ).
The description provided by Mouchacca (1990a) corresponds to our species, but
in the original description, the conidiophores are much large when compared with
208
Brazilian material (Kuthubutheen & Nawawi, 1987). The principal characteristics of this
species are the morphology and the unbranched disposition the catenate conidia.
Subulispora longirostrata Nawawi & Kuthubutheen, Mycotaxon 30: 459. 1987.
Conidiophores simple, erect or flexuous, geniculate at the apex, 2-3 septate, smooth,
brown at the base and light brown in apex, 42.5-63.5 X 3.5-4.5 um. Conidiogenous
cells integrated, terminal, sympodially proliferated, smooth, light brown. Conidia
solitary, subuliform, truncate at the base, apex with appendage, 1-3 septate, smooth,
hyaline, 28-35.5 X 2.5-4 um. Appendage filiform, smooth, hyaline, 14.5-22 um long.
Material examined: BRAZIL, Sao Paulo, Biological Reserve of Paranapiacaba, L.F.P.
Gusmao, 24 Oct. 1995, SP307243.
Known distribution: Malaysia (Kuthbutheen & Nawawi, 1987).
The Brazilian material is similar to the type material (Kuthubutheen & Nawawi,
1987). This species is characterized by the morphology of the conidia and the filiform
appendage with a small inflexion at the junction of conidia. Up to now, S. longirostrata
does not have a large distribution and this is the second record of this taxon in the
world.
Triramulispora gracilis Matsush., Icones Microfungorum a Matsushima Lectorum,
Kobe, p. 158. 1975.
Conidiophores not observed. Conidia composed of a central axis and three branches;
central axis obclavate, truncate base, acute apex, 1-2 septate, hyaline, 25-30.5 X 2.5-3
um; branches obclavate, 0-1 septate, hyaline, 13-26 X 1.5 -3 um; apex, 1-1.5 um wide.
Material examined: BRAZIL, Sao Paulo, Biological Reserve of Paranapiacaba, L.F.P.
Gusmao, 13 Mar. 1996, SP307249.
Known distribution: Japan (Matsushima, 1975), Mexico (Heredia et al. 1995).
This species was originally collected on decaying leaves of unidentified tree
(Matsushima, 1975) and Quercus xalapensis (Heredia et al., 1995). The dimensions of
the structures of the previously described material (Matsushima, 1975; Heredia, et al.,
1995) are large, but this species has conidia very characteristic when compared to other
species in the genus. Heredia et al., (1995) revealed that Mexican collection exhibit
much smaller dimensions if compared to Matsushima’s diagnoses. Ando (1993)
reported that the number of branches are considered an important characteristic to
identify the species.
Zygosporium echinosporum Bunting & Mason, Mycol. Pap. 5: 135. 1941.
Conidiophore unbranched, smooth, septate, brown, 10-13.5 X 3-4 um, arising from the
vegetative hyphae or from the stipe. Stipe straight, long, smooth, light brown, with a
expansion at the apex, 98-154.5 X 3-4 um. Stipe expansion rounded, subhyaline, 4.5-5
um diam. Vesicles arising from the conidiophore, curved, smooth, dark brown, 11.5-
12.5 X 7-8 wm. Conidiogenous cells arising from vesicles, in number of 3-4,
ampuliform or ellipsoidal, discrete, determinate, monoblastic, smooth, light brown to
hyaline. Conidia rounded, 0-septate, verrucose, hyaline, 6-8 um diam.
209
Material examined: BRAZIL, Sao Paulo, Biological Reserve of Paranapiacaba, L.F.P.
Gusmao, 04 Mar. 1996, SP307255.
Known distribution: British Isles, Ghana, Japan, Mexico, Nigeria, Peru, Serra Leoa,
Trinidad, Taiwan, United States of America (Hawaii) (Heredia et al., 1997).
The typical features of this species are the presence of the expansion in the apex
of conidiophore stipes and the disposition of the vesicles. The Brazilian material is
similar to that previously described (Ellis, 1971; Kirk, 1983). Kirk (1983) reported that
the size of the conidia is not a good character to distinguish any species included in this
genus. The vesicles are: responsible for the forcible discharge of conidia, when humidity
varies (Ingold, 1971).
OTHER SPECIES FOUND ON M. CABUSSU
Arthrobotrys oligospora Fresenius, Beitrage zur Mykologie, 1-2: 18. 1850.
Material examined: L.F.P. Gusmao, 08 Dec. 1995, SP251232.
Beltrania rhombica Penzig. Nuovo G. bot. ital., 14: 72. 1882.
Material examined: L.F.P. Gusmao, 02 May 1996, SP251236.
Beltraniella japonica Matsushima, Icones Microfungorun a Matsushima Lectorum, p.
151075.
Material examined: L.F.P. Gusmao, 04 Mar. 1996, SP251238.
Beltraniella portoricensis (F.L. Stevens) Pirozynski & Patil, Can. J. Bot. 48: 575.
1970.
Material examined: L.F.P. Gusm4o, 22 Apr. 1996, SP251237.
Beltraniopsis miconiae Gusmao & Grandi, Mycol. Res. 104(2): 251. 2000.
Material examined: L.F.P. Gusm4o, 18 Apr. 1996, SP251240 (holotypus).
Beltraniopsis ramosa Castafieda Ruiz, Rev. Jard. Bot. Nac. 4(1): 53. 1985.
Material examined: L.F.P. Gusmao, 18 Apr. 1995, SP251239.
Camposporium antennatum Harkness, Bull. Calif. Acad. Sci. 1: 37. 1884.
Mateial examined: L.F.P. Gusmao, 07 Nov. 1995, SP251241.
Chaetopsina fulva Rambelli, Atti. Accad. Sci. Ist. Bologna Rc., Ser 11, 3: 5. 1956.
Material examined: L.F.P. Gusmao, 28 Oct. 1996, SP251243.
Chaetopsina splendida Sutton & Hodges, Nova Hedwigia 27: 346. 1976.
Material examined: L.F.P. Gusmao, 01 Nov. 1995, SP251244.
Chalara alabamensis Morgan-Jones & Ingram, Mycotaxon 4(2): 489. 1976.
Material examined: L.F.P. Gusmao, 28 Mar. 1996, SP251245.
Circinotrichum olivaceum (Spegaz.) Pirozynski, Mycol. Pap. 84: 6. 1962.
Material examined: L.F.P. Gusmao, 30 Oct. 1995, SP251248.
Cladosporium cladosporioides (Fres.) de Vries, Contribution to the Knowledge of the
genus Cladosporium Link: Fr.: p. 57. 1952.
Material examined: L.F.P. Gusmao, 05 Nov. 1995, SP251249.
Cladosporium oxysporum Berk. & Curt., J. Linn. Soc. Lond. Bot. 10: 362. 1868.
Material examined: L.F.P. Gusm4o, 06 Set. 1996, SP251250.
Curvularia pallescens Boedijn, Bull. Jard. Bot. Buitenz. III, 13(1): 127. 1933.
Material examined: L.F.P. Gusméo, 01 Nov. 1995, SP251251.
Cylindrocladium candelabrum Viégas, Bragantia 6: 370. 1946.
210
Material examined: L.F.P. Gusmao, 28 Oct. 1996, SP251252.
Cylindrocladium gracile (Bugn.) Boesewinkel, Trans. Br. mycol. Soc. 78: 554. 1982.
Material examined: L.F.P. Gusmao, 09 Oct. 1996, SP251253.
Cylindrocladium quinqueseptatum Boedijn & Reifsma, Reinwardtia 1: 59. 1950.
Material examined: L.F.P. Gusmao, 03 May 1996, SP251254.
Cylindrocladium spathulatum E\-Gholl, Kimbrough, Barnard, Alfieri & Schoulties,
Mycotaxon 26: 159. 1986.
Material examined: L.F.P. Gusm4o, 26 Aug. 1996, SP251255.
Dictyochaeta novae-guineensis (Matsushima) Romero, Bol. Soc. Argent. Bot. 22(1-4):
76. 1983.
Material examined: L.F.P. Gusmao, 20 Mar. 1996, SP251256.
Epicoccum nigrum Link, Mag. Ges. Naturf. Fr. Berl. 7: 32.
Material examined: L.F.P. Gusm4o, 27 Aug. 1996, 251258.
Gyrothrix circinata (Berk. & Curt.) Hughes, Can. J. Bot. 36: 771. 1958.
Material examined: L.F.P. Gusmao, 24 Nov. 1995, SP251259.
Gyrothrix verticiclada (Goid.) Hughes & Pirozynski, N. Z. Jl. Bot. 9: 42. 1971.
Material examined: L.F.P. Gusmao, 22 May 1996, SP251260.
Helminthosporium velutinum Link: S.F. Gray, Mag. Ges. Naturf. Freund., Berlin 3: 10.
1809.
Material examined: L.F.P. Gusmao, 26 Jul. 1996, SP251261.
Memnoniella echinata (Riv.) Galloway, Trans. Br. mycol. Soc. 18: 1933.
Material examined: L.F.P. Gusmao, 17 Nov. 1995, SP251263.
Menisporopsis theobromae Hughes, Mycol. Pap. 48: 59. 1952.
Material examined: L.F.P. Gusmao, 06 Oct. 1996, SP251264.
Nigrospora sphaerica (Sacc.) Mason, Trans. Br. mycol. Soc. 12: 158. 1927.
Material examined: L.F.P. Gusmao, 29 Oct. 1996, SP307228.
Parasympodiella laxa (Subram. & Vital) Ponnapa, Trans. Br. mycol. Soc. 64(2): 344. 1975.
Material examined: L.F.P. Gusmao, 25 Feb. 1996, SP307230; L.F.P. Gusmao, 18 Mar.
1996, SP307231.
Periconia byssoides Pers., Synop. Meth. Fung.: 686. 1801.
Material examined: L.F.P. Gusmao, 11 Nov. 1996, SP307232.
Phaeoisaria clematidis (Fuckel) Hughes, Can. J. Bot. 36: 795. 1958.
Material examined: L.F.P. Gusmao, 27 Nov. 1995, SP307233.
Pithomyces chartarum (Berk. & Curt.) Ellis, Mycol. Pap. 76: 13. 1960.
Material examined: L.F.P. Gusmao, 12 Jan. 1996, SP307234; L.F.P. Gusmao, 23 Jan.
19904SP307 230.
Pyricularia fusispora (Matsushima) Zucconi, Onofri & Persiani, Mic. Ital. 13: 9. 1984.
Material examined: L.F.P. Gusm4o, 24 Oct. 1995, SP307236.
Stachybotrys atra Corda, Icon. Fung. 1: 21. 1837.
Material examined: L.F.P. Gusmao, 27 Nov. 1995, SP307241.
Stilbella aciculosa (Ellis & Everhart) Seifert, Stud. Mycol. 27: 44. 1985.
Material examined: L.F.P. Gusmao, 29 Oct. 1996, SP307242.
Subulispora procurvata Tubaki, Trans. Mycol. Soc. Japan 12: 20. 1971.
Material examined: L.F.P. Gusmao, 24 Oct. 1995, SP307244.
Thozetella cristata Pirozynski & Hodges, Can. J. Bot. 51: 168. 1973.
Material examined: L.F.P. Gusmao, 05 Nov. 1995, SP307245; L.F.P. Gusmao, 16 Jul.
1996, SP307246.
Pani
Thozetella cubensis Castafieda Ruiz & Arnold, Rev. Jard. Bot. Nac. 6(1): 51. 1985.
Material examined: L.F.P. Gusmfo, 31 Jul. 1996, SP307247.
Tripospermum myrti (Lind.) Hughes, Mycol. Pap. 46: 18. 1951.
Material examined: L.F.P. Gusm4o, 19 Dec. 1995, SP307248.
Volutella minima Hohnel, Stizungsber. Kaiserl. Akad. Wiss., Math.-Naturwiss. Cl.,
Abt. I, 118: 1543. 1909.
Material examined: L.F.P. Gusmao, 20 Dec. 1995, SP307250.
Wiesneriomyces laurinus (Yassi) Kirk, Trans. Br. mycol. Soc. 82: 748. 1984.
Material examined: L.F.P. GusmAo, 26 Jul. 1996, SP307254.
ACKNOWLEDGEMENTS
The authors wish to acknowledge the CNPq (Conselho Nacional de Desenvolvimento
Cientifico e Tecnoldgico) for the financial support. We extend special thanks to Dr. K.
A. Seifert, Eastern Cereal and Oilseed Research, Centre Agriculture and Agri-Food,
Canada, for critical review of the manuscript and Dr. R. F. Castafieda Ruiz, Instituto de
Investigaciones Fundamentales en Agricultura Tropical “Alejandro de Humboldt”,
Cuba, for his suggestions.
REFERENCES
Abarca, G. H., Mena Portales, J., Mercado Sierra, A. & Estebanez, M. R. (1997). Tropical
Hyphomycetes of Mexico. II. Some species from the tropical biology station “Los Tuxtlas”,
Veracruz, Mexico. Mycotaxon 64: 203-223.
Ando, K. (1993). Three new species of staurosporous Hyphomycetes from Japan. Transactions
Mycological Society of Japan 34: 399-408.
Arambarri, A. M., Gamundi, I. J. & Bucsinszky, A. M. (1981). Micoflora de la hojarasca de
Nothofagus dombeyi. Il. Darwiniana 23(2/4): 327-348.
Bhatt, D. J. & Kendrick, B. (1993). Twenty-five new conidial fungi from the Western Ghats
and the Andaman Islands (India). Mycotaxon 49: 19-90.
Bononi, V. L. R. (Coord.).(1989). Recomposigao da vegetag¢do da Serra do Mar, em Cubatdo,
Sao Paulo, Brasil. Governo do Estado de Sao Paulo, Secretaria do Meio Ambiente, Instituto
de Botanica. Sao Pauio.
Cabello, M., Cazau, C. & Arambarvi, A. (1993). Estudio sistematico de los Hyphomycetes del
Rio Santiago. VI. (Buenos Aires, Argentina). Boletin de la Sociedad Argentina de Botanica
29(1-2): 11-14.
Castafieda Ruiz, R. F. 1986. Fungi Cubenses III. Instituto de Investigaciones Fundamentales en
Agricultura Tropical “Alejandro de Humbold?’ p.19.
Castafieda Ruiz, R. F. & Arnold, G. R. W. (1985). Deuteromycotina de Cuba. I. Hyphomycetes.
Revista del Jardin Botanico Nacional 6(1): 47-67.
Castafieda Ruiz, R. F. & Kendrick, B. (1990). Conidial fungi from Cuba: II. . University of
Waterloo Biology Series N® 33.
Castafieda Ruiz, R. F., Cano, J. & Guarro, J. (1997). Notes on conidial fungi VI.
Menisporopsis. Mycotaxon 64: 335-342.
Castafieda Ruiz, R.F., J. Guarro, E. Mayayo, and C. Decock (1998). Notes on conidial fungi.
XVI. A new species of Dendryphiosphaera and some new records from Cuba. Mycotaxon
67: 9-19.
Coutinho, L. M. (1962). Contribuicao ao conhecimento da ecologia da Mata Pluvial Tropical.
Boletim da Faculdade de Filosofia, Ciéncias e Letras da Universidade de SGo Paulo 257,
Botanica 18: 11-219.
212
Coutinho, L. M. (1962). Contribuigéo ao conhecimento da ecologia da Mata Pluvial Tropical.
Boletim da Faculdade de Filosofia, Ciéncias e Letras da Universidade de SGo Paulo 257,
Botdnica 18: 11-219.
Crous, P. W., Seifert, K. A. & Castafieda Ruiz, R. F. (1996). Microfungi associated with
Podocarpus \eaf litter in South Africa. South African Journal of Botany 62(2), 89-98.
Domingos, M., Lopes, S. M. I. M., Struffaldi-De Vuono, Y., Klumpp, A., Klumpp, G., .
Guderian, R., Liess, S. & Mayer, R. (1994). Poluig&éo atmosférica e danos a vegetacao e solo
da Serra do Mar, na regiao de Cubatao, SP. IJ Simposio de ecossistemas da Costa
Brasileira, Aciesp 87-X1: 10-17.
Dorai, M. & Vittal, B. 1997. Some more interesting Hyphomycetes from Eucalyptus litter.
Kavaka 15: 33-39.
Ellis, M. B. (1971). Dematiaceous Hyphomycetes. Commonwealth Mycological Institute.
London.
Grandi, R. A. P. (1998). Hyphomycetes decompositores do folhedo de Alchornea triplinervia
(Spreng.) Miiell. Arg. Hoehnea 25(2): 133-148.
Grandi, R. A. P. (1999). Hifomicetos decompositores do folhedo de Euterpe edulis Mart.
Hoehnea 26(1): 87-101.
Grandi, R. A. P. & Gusmao, L. F. P. (1996). Hyphomycetes decompositores de raizes de
Calathea zebrina (Sims) Lindl. (Marantaceae), provenientes da Reserva Bioldgica do Alto
da Serra de Paranapiacaba, Santo André, SP, Brasil. Revista Brasileira de Botanica 192):
165-172.
Harley, J. L. & Waid, J. S. (1955). A method of studing active mycelia on living roots and other
surfaces in the soil. Transactions of the British Mycological Society 38: 104-118.
Heredia, G., Mercado Sierra, A. & Mena Portales, J. (1995). Conidial fungi from leaf litter in a
mesophilic cloud forest of Veracruz, Mexico. Mycotaxon 55: 473-490.
Holubova-Jechova, V. (1984). Lignicolous Hyphomycetes from Czech Republic 7. Chalara,
Exochalara, Fusichalara and Dictyochaeta. Folia Geobotanica Phytotaxonomica 19(4):
387-438.
Ingold, C. T. (1971). Fungal spores: their liberation and dispersal. Oxford University Press,
London.
Iwatsu, T., Nishimura, K. & Miyaji, M. (1987). Studies on conidiogenesis in Rhinocladiella
aquaspersa. Mycotaxon 28(1): 199-207.
Kirk, P. M. (1982). New or interesting microfungi IX. Dematiaceous Hyphomycetes from Esher
Common. Transactions of the British Mycological Society 80(3): 449-467.
Kirk, P. M. (1983). New or interesting microfungi X. Hyphomycetes on Laurus nobilis leaf
litter. Mycotaxon 18(2): 259-298.
Kirk, P. M. & Sutton, B. C. (1980). Henicospora gen. nov. (Hyphomycetes). Transactions of
the British Mycological Society 75(2): 249-253.
Klumpp, A., Klumpp, G., Domingos, M. & Silva, M. D. (1996). Fluoride impact on native tree
species of the Atlantic Forest near Cubatao, Brazil. Water, Air, Soil and Pollution 87: 57-71.
Kuthubutheen, A. J. & Nawawi, A. (1987). A new species of Speiropsis from Malaysia.
Transactions of the British Mycological Society 89(4): 584-587.
Leitdo Filho, H. F., Pagano, S. N., Cesar, O, Timoni, J. L. & Rueda, J. J. (1993). Ecologia da
Mata Atlantica em Cubatdo. Ed. Unesp, Sao Paulo.
Lunghini, D. & Quadraccia, L. (1991). Contributo alla conoscenza degli ifomiceti del Parco
Nacionale D’ Abruzzo. Giornale Botanico Italiano 125(5): 797-815.
Macgarvie, Q. D. (1968). Hyphomycetes on Juncus effusus L. Scientific Proceedings of the
Royal Dublin Society, Series B, 2: 153-161.
Matsushima, T. (1971). Microfungi of the Solomon Islands and Papua-New Guinea. Published
by the author, Kobe.
Matsushima, T. (1975). Icones Microfungorum a Matsushima Lectorum. Published by the
author, Kobe.
HANS
_ Matsushima, T. (1980). Matsushima Mycological Memoirs N°. 1. Saprophytic Microfungi From
Taiwan. Published by the author, Kobe.
Matsushima, T. (1989). Matsushima Mycological Memoirs N° 6. Published by the author,
Kobe.
Matsushima, T. (1993). Matsushima Mycological Memoirs N°. 7. Published by the author,
Kobe.
Matsushima, T. (1996). Matsushima Mycological Memoirs N°. 9. Published by the author,
Kobe.
Medeiros, J. D. (1993). Anatomia e embriologia de Miconia cabussu Hoehne (1933)
(Melastomataceae - Miconieae). Tese de Doutorado. Sao Paulo, SP, Universidade de Sao
Paulo.
Mercado Sierra, A., Holubova-Jechova, V. & Mena Portales, J. (1997). Hifomicetos
demacidceous de Cuba. Enterobldsticos. Museo Regionale di Scienze Naturali Torino.
Monografie XXIII. Torino. |
Mouchacca, J. (1990a). Champignons de Nouvelle-Calédonie I. Quelques dématiées
intéressantes de litiére forestiére. Persoonia 14(2): 151-160.
Mouchacca, J. (1990b). Champignons de Nouvelle-Calédonie II. Quelques dématiées
intéressantes de liti¢re foresti¢re. Nova Hedwigia 51: 459-468.
Mouchacca, J. & Zucconi, L. (1994). Fungi of New Caledonia III. Some interesting
dematiaceous Hyphomycetes from leaf litter. Cryptogamie, Mycology 15(1): 27-38.
Mulas, B., Pasqualetti, M. & Rambelli, A. (1993). Influence of the substratum on the
morphology of Endophragmiella boewei and Beltrania rhombica. Flora Mediterranea 3:
233-238.
Nag Raj, T. R. & Kendrick, B. (1975). A monograph of Chalara and allied genera. Wilfrid
Laurier University Press, Waterloo.
Nawawi, A. & Kuthubutheen, A. J. (1987). A new species of the genus Subulispora. Mycotaxon
30: 459-463.
Onofri, S & Castagnola, M. (1983). The genera Ardhachandra and Rhinocladiella, their
synonymy. Mycotaxon 18(2): 337-343.
Pirozynski, K. A. (1963). Beltrania and related genera. Mycological Papers 90: 1-37.
Pirozynski, K. A. (1972). Microfungi of Tanzania. Mycological Papers 129: 1-64.
Rao, Vasant & Hoog, G. S. (1986). New or critical Hyphomycetes from India. Studies in
Mycology 28: 1-84.
Schoenlein-Crusius, I. H. & Milanez, A. I. (1998). Fungos microscdépicos da Mata Atlantica de
Paranapiacaba, Sdo Paulo, Brasil. Revista Brasileira da Botanica 21(1): 73-79.
Sinclair, R. C., Eicker, A. & Morgan-Jones, G. (1990). Dematiaceous hyphomycetes form
South Africa. I. Some phragmosporous, holoblastic and tretic species. South African Journal
of Botany 56(5): 507-513.
Struffaldi-De Vuono, Y., Domingos, M & Silveira-Lopes, M. I. M. (1989). Decomposi¢ao da
serapilheira e liberag¢ao de nutrientes na floresta da Biological Reserve of Paranapiacaba,
Sujeita aos poluentes atmosféricos de Cubatao, Sao Paulo, Brasil. Hoehnea 16:179-193.
Subramanian, C. V. & Sudha, K. (1978). Ardhachandra, a new genus of the Hyphomycetes.
Canadian Journal of Botany 56: 729-731.
Sutton, B. C. (1978). New and interesting Hyphomycetes from Tampa, Florida. Mycologia 70:
784-801.
Sutton, B. C. & Hodges, C. S. (1977). Eucalyptus microfungi: miscellaneous Hyphomycetes.
Nova Hedwigia 28: 487-498.
Trappe, J. M. & Schenck, N. C. (1982). Taxonomy of the fungi forming endomycorrhizae. In
Methods and principles of mycorrhizae reseach. (ed. N. C. Schenck) pp. 1-9. The American
Phytopathological Society: St. Paul.
Vittal, B. P. R. & Dorai, M. 1994/1995. Studies on litter fungi VIII. Quantitative studies of the
mycoflora colonizing Eucalyptus tereticornis Sm. litter. Kavaka 22/23: 35-41.
A te %
# pick
am D Ray ty. mx mr
D oatael Se
4 it ia highs 7
ol A a aA susie J he
aan Seas nv ap pn ‘i Cite -
| agit nee ae 4% 3
ip A men) oe Hy
4 5 : +
be a " ra Hf , i tyAsy a “y satis Ail
pate wre re we Maye
ad Fb Sy ae A plier
ail uy " .
7 ive ah Ww a ae dee a ‘aa ; pitt as ok
aR REN et ren ceva ye
& “ar | 4a as
ie dit cea
Ra ey. 1a mt Ki Oy ita €
viel? re! pale 4: ay x ms pu Ye ds jhytt: ei
a: PEE oO AVEIAY ey ne tee | ¥ me, “dete j
. rs 12 aah Sal oa NEP K
Logs ert au Baer gh Ps a teint ie as vot A.3
ci ihe dae | Vn ee cat, Mite e , Fabs ie ah we. % ) aided ite as y
ade A Nghia ae -
Fe baAhe we fs
mia ant sae the,
neipeyy “ Ne a is ei hasten i | ne
ff ede mee iia
rane
ay a a
Sartre cf BE Biasit'
cath vet J i io wee Bi
nhs een hed ner Ea
iY Af at - fie P wie ee 7 ‘ if
asl ¥ et is sacked it mee eee 4
Pk a, 0
iia nals Lihat Asati ket
ven My ae ale aut
UA S Sveti) cheval, la
+ r .
hth
; wh r Ny
By
bina ky
MYCOTAXON
Volume LXXIX, pp. 215-216 July-September 2001
A NEGLECTED CALICIOID LICHEN NEW TO TAIWAN
I-Chen Hsueh
Department of Forestry, National Taiwan University, Taipei, Taiwan 106
Clifford M. Wetmore
Plant Biology Department, College of Biological Sciences, St. Paul,
MN 55108-1095, U.S. A.
Ming-Jou Lai
P.O.Box 834, Tunghai University, Taichung, Taiwan 407
Abstract: There are no previous records of any member of the Coniocybaceae in
Taiwan. This paper reports the presence of Chaenotheca chrysocephala there.
Keywords: Chaenotheca chrysocephala, Coniocybaceae
Chaenotheca chrysocephala has been reported from Yunnan, China (Zahlbruckner
1930, Wei 1991), Japan (Yoshimura 1974), and Nepal (Awasthi & Awasthi 1989). For
the distribution in Europe, Siberia and North America see Tibell (1975, 1980, 1999). It
is also known from the Southern hemisphere (Tibell 1987, 1998).
Recently during a collecting trip to the mountainous area in central Taiwan, we
collected among many others a lichen which may represent the first record of the family
Coniocybaceae in Taiwanh: (cf. Lai 2001, an updated lichen checklist of 144 genera, 579
species and infraspecific taxa enumerated). We express our deep gratitude to Prof. Leif
Tibell, Department of Systematic Botany, Uppsala University, Sweden who assisted in
verifying the identity of it as Chaenotheca chrysocephala. It was found on the north
side near the base of an old Tsuga chinensis.
Chaenotheca chrysocephala (Turn. ex Ach.) Th. Fr., Acta Reg. Soc. Sci. Ups. 3:
250. 1860.
Calicium chrysocephala Turn. ex Ach., Methodus qua omnes detectos Lichenes,
suppl.: 15. 1803.
Thallus corticolous, verrucose to squamulose, yellowish green. Apothecia black,
stalked, stalk 1-2 mm. Capitulum obconical, lower side and stalk yellow-pruinose.
Spores simple, pale brown, spherical to ellipsoid, 4-6 jm. Phycobiont a Chlorococcales.
Thallus K-, C-, KC-, P- ; TLC : vulpinic acid.
Distribution: Cool to temperate areas of both hemispheres, and higher elevation at
low latitudes.
Specimens examined. TAIWAN. Taichung County: Anmashan Forest Station,
216
2275 alt., upper montane vegetation zone, on trunk of Tsuga chinensis. Wetmore 85364
(MIN), Lai s. n. Feb. 1, 2001 (LAI).
Literature Cited
Awasthi, P. G. & D. D. Awasthi, 1989. Caliciales from India and Nepal. Biovigyanam 15(1): 3-27.
Lai, M. J. 2001. Illustrated Macrolichens of Taiwan. Council of Agriculture, Taipei.
Tibell, L. 1975. The Caliciales of boreal North America. Symb. Bot. Upsal. 21: 1-128.
Tibell, L. 1980. The lichen genus Chaenotheca in the Northern Hemisphere. Symb. Bot. Upsal. 23: 1-65.
Tibell, L. 1987. Australasian Caliciales. Symb. Bot. Upsal. 27, 1: 1-279.
Tibell, L. 1998. Crustose mazaediate lichens and the Mycocaliciaceae in temperate South America. Bibl.
Lichenol. 71. 107 pp. J. Cramer, Berlin, Stuttgart.
Tibell, L. 1999. Calicioid lichens and fungi. Nordic Lichen Flora. Vol. 1. pp. 20-94. Eds. Ahti, T.,
Jorensen, P.-M., Moberg, R. and U. Sechting.
Wei, J. C. 1991. An Enumeration of Lichens in China. International Academic Publishers. Beijing.
Yoshimura, I. 1974. Lichen Flora of Japan in Color. Hoikusha Publishing Co., Ltd., Osaka.
Zahlbruckner, A. 1930. Lichenes in Handel-Mazzetti, Symbolae Sinicae 3: 1-254. Pl. 1.
MYCOTAXON
Volume LXXIX, pp. 217-229 July-September 2001
TYPE SPECIMEN STUDIES IN NEW WORLD LENTINULA
JUAN L. MATA and RONALD H. PETERSEN
Dept. of Botany, University of Tennessee, Knoxville 37996-1100, USA
ABSTRACT
Discovery of two biological species within putative Lentinula boryana led to
examination of type specimens of names previously listed in synonymy under L.
boryana. Shape of cystidia and spore dimensions were diagnostic in assigning each type
collection to a morphological species. Armillaria raphanica is the most priorable
basionym representing the "non-boryana" taxon, and the epithet is recombined in
Lentinula.
KEY WORDS: nomenclature, specimen studies
INTRODUCTION
Lentinula boryana (Berk. & Mont.) Pegler and L. guarapiensis (Speg.) Pegler have
been considered to be the only New World species within Lentinula, the latter species
known only from its type collection (Pegler, 1983a). Until now, LZ. boryana has been
reported from the tropics of Mexico, Central America, Caribbean landmasses and South
America to subtropical North America (Hibbett et al, 1998; Nicholson et al, 1997; Mata
et al., 2000; Murmill, 1916; Pegler, 1983a; Petersen et al, 1998).
Mating experiments involving several specimens of putative L. "boryana” from Mexico,
Costa Rica, Puerto Rico, Florida and the Gulf Coast area of North America revealed the
presence of two intersterility groups (Petersen et al, 1998), a conclusion supported by
independent genetic and molecular data (Hibbett et al, 1998; Nicholson et al, 1997).
Macroscopically, basidiomata of the two intersterility groups were indistinguishable,
but microscopic analyses showed that they could be separated into two morphotaxa
distinguished by the shape of cheilocystidia, caulocystidia, and basidiospore dimensions
(Mata et al, 2000; Petersen et al, 1998). Consequently, these micromorphological
characters gained more taxonomic importance when identifying LZ. boryana and sister
taxa. Previous comprehensive studies which included L. boryana and _ putatively
synonymous names left the presence of cystidia unnoticed (Singer, 1952, 1955; Pegler,
1975, 1983a,b) although these structures were reported by other authors (Horak, 1968;
Guzman et al, 1997).
The objective of this paper was to determine which of the two biological species is to be
represented by the name L. boryana, and to apply the most priorable name (if any) to
the other biological species. To answer this question, examination of type specimens of
epithets listed by Pegler (1983a) as synonymous under L. boryana was carried out. This
218
paper reports on the morphological characters of type specimens and develops a
nomenclator for the two morphospecies. In those cases where designation of type —
Specimens was not explicit (Pegler, 1975, 1983a,b) or type specimens were missing, ©
proper typification has been proposed according to Art. 9.9, 9.10 and 9.11 of the ICBN |
(Greuter, 2000). ;
MATERIAL AND METHODS
Morphological observations. All macroscopic observations were performed on dried
material. Fungal contaminants detected on basidiomata were removed with a fine-tipped
brush. Sections of basidiomata were rehydrated first in 95% ethanol and then in water
for as long as 24 hours, and then placed in 3% KOH. Preparations were observed under
phase contrast microscopy or bright field with Congo Red and/or phloxine. Melzer’s
reagent was used to test for amyloidity.
Terminology. Basidiospore measurements and statistics are as follow: range of spore
length X spore width is given for all measured basidiospores; n = total number of spores
measured, x = arithmetic mean of spore length and spore width for all spores measured;
Q = spore length divided by spore width, indicated as a range of variation in n spores
measured; Qx = arithmetic mean of Q-values. Color names in quotations are from
Ridgway (1912), names followed by alphanumerical codes in parentheses are from
Kornerup and Wanscher (1978).
RESULTS
Agaricus boryanus Berkeley & Montagne. 1849. Ann. Sci. Nat., Bot. Ser. 3, 11: 235.
HOLOTYPE: Brazil, Bahia, Blanchet, no. 24, K [!]
= Collybia boryana (Berk. & Mont.) Saccardo. 1887. Syll. Fung. 5: 240.
= Gymnopus boryanus (Berk. & Mont.) Murrill. 1916. North Amer. FI. 9: 370.
= Armillaria boryana (Berk. & Mont.) Murrill. 1939. Bull. Torrey Bot. Club 66: 31.
= Lentinus boryanus (Berk. & Mont.) Singer. 1955. Sydowia 9: 379.
= Lentinula boryana (Berk. & Mont.) Pegler. 1975. Kavaka 3: 19.
Basidiomata three, pressed and glued on white cardboard; two basidiomata with
lamellae upwards, the other showing surface details of the pileus; one basidiome with a
complete stipe, one basidiome partially damaged by insects. Pileus 3-4 cm diam,
circular in shape, probably convex when fresh, surface subvelutinous to subfibrillose
(but epicutis apparently missing over some areas), apparently hygrophanous at disc,
translucent outwards, light brown (5C6 to 5D6) at disc, darker yellowish brown (5E8)
towards margin. Lamellae adnate, but seceding (probably during drying), forming a
pseudo-collarium, close to crowded, now + concolorous with pileus; margin entire or
eroded; lamellulae in at least three tiers. Stipe now 1.5 X 0.2-0.3 cm, central; + widened
at apex and base, striate to sulcate, fibrillose near apex, becoming twisted downwards,
in middle section bumpy to warty, dark brown (6F8). No evidence of annulus or velar
remains.
Ba 8)
Pileipellis a compact, repent layer of interwoven hyphae; hyphae 4-12 ym diam, +
gelatinized, with clamp connections, hyaline singly, light brown in mass; walls thin.
Pileus trama loosely interwoven; hyphae 4-16 tm diam, with clamp connections,
hyaline; walls 2-4 jm thick. Lamellar trama parallel; hyphae 4-14 wm diam, with
clamp connections; walls up to 1.6 tzm thick. Hymenium composed of two elements: 1)
basidia 12-16 X 3-4 wm, clavate; sterigmata 1-4; and 2) basidioles equal in size to
basidia, clavate to ampullaceous; numerous. Pleurocystidia not observed.
Cheilocystidia (Fig. la) 14-21 X 4-10 um, clavate to broadly clavate, uncommon, often
collapsed; apex obtuse. Stipe trama parallel; hyphae 2.5-7 m diam, with clamp
connections, hyaline singly, straw color in mass; walls 1-2 um thick. Caulocystidia
(Fig. 1b) 12-44 X 3-8 um, clavate to subventricose, apex obtuse, sub-mucronate or sub-
ampullaceous. Basidiospores (Fig. lc) 4.8-6.4 X 2.4- 3.2 um, (n = 20, x = 5.9 X 2.7
wm, Q = 1.71-2.67, Qx = 2.24), ellipsoid, subovoid to subcylindrical, compressed
laterally or partially collapsed, hyaline, inamyloid; wall smooth, thin.
Comment: Singer (1955) and Pegler (1975, 1983a,b) overlooked the presence of
cystidia (cheilo-, caulo-) in this type. Because of the preservation process of the type
basidiomata, tissues became cemented, giving them a caramelized appearance. As a
result, initial distinction of individual cells under light microscopy was very difficult.
Only after prolonged re-hydration and squashing of the tissues could cheilocystidia,
caulocystidia, and basidiospores be observed. Shape of cheilocystidia and caulocystidia
in A. boryanus range from clavate to broadly clavate (i.e. subsphaeropedunculate)
closely resembling the shape of those structures in modern collections of L. boryana
(Guzman et al, 1997; Mata et al, 2000; Petersen et al, 1998). Basidiospore dimensions
and other microstructures of this type collection also coincide with those observed by us
in fresh material. Singer (1955) reported gelatinization of the hymenophoral and pileus
trama, which we have observed in some modern collections, but like Pegler (1983a) we
do not consider this phenomenon as taxonomically informative as spores and cystidia,
because of its irregular manifestation. Our observations agree with those of previous
authors on other characters such as disposition of lamellar trama, hyphal width, and
arrangement and composition of the pileus epicutis.
Lentinula boryana is the most priorable name for any morphospecies of Lentinula in the
New World exhibiting the above combination of micromorphological characters.
Agaricus ixodes Montagne. 1854. Ann. Sci. Nat., Bot. Ser. 4, 1: 95.
HOLOTYPE: Guyana, Leprieur, no. 982 (ex Patouillard # 4055) FH [!]
= Collybia ixodes (Mont.) Saccardo. 1887. Syll. Fung. 5: 232.
= Lentinus ixodes (Mont.) Singer. 1952. Lilloa 25: 479.
| Basidiomata two, pressed flat, moldy, one complete, the other broken. Pileus about 40
_ mm diam, probably convex when fresh, tan; surface glabrous; margin curved. Lamellae
seceding, crowded, narrow. Stipe about 30 X 3 mm, slightly eccentric, fibrillose, with
| scattered squamulae, tough. No evidence of veil or annulus.
: Pileipellis a compacted, repent layer of interwoven, radially arranged filamentous
_ hyphae; hyphae 2-8 um diam, pigment-encrusted, light brown in mass, with clamp
connections; wall thin. Pileus trama loosely interwoven; hyphae 4-10 ym diam,
220
hyaline, with clamp connections; wall up to 3 yum thick. Lamellar trama regular to
subregular, sometimes interwoven; hyphae 2-20 pm diam, hyaline, with clamp
connections; wall up to 1.6 um thick. Basidia 15-18 X 4-7 jum, clavate; sterigmata 4.
Pleurocystidia not observed. Cheilocystidia (Fig. 2a) 15-23 X 4-8 um, clavate to
broadly clavate, occasionally sphaeropedunculate; wall smooth, thin. Lamella margin
sometimes fertile. Stipe trama parallel; hyphae 3-9 um diam, straw colored, with
clamp connections; wall up to 1.6 pm_ thick. Caulocystidia not observed.
Basidiospores (Fig. 2b) 5.2-7.2 X 2.4-3.2 um (n = 40, x= 6.1 X 2.7 um; Q = 1.75-3.00,
Qx = 2.27), subcylindrical to ellipsoid, + lacrymoid-ellipsoid in side view, hyaline,
inamyloid; wall thin, smooth.
Comment: Singer (1955) reported cystidioles but under our criterion these are
basidioles. In our study, size and shape of cheilocystidia and basidiospores were similar
to those of the type specimen of A. boryanus. The lamellar margin was caramelized and
cheilocystidia were not as readily evident as in the type of A. boryanus. Absence of
caulocystidia can be explained by the preservation condition of the material. We
conclude that A. ixodes is a taxonomic synonym of A. boryanus.
Armillaria raphanica Murrill. 1943. Mycologia 35: 423.
HOLOTYPE [FLAS, F 17949, missing; J. Kimbrough, pers. comm.]. LECTOTYPE
[hic designatus]|: U.S.A., Florida, Sanchez Hammock, near Gainesville, 23. VII. 1938,
col. West & Murrill, TENN 16075 ["part of type" teste Murrill] [!], ISOLECTOTYPE
FH UT;
Basidiomata six, in excellent condition, two attached to woody substrate. Pileus now
15-35 mm diam, broadly convex; surface smooth, now light brown (5C7 to 6D8),
margin incurved to inrolled. Lamellae seceding (apparently from drying), crowded,
light brown (6C8 to 6C5); margin entire, several lamellulae of different lengths. Stipe
now 20-30 X 2-4 mm, central to eccentric, + equal to slightly enlarged at base; surface
fibrillose to scaly towards base, longitudinally sulcate and somewhat twisted, similarly
colored as pileus; consistency tough.
Pileipellis a simple cutis; hyphae 3-6 jm diam, filamentous, tightly interwoven, hyaline
singly, light brown to tan in mass, inamyloid, with clamp connections, wall thin.
Oleiferous hyphae occasional. Pileus trama 200-400 jum thick, loosely interwoven;
hyphae 6-16 wm diam, hyaline, with clamp connections; wall 0.8-1.6 jum thick.
Lamellar trama regular to subregular, hyphae 6-8 um diam, hyaline, inamyloid, with
clamp connections; wall thin to 0.8 jm thick. Subhymenium 8-15 jum thick, 3-4 cells
thick, not clearly distinct from trama. Basidia not observed. Basidioles 11-19 X.3-6 um,
clavate to ampullaceous, hyaline, inamyloid. Pleurocystidia not observed.
Cheilocystidia (Fig. 3a) 17-28 x 5-8 um, mostly clavate, rarely sphaeropedunculate,
lobed or knobbed at apex, hyaline, inamyloid; with clamp connections. Not readily
evident, often collapsed. Stipe trama parallel; hyphae 4-14 jum diam, hyaline singly,
yellowish in mass, with clamp connections; walls 2-4 jum thick. Caulocystidia (Fig. 3b)
18-24 X 4-5 «um, cylindrical or clavate, flexed; apex obtuse, or as small knobs or
outgrowths, scattered. Basidiospores from paratype at TENN (Fig. 3c) 4.8-6.0 X 2.4- —
2.8 wm (n = 20, x = 5.4 X 2.6 pm; Q = 1.71-2.67, Qx = 2.09), ellipsoid to
subcylindrical, hyaline, inamyloid, wall thin wall, smooth.
221
Comment: Murrill (1943) distinguished this taxon from A. boryanus (Armillaria
boryana sensu Murrill) by the closer and narrower gills, and a radish odor when drying.
Spores could not be found in any basidiomata of the specimen at FH but they were
measured from the type at TENN. The size of the basidiospores reported by Murrill
(1943), 5 X 2 um, falls within the range of our measurements, and spore dimensions are
similar to other type specimens of Lentinula. Cheilocystidia and caulocystidia, not
reported by Murmill, are relatively smaller than those found in any of the types of
synonyms under L. boryana, are much more contorted and knobbed, and less apically
inflated. Cystidia and spore shape and dimensions fit well with those observed in
modern collections of Lentinula from the Gulf Coast of the U.S.A., Puerto Rico, Costa
Rica and Venezuela which are supported by molecular and genetic data (Hibbett, 1999;
Mata et al, 2000; Petersen et al, 1998). The holotype at FLAS (F 17949) could not be
located (Kimbrough, pers. com.) and TENN 16075 serves as the best collection to be
designated here as the lectotype for the name A. raphanica.
Following the dictates of the ICBN, we have chosen A. raphanica over Gymnopus
alliaceus as the correct epithet for the "non-boryana" biological species on which we
will report in another publication.
Armillariella umbilicata Patouillard. 1899. Bull. Soc. Mycol. France 15: 191.
LECTOTYPE [hic designatus]: Guadeloupe, Basse Terre, Camb Jacob, 20.IIL.1898,
coll. Duss, no. 579, FH [!]
= Armillaria umbilicata (Pat.) Saccardo & Sydow. 1902. Syll. Fung. 16: 19.
Basidiomata 15, moldy, in fair condition. Pileus 0.5-40 mm diam, convex when young,
aplanate-umbilicate with age. surface glabrous, now wrinkled, dark brown; margin
inrolled, persistent. Lamellae seceding, close to crowded, rufous to rusty brown; margin
entire. Stipe 15-20 X 1-3 mm, central, equal; surface striate to sulcate, fibrillose, dark
brown.
Pileipellis a repent layer of compacted, filamentous hyphae; hyphae 3-6 wm diam,
hyaline singly, light brown in mass, with clamp connections; wall thin. Pileus trama
loosely interwoven; hyphae 4-9 «um diam, hyaline, with clamp connections; wall up to
2.4 «wm thick. Lamellar trama regular; hyphae 4-10 um diam, hyaline, with clamp
connections; wall up to 0.8 wm thick. Basidia 15-22 X 6-7 um, clavate; sterigmata 4.
Pleurocystidia not observed. Cheilocystidia (Fig. 4a) 20-42 X 9-18 um,
sphaeropedunculate, occasionally broadly clavate; apex obtuse, occasionally knobbed,
hyaline: wall smooth. Stipe epicutis parallel; hyphae 4-11 jm diam, hyaline singly,
light brown in mass, with clamp connections; wall 1.6-2.4 zm thick. Caulocystidia not
observed. Basidiospores (Fig. 4b) 5.6-7.2 X 2.4-3.2 um (n = 24, x = 6.1 X 2.9 um, Q=
1.75-2.50, Qx = 2.07), ellipsoid to subcylindrical, hyaline, inamyloid; wall thin, smooth.
- Comment: Basidiospore and cheilocystidia measurements resemble those found in A.
boryanus. Also, the presence of a fugacious veil included in Patouillard's description
recalls that of L. boryana. No explicit designation of a holotype was indicated in the
protologue for the name A. umbilicata, and there is a need for lectotypification because
222
Pegler (1983a) only referred to this collection as the "type". We consider A. umbilicata
to be a taxonomic synonym of A. boryanus.
Gymnopus alliaceus Murrill. 1943. Mycologia 35: 425.
HOLOTYPE: U.S.A., Florida, Magnesia Springs, 15. VIII.1938, coll. W.A. Murnill, F
17940, FLAS [!]
Basidiomata ten, in fair condition. Some basidiomata partially eaten by insects, some
with eroded pileus surface. Pileus now 30-60 mm diam, broadly convex, + depressed,
glabrous (now wrinkled); margin curved to incurved. Lamellae seceding, close to +
crowded, narrow, beige to brown; margin entire. Stipe central, equal to + broad at apex,
striate to sulcate.
Pileipellis a repent layer of interwoven filamentous hyphae, worn off in most
basidiomata; hyphae 3-8 um diam, hyaline singly, light brown in mass, with clamp
connections; wall thin. Pileus trama interwoven; hyphae 6-18 jum diam, with clamp
connections; wall up to 2.4 ym thick. Oleiferous hyphae embedded in pileus trama.
Lamellar trama parallel; hyphae 4-14 zm diam, hyaline, with clamp connections; wall
up to 1.6 pm thick. Basidia 17-18 X 4-5 um, clavate; sterigmata 4. Pleurocystidia not
observed. Cheilocystidia (Fig. 5a) 12-24 X 4-5 jum, mostly clavate, some flexed; apex
obtuse or knobbed:; uncommon. Lamella edge fertile. Stipe trama parallel; hyphae 5-12
um diam, with clamp connections; wall 0.8-3.2 um thick. Caulocystidia not observed.
Basidiospores (Fig. 5b) 5.6-6.4 X 2.4-3.2 um, (n = 20, x = 6.0 X 2.8 um, Q = 1.75-
2.67, Qx = 2.19), narrowly ellipsoid, hyaline, inamyloid; wall thin, smooth.
Comment: All the observed microscopic characters in G. alliaceus are similar to those
of the type specimen of A. raphanica. Basidiospore measurements of 5-6 x 4 um,
recorded by Murrill (1943), fall into the range reported here. Cheilocystidia are similar
to those found in A. raphanica. Murrill (1943) did not observe any cystidia, a hint that
these are not readily distinguishable from other hymenial elements. The onion-like odor
reported by Murrill (1943), however, resembles that of 4. raphanica, and has been
noted in some of our field collections.
We consider G. alliaceus as a taxonomic synonym under A. raphanica. Basidiomata of
both type specimens exhibit the same combination of macroscopic and microscopic
characters. The ICBN directs us to choose between simultaneously published,
taxonomically indistinguishable names, and we have done so.
Lentinus cubensis Berkeley & Curtis. 1869. J. Linn. Soc., Bot. 10: 302.
LECTOTYPE [hic designatus]: Cuba, coll. C. Wright, no. 115,K [!] |
= Lentinula cubensis (Berk. & Curt.) Earle. 1909. Bull. New York Bot. Gard. 5: 416.
Basidiomata two, moldy; one is pressed flat. Pileus 12-24 mm diam, circular, probably
convex; surface + smooth, yellow brown (5C7, 5E8); margin slightly incurved.
Lamellae adnate, seceding, forming a “pseudo-collarium”, close, pale orangeyish (5A4)
where not covered by mold; margin entire or eroded; lamellulae in at least two tiers.
223
Stipe 12-15 X 1-2 mm, central to slightly eccentric, + widened at apex and base,
appearing sulcate, fibrillose to + scaly. No veil or annulus observed.
Pileipellis a repent layer of compacted, interwoven hyphae, embedded in a + gelatinous
matrix; hyphae 2-6 jum diam, hyaline singly, yellow-brown in mass, with clamp
connections; wall thin. Pileus trama loosely interwoven; hyphae 6-16 ym diam,
hyaline, with clamp connections; wall 1-3 um thick. Lamellar trama parallel at first,
becoming irregular to interwoven at lamellar edge; hyphae 4-10 pm diam, with clamp
connections; wall 2-4 wm thick. Subhymenium poorly developed. Hymenium composed
of two elements: 1) basidia 12-19 x 4-7 um, clavate; sterigmata 1-4, most with only
two visible sterigmata; and 2) basidioles numerous, equal in size to basidia, clavate or
ampullaceous. Pleurocystidia none. Cheilocystidia (Fig. 6a) 16-30 x 5-14 wm, clavate
to broadly clavate, or sphaeropedunculate, mostly collapsed. Stipe trama_ parallel;
hyphae 2-7 pm diam, hyaline singly, straw color in mass, with clamp connections; wall
up to 1.5 ym thick. Caulocystidia (Fig. 6b) 12-32 x 5-12 1m, cylindrical to broadly
clavate, with obtuse or mucronate apex. Basidiospores (Fig. 6c) 4.8-6.0 x 2.4-3.2 um (n
= 40, x = 5.5 X 2.9 um, Q = 1.71-2.33, Qx = 1.95), ellipsoid, subovoid, hyaline; wall
smooth, thin.
Comment: Earle (1909) proposed Lentinula as a new genus and designated L. cubensis
as its type species, but A. boryanus is an earlier epithet for the species (see Singer,
1955). Unlike Horak (1968), we found basidiospores on a paradermal section of the
pileus, the spore ranges and averages being similar to those observed in A. boryanus.
Cheilocystidia match those of the type of A. boryanus, although some cheilocystidia
present outgrowths which are not uncommon in more recent collections of L. boryana.
There is no explicit designation of a lectotype specimen for L. cubensis in previous
studies, and collection Wright no. 115 is cited as the “K type” in the two of the three
keystone works for L. boryana (Pegler, 1975, 1983a, b). It is the intention here to
resolve this situation by explicitly designating Wright no. 115 as the lectotype specimen
of L. cubensis. Microscopic examination of paratype specimens Wright no. 80, 121, 122
(FH) confirmed their identity as LZ. cubensis. Like previous workers (Pegler 1975,
1983a, b: Singer, 1952, 1955) we consider L. cubensis to be a taxonomic synonym of A.
boryanus.
Lentinus detonsus Fries. 1851. Nov. Symb. Mycol., p. 38.
HOLOTYPE: Costa Rica, Oersted, missing. NEOTYPE [hic designatus]: Costa Rica,
Prov. San José, Jardin de Dota, 3.5 km W. of Inter-American Highway at El Empalme,
9° 42' 52" N, 83° 58' 28" W, elev. 2220 m, 16. VI1.1995, coll. R.E. Halling, field no. 7814
(TENN 53824) [!]
= Lentinula detonsa (Fr.) Murrill. 1911. Mycologia 3:28.
Basidioma one, air-dried, in good condition. Pileus convex when young, in age lobate
to depressed, disc "avellanous" to "tilleul buff" (7B3 - 7B2). Lamellae subventricose,
free. close, off-white to "tilleul buff' (7B2); margin entire. Stipe somewhat bulbous at
224
Fig. 1. A. boryanus. a) cheilocystidia, b) caulocystidia, c) spores. Scale bar = 10 jum.
Fig. 2. A. ixodes. a) cheilocystidia, b) spores. Scale bar = 10 um.
Fig. 3. A. raphanica. a) cheilocystidia, b) caulocystidia, c) spores. Scale bar = 10 um.
Fig. 4. A. umbilicata. a) cheilocystidia, b) spores. Scale bar = 10 um.
Fig. 5. G. alliaceus. a) cheilocystidia, b) spores. Scale bar = 10 yum.
Fig. 6. L. cubensis. a) cheilocystidia, b) caulocystidia, c) spores. Scale bar = 10 pm.
L25
base, scrobiculate, concolorous with gills, at base "army brown" to "natal brown" (8D5 -
8E6); flesh white; consistency tough; veil apparently absent. Odor of cut lamellae very
fungus-like, taste not acrid.
Pileipellis a layer of repent, tightly interwoven hyphae; hyphae 2-8 wm diam,
pigmented light brown, with clamp connections; wall thin. Pileus trama loosely
interwoven; hyphae 6-16 jim diam, constricted at septa, with clamp connections; wall 2-
4 wm thick. Lamellar trama regular to subregular; hyphae 3-7 1m diam; walls up to |
um thick. Basidia 21-26 X 6-7 um, clavate; sterigmata 4. Pleurocystidia not observed.
Cheilocystidia (Fig. 7a) 25-36 X 10-14 jm, clavate, broadly clavate to
sphaeropedunculate, with clamp connections; apex obtuse or irregularly lobed. Stipe
trama parallel; hyphae 3-6 jum diam, with clamp connections; walls up to 1.5 um thick.
Caulocystidia (Fig. 7b) 20-25 X 5-8 jum, clavate, uncommon to rare; apex obtuse or
irregularly lobed. Basidiospores (Fig. 7c) 6.0-8.0 X 3.2-4.0 um (n = 20, x = 7.0 X 3.4
um; Q = 1.78-2.25, Qx = 2.06), ellipsoid, ovoid, hyaline, inamyloid; wall thin, smooth .
Comment: An Oersted specimen under Lentinus detonsus is not resident at UPS (herb.
Fries) or C (herb. Oersted). With no holotype or lectotype material available, we are
obliged to neotypify the name in order to secure its identity. The neotype is from the
same country of origin (Costa Rica), exhibits the morphological characters of L.
boryana, and therefore serves to tie more firmly the name L. detonsus and L. boryana as
listed by Pegler (1983a). Cystidia and basidiospores found in this neotype are typical for
L. boryana. The name Lentinula detonsa has been misapplied to taxa collected along the
Gulf Coast of the U.S.A. (Metzler and Metzler, 1992), which actually correspond to A.
raphanica.
Lentinus proximus Berkeley & Curtis. 1869. J. Linn. Soc., Bot. 10:302.
LECTOTYPE [hic designatus|: Cuba, C. Wright, no. 117, FH [!].
Basidiomata two, moldy, lamellae partially eaten by insects. Pileus convex; surface +
smooth to fibrillose; margin inrolled. Lamellae adnate-seceding, forming a "pseudo-
collarium", close, + broad; margin entire or eroded: lamellulae in two tiers. Stipe
central; + widened at base, appearing sulcate, fibrillose. No evidence of veil or annulus.
Pileipellis a compact, repent layer of interwoven hyphae; hyphae 3-6 tm diam, hyaline
singly, light brown in mass, with clamp connections; wall thin. Pileus trama loosely
interwoven; hyphae 6-14 jum diam, hyaline, with clamp connections; wall 1-3 um thick.
Lamellar trama parallel; hyphae 4-12 «um diam, with clamp connections; wall 0.5-2
yum thick. Subhymenium poorly developed. Basidia 14-18 X 4-7 um, clavate, often
collapsed; sterigmata 1-4, often only two visible. Pleurocystidia not observed.
Cheilocystidia (Fig. 8a) 12-33 X 5-12 jm, clavate to broadly clavate, often collapsed;
apex obtuse, or irregularly lobed to branched. Stipe trama parallel; hyphae 2-10 um
diam, hyaline singly, straw colored in mass, with clamp connections; wall 0.8-2.4 um
thick. Caulocystidia not observed. Basidiospores (Fig. 8b) 5.6—7.2 X 2.4-3.2 um, (n =
20, xX = 6.4 X 2.9 um, Q = 2.0-2.67, Qx = 2.19), ellipsoid, subovoid to subcylindrical,
hyaline, inamyloid; wall thin, smooth.
226
Comment: All micromorphological characters conform to those described for A.
boryanus (see above). The stipes of the basidiomata are very contaminated with mold
and confirmation of caulocystidia was not possible. Previous workers did not expressly
designate a lectotype for L. proximus (Pegler, 1975, 1983a), and now we propose
collection Wright no. 117 to serve this function. We consider LZ. proximus to be a
taxonomic synonym of A. boryanus.
Lentinus puiggarii Spegazzini. 1919. Bol. Acad. Nac. Cienc. Cordoba 23: 387.
HOLOTYPE: Brazil, Apiahy, L. Puiggari, no. 86, LPS [!].
Basidiomata five, all in very deteriorated and moldy condition, broken or worn off,
some eaten by insects. Pileus 5-15 mm diam; surface glabrous, brownish with olive-
gray hues. Lamellae seceding, close, somewhat narrow, brown; margin eroded in most
basidiomata. Stipe central, striate-sulcate, somewhat wider at base, light brown;
consistency tough. On wood.
Pilepellis a repent layer of tightly interwoven filamentous hyphae; hyphae 3-6 pm
diam, hyaline singly, light brown in mass, with clamp connections; wall thin. Pileus
trama + loosely interwoven; hyphae 4-10 tm diam, hyaline, with clamp connections;
wall 0.8-2.4 um thick. Lamellar trama regular; hyphae 4-12 pm diam, hyaline, with
clamp connections. Hymenium 12-20 ym _ thick; basidia indistinguishable from
basidioles; sterigmata collapsed. Pleurocystidia not observed. Cheilocystidia (Fig. 9a)
19-32 X 4-8 um, clavate to broadly clavate or sphaeropedunculate, often collapsed.
Stipe trama parallel; hyphae 4-12 tum diam, hyaline singly, yellowish in mass, with
clamp connections; wall 0.8-2.4 «um thick. Caulocystidia (Fig. 9b) 21-25 X 4-8 pm,
cylindrical to clavate, flexous. Basidiospores: (Fig. 9c) 4.4-5.6 X 2.0-2.8 um (n = 14,
5.1 X 2.4 wm, Qx = 1.71-2.80, Q = 2.16), lacrymoid in side view, ellipsoid to subovoid
in profile, collapsed, hyaline, inamyloid; wall thin, smooth.
Comment: On the original voucher folder there are drawings of five basidiospores, 6 X
3 yum, ellipsoid in profile. Singer (1952) provided descriptions of what he considered L.
puiggarii from fresh material, the basidiospores measuring 5-7.3 X 2.8-4.3 um, but
gave no report of cystidia. However, Singer (1952) thought this species to be related to
the types of A. ixodes and L. cubensis, both synonyms of A. boryanus. In our view,
cheilocystidia, caulocystidia and basidiospore dimensions match those found on the
type specimen of A. boryanus.
Panus leprieurii Montagne 1854. Ann. Sci. Nat., Bot. Ser. 4, 1:121 [non Lentinus
leprieurii Mont. 1854]
LECTOTYPE [hic designatus]: Guyana, Cayenne, Leprieur, no. 980, K [!]
Basidioma one, pressed flat, glued to cardboard, severely covered by mold, broken at
stipe. Pileus about 6 mm diam, probably convex, color not detectable, margin inrolled.
Lamellae seceding, close, narrow, margin brown to hazel brown, apparently smooth.
Stipe nearly central, short, striated longitudinally. On wood.
od
-Pileipellis a simple cutis; hyphae 2-4 jum diam, filamentous, radially oriented,
somewhat gelatinized, hyaline singly, light brown in mass, with clamp connections;
wall thin. Pileus trama interwoven, hyphae 3-11 jum diam, hyaline singly, yellowish in
mass, with clamp connections; wall thin. Lamellar trama subregular; hyphae 2-8 wm
diam, hyaline, with clamp connections; wall thin. Hymenium composed of two
elements: 1) basidia 15-21 X 5-7 tum, clavate, hyaline; wall thin; sterigmata 4; and 2)
basidioles similarly sized, clavate to mucronate. Pleurocystidia not observed.
Cheilocystidia (Fig. 10a) 18-27 X 5-8 um, mostly clavate, few sphaeropedunculate,
some knobbed; apex obtuse, hyaline; wall thin. Stipe epicutis parallel; hyphae 3-8 um
diam, hyaline singly, yellowish in mass, with clamp connections; wall thin to 1.6 um
thick. Caulocystidia not observed. Basidiospores (Fig. 10b) 5.2-7.2 X 2.8-3.6 um (n =
27. x = 6.0 X 3.0 pm; Q = 1.75-2.29, Qx = 1.98), pip-shaped in side view, ellipsoid to
subcylindrical in profile, hyaline; wall thin, smooth.
Comment: The protologue description by Montagne (1854) of the type specimen
coincides with habit and stature of modern day L. boryana. Montagne (1854) noticed a
veil, scales on the pileus, tough consistency, and seceding lamellae typical of Lentinula.
Cheilocystidia are not readily distinguished in size from basidioles, but distinct by their
shape, but are similar to the cheilocystidia of the type specimen of A. boryanus. Heavy
mold infestation made detection of caulocystidia impossible. Pileus epicutis
gelatinization is similar to that observed in other type specimens under A. boryanus.
Collection Leprieur no. 980 is designated here as the explicit lectotype of P. /eprieurii.
The basidiome represents a younger stage of the paratype collection Leprieur no. 981,
which we also have examined.
_ Fig. 7. L. detonsus. a) cheilocystidia, b) caulocystidia, c) spores. Scale bar = 10 pm.
Fig. 8. L. proximus. a) cheilocystidia, b) spores. Scale bar = 10 um.
Fig. 9. L. puiggarii. a) cheilocystidia, b) caulocystidia, c) spores. Scale bar = 10 um.
Fig. 10. P. leprieurii. a) cheilocystidia, b) spores. Scale bar = 10 jum.
228
SUMMARIZED NOMENCLATORS (for detailed nomenclators see above)
Lentinula boryana (Berk. & Mont.) Pegler. 1975. Kavaka 3:19.
= Agaricus boryanus Berkeley & Montagne. 1849. Ann. Sci. Nat., Bot. Ser. 3, 11:
325
= Lentinus detonsus Fries. 1851. Nov. Symb. Mycol. [Saccardo 5:597]
= Panus leprieurii Montagne. 1854. Ann. Sci. Nat., Bot. Ser. 4, 1: 121 [non Lentinus
leprieurii Mont. 1854]
= Agaricus ixodes Montagne. 1854. Ann. Sci. Nat., Bot. Ser. 4, 1: 95.
= Lentinus cubensis Berkeley & Curtis. 1869. J. Linn. Soc., Bot. 10: 302.
= Lentinus proximus Berkeley & Curtis. 1869. J. Linn. Soc., Bot. 10:302.
= Armillariella umbilicata Patouillard. 1899. Bull. Soc. Mycol. France. 15: 191.
= Lentinus puiggarii Spegazzini. 1919. Bol. Acad. Nac. Cienc. Cordoba 23: 387.
Lentinula raphanica (Murrill) Mata & R.H. Petersen comb. nov.
= Armillaria raphanica Murmill. 1943. Mycologia 35: 35:422.
= Gymnopus alliaceus Murrill. 1943. Mycologia 35: 425.
ACKNOWLEDGEMENTS
We thank the mycology curators at the following institutions for arranging herbarium
loans of pertinent specimens: Harvard University (Dr. Donald Pfister), Royal Botanic
Gardens, Kew (Dr. David N. Pegler, Dr. B Spooner), University of Florida (Dr. James
Kimbrough), New York Botanical Garden (Dr. Roy E. Halling), Herbario del Instituto
de Botanica Carlos Spegazzini (Dr. Arambari), and Laboratoire de Cryptogamie, Paris
(Dr. Bart Buyck). We also thank Dr. Tim Baroni for reviewing this manuscript. This
research was partially funded by NSF DEB 9521526 (PEET program).
BIBLIOGRAPHY
Earle, F.S. 1909. Genera of North American Gill Fungi. Bull. N.Y. Bot. Gard. 5(18):
375-462.
Greuter, W. 2000. /nternational Code of Botanical Nomenclature. Regnum Vegetabile,
Vol 138. Koeltz Scientific Books. Germany. 474 p.
Guzman, G., Salmones, D. & Tapia, F. 1997. Lentinula boryana: morphological
variations, taxonomic position, distribution and relationships with Lentinula edodes and
related species. Rep. Tottori Mycol. Inst. 35: 1-28.
Hibbett, D. S., Hansen, K. & Donoghue, M. J. 1998. Phylogeny and biogeography of
Lentinula inferred from an expanded rDNA dataset. Mycol. Res. 102: 1041-1049.
Horak, E. 1968. Synopsis generum Agaricalium. Bei. zur Kryptogamenfl. Schweiz.
Band XII. 741 p.
Kornerup, A. and Wanscher, J.H. 1978. Methuen Handbook ae Colour. 3rd ed.
Methuen Co. London. 243 p + 30 color plates.
Mata, J.L., Petersen, R.H. and Hughes, K.W. 2000. Lentinula of the New World.
Program, hehe Meeting, Mycol. Soc. Amer. 2000, Abstracts p. 14.
Metzler, S. and Metzler, V. 1992. Texas Mushrooms. A field guide. University of
Texas Press, Austin. 350 p.
Murrill, W.A. 1916. North American Flora. N.Y. Bot. Gard. Vol. 9(5): 297-374.
papte)
-Murrill, W.A. 1939. Additions to the Florida Fungi-I. Bull. Torrey Bot. Club. 66: 29-
ats
Murrill, W.A. 1943. Some southern novelties. Mycologia 35: 422-433.
Nicholson, M.S., Bunyard, B.A. and Royse, D.J. 1997. Phylogeny of the genus
Lentinula based on ribosomal DNA restriction fragment length polymorphism analysis.
Mycologia 89(3): 400-407.
Pegler, D.N. 1975. The classification of the genus Lentinus Fr. (Basidiomycota).
Kavaka 3: 11-20.
Pegler, D.N. 1983a. The genus Lentinula (Tricholomataceae tribe Collybieae). Sydowia
per. II 36: 227-239.
Pegler, D.N. 1983b. The genus Lentinus. A world monograph. Kew Bull. Add. Ser. 10,
281 p.
Petersen, R. H., Hughes, K. W. & Mata, J. L. 1998. Lentinula boryana intersterility
groups and RFLP analysis. Inoculum 49: 41.
Ridgway, R. 1912. Color Standards and Color Nomenclature. Washington, D.C.,
published privately (by the author). 43 pp + 53 color pls.
Singer, R. 1952. Type Studies on Agarics III. Lilloa 25: 463-514.
Singer, R. 1955. Type Studies on Basidiomycetes. VIII. Sydowia 9: 367-431.
MYCOTAXON
Volume LXXIX, pp. 231-233 July-September 2001
DOASSANSIOPSIS EURYALIS SP. NOV.
(USTILAGINOMYCETES)
KALMAN VANKY
Herbarium Ustilaginales Vanky (HUV)
Gabriel-Biel-Str. 5, D-72076 Tiibingen, Germany
e-mail: VANK Y.K @cityinfonetz.de
Key words: smut fungi, Euryale ferox, India.
ABSTRACT
A new smut fungus, Doassansiopsis euryalis is described and illustrated on
the cultivated Euryale ferox from India.
Euryale ferox Salisb. (Nymphaeaceae), a spiny water plant, is cultivated on
commercial scale in China and India for its edible seeds rich in starch. In India, it
is. parasitised by a fungus, producing golden-yellow coloured, irregular,
cerebriform swellings on the leaves. The study of a diseased leaf, preserved in
IMI, revealed that the parasite is an unknown smut fungus:
Doassansiopsis euryalis Vanky, sp. nov.
Typus in matrice Euryale ferox Salisb., India, North Bihar, sine loco et die,
comm. V. Jha, Sept. 1989. Holotypus in IMI 335137, isotypus in Herbario Ustil.
‘Vanky, HUV 19510.
Sori in foliis hypertrophyam bullatam, iregulariter cerebriformem et
deformationem, 0,5—5 cm. diametro, vel illas confluentes majores producentes et
idonei occupationis areas magnas, venis non limitatas, aureoflavas superficiei
foliorum, cum glomerulis sporarum in telis hospitis immersis. Venae folii soris
inclusae sicut lineae carminorubreae conspicuae. Glomeruli sporarum globosi,
ovoidei, ellipsoidales vel parum irregulares, 80-170 x 100-230 um, pallide
flavidobrunnei, compositi e massa centrali parenchymatica telae fungalis,
circumdata strato sporarum elongatarum et strato externo, corticali cellularum
parvarum sterilium. Sporae radialiter elongatae, parum irregulares, lateraliter
232
Fig. 1 A leaf segment of Euryale ferox with bullate, irregular, cerebriform,
hypertrophied sori of Doassansiopsis euryalis Vanky (type). Bar = 1 cm.
Fig. 2 Part of a spore ball of Doassansiopsis euryalis with a thin cortical layer of
small, sterile cells (c), radially elongated spores (s), and a central mass of
parenchymatous fungal tissue of empty cells (p). Hand-cut section embedded
in lactophenol with cotton blue (type). Bar = 10 um.
233
compressae, raro subcuneiformes, 5,5—10,5 x 16-30 um, pallide flavae, infra
corticem, subpolyedrice irregulari, 5,5—10,5 x 6,5—12 jm; pariete aequaliter
crasso, cca. 0,5 um, levi. Cellulae steriles centrales subglobosae, ovoideae,
ellipsoidales usque parum irregulares, lateribus compressis, magnitudine variae,
5,5—10,5 x 5,5-12 um, hyalinae vel pallide flavae, vacuae; pariete tenui, aequali,
cca. 0,5 um, levi. Cellulae steriles corticales plerumque tangentialiter deplanatae,
quadrangulares vel subcuneiformes, radialiter 3-5,5 um latae, si subcuneiformes
usque ad 8 um longae, tangentialiter 4-8 um longae; pariete tenui, aequali, cca.
0,5 pm, levi.
Sori (Fig. 1) in the leaves producing bullate, irregularly cerebriform
hypertrophy and deformation, 0.5—5 cm in diameter or larger by confluence and
may cover large areas of the leaf surface, not delimited by the veins, golden-
yellow coloured, with spore balls embedded in the host tissue. The leaf veins
within the sori appear as carmine-red lines. Spore balls globose, ovoid,
ellipsoidal or slightly irregular, 80-170 x 100-230 um, pale yellowish-brown,
composed of a central mass of parenchymatous fungal tissue surrounded by a
layer of elongated spores and an outer, cortical layer of small, sterile cells.
Spores (Fig. 2, "s") radially elongated, slightly irregular, laterally compressed,
rarely subcuneiform, 5.5—10.5 x 16-30 ym, pale yellow, the distal side, beneath
the cortex, is subpolyhedrally irregular, 5.5—10.5 x 6.5—12 tym; wall evenly thick,
c. 0.5 wm, smooth. Central sterile cells (Fig. 2, "p") subglobose, ovoid,
ellipsoidal to slightly irregular with compressed sides, variable in size, 5.5—10.5 x
5.5—-12 pm, hyaline or pale yellow, empty; wall thin, even, c. 0.5 um, smooth.
Cortical sterile cells (Fig. 2, "c") usually tangentially flattened, quadrangular or
subcuneiform, radially 3—5.5 1m wide, when subcuneiform up to 8 um long,
tangentially 4—8 jm long; wall thin, even, c. 0.5 um, smooth.
On Nymphaeaceae: Euryale ferox Salisb.; N.E. India. Known only from the
type collection.
Beside the host plant and the strongly hypertrophied, cerebriform, golden-yellow
sori, Doassansiopsis euryalis has very typical long and narrow spores. Of the
nine known Doassansiopsis species two are on members of Nymphaeaceae:
D. nymphaeae (H. & P. Sydow) Thirum., type on Nymphaea stellata Willd.,
India, and D. ticonis M. Piepenbr., type on Nymphaea blanda G. F. W. Meyer,
Costa Rica. The spores of D. nymphaeae are 13-16 wm long, those of D. ticonis
12-16 um long.
ACKNOWLEDGEMENTS
I am grateful to Dr. S. Toth (G6éd6ll6, Hungary) for providing the Latin
description, to Dr. R. Berndt (Tiibingen, Germany) for reading the manuscript
and serving as pre-submission reviewer, and to Dr. J. David, Herbarium IMI
(Egham, UK) for unidentified smut fungi, and for the isotype of Doassansiopsis
euryalis.
ra
ov
MYCOTAXON
Volume LXXIX, pp. 235-246 July-September 2001
PHYLOGENETIC RELATIONSHIPS OF ASTERODON AND
ASTEROSTROMA (BASIDIOMYCETES), TWO GENERA WITH
ASTEROSETAE
Tobias Wagner
Institute of Botany, University of Regensburg, D-93040 Regensburg, Germany
tobias. wagner @biologie.uni-regensburg.de
Abstract
The occurrence of asterosetae in Asterodon and Asterostroma suggests a close
relationship of these genera, whereas other morphological and anatomical features
point at a polyphyletic origin. Using a dataset of 26 taxa, the relationships and the
assignments of Asterodon and Asterostroma are studied by molecular sequence data
of a region of the large subunit of the nuclear encoded ribosomal DNA. Taxon
sampling includes representatives of the Hymenochaetales, the Lachnocladiales, the
Russulales and the Polyporales. According to the phylogenetic analysis, Asterodon
and Asterostroma are not closely related. Asterodon is evidently placed within the
Hymenochaetales. A sister group to this genus was not found with confidence within
the hymenochaetoid taxa included in this study. Asterostroma is placed in the
Lachnocladiales, close to Vararia and Dichostereum. The two evolutionary lineages,
Asterodon and Asterostroma, in which asterosetae convergently occur, are discussed
referring to morphological and anatomical characteristics.
Key words: molecular systematics, ribosomal DNA, Hymenochaetales,
Lachnocladiales
Introduction
The two aphyllophoroid genera Asterodon Pat. and Asterostroma Massee, both
exhibit a significantly ramified structure (Figs. 1, 2), the asteroseta (Corner, 1948;
Parmasto, 1970; Jiilich, 1984; Hallenberg & Eriksson, 1985; Boidin et al., 1997). The
unique shape of these eponymous setae implies a homologous development and a
close relationship (Patouillard, 1900; Bourdot & Galzin, 1928; Donk, 1933).
Asterodon ferruginosus, the single species of the genus, is quite rare to find, and
the distribution is restricted to Northern Europe (Sweden, Norway, Finland), France,
Siberia, Asian Far East and Northern America (Corner, 1948; Parmasto, 1970; Jiilich,
1984). The species grows on rotten coniferous trees and less often on angiosperms.
The basidiocarps are resupinate, felted-membraneous and produce a_ hydnoid
hymenophore. Basidiospores are hyaline, smooth and ellipsoid, the hyphal system is
dimitic. Asterosetae sometimes are regarded as another type of hyphae and thus the
hyphal system of Asterodon is described as trimitic (Parmasto 1970; Hallenberg &
236
Eriksson 1985); Parmasto (1970) creates the terms asterodimitic and asterotrimitic.
Several characteristics, such as the xanthochroic reaction, the cause of a white rot, the
yellow to deep brown trama, the clampless hyphae and the hymenial setae (Fig. 3),
indicate a taxonomic position within the Hymenochaetaceae Donk (Hymenochaetales
Oberwinkler; Corner, 1948; Parmasto, 1970; Oberwinkler, 1977; Fiasson & Niemela,
1984; Jiilich, 1984; Hansen & Knudsen, 1997). Another important taxonomic hint are
the imperforated septal pore caps (Miiller et al., 2000), which are assumed as
characteristic within the Hymenochaetales (Moore, 1980; Keller, 1997). As next
relatives within the Hymenochaetales the hydnoid genus Hydnochaete Bres. and the
corticioid genus Hymenochaete Lév. are regarded (Ryvarden, 1982).
The approximately 20 species of the genus Asterostroma are mostly tropical. The
corticioid basidiocarps are resupinate and membraneous. Based on characteristics of
the basidiospores, the genus is divided in the two subgenera Austroasterostroma
Parm. (basidiospores not amyloid and smooth) and Asterostroma (basidiospores
amyloid and smooth or tuberculate) and the latter into the two sections Laevispora
Parm. (basidiospores smooth) and Asterostroma (basidiospores _ tuberculate;
Parmasto, 1970). The hyphal system is monomitic (asterodimitic), built up by
clampless and hyaline generative hyphae. But the character of the hyphal system
does not seem to be homogeneous within Asterostroma, because the existence of
dimitic (asterotrimitic) species is mentioned (Parmasto, 1970; Hallenberg &
Eriksson, 1985; Boidin, 1997).
The taxonomic position of Asterostroma is still controversial. The occurrence of
asterosetae suggests a close affinity with the Hymenochaetaceae (Jiilich, 1984)
respectively Hymenochaetales (Hawksworth et al., 1995), but the perforated septal
pore caps (Miiller et al., 2000) are untypical. The occurrence of thin-walled cystidia
in the hymenium, which seem to be homologous to the gloeocystidia of
Lachnocladium Lé&v., indicates a close relationship to the Lachnocladiaceae Reid
(Lachnocladiales Jiilich; Corner, 1948; Reid, 1965; Parmasto, 1970; Oberwinkler,
1977; Hansen & Knudsen, 1997). The asterosetae of Asterostroma can be regarded as
a transition to the dichohyphidia of Vararia P. Karst. (Corner 1948). Based on the
occurrence of dichohyphidia within tropical species of Hymenochaete, Corner (1948)
assumes this genus as possibly the critical group for the explanation of an affinity of
Asterodon, Asterostroma and Vararia. Referring to the common occurrence of
gloeocystidia and tuberculate basidiospores, Oberwinkler (1977) suggests a close
relationship of Asterostroma, the Lachnocladiaceae and the aphyllophoralean
Russulales Sing.
Comparing all the data at hand a close relationship between Asterodon and
Asterostroma is unlikely. The taxonomic position of the two genera, predominately
with regard to the natural groupings within the Hymenochaetales (Murrill, 1904,
1905, 1907; Donk, 1969; Fiasson & Niemela, 1984; Dai, 1995, 1999; Fischer, 1996;
Niemela et al. 2001; Wagner & Fischer, 2001) was not yet extensively discussed.
This study aims to evaluate the significance of morphological and anatomical
characters mentioned above, compared with a phylogenetic analysis of nuc-lsu
sequencing data for a selected range of taxa. Taxon sampling included
representatives of Asterodon and Asterostroma sect. Asterostroma, of the
Hymenochaetales, the Lachnocladiales, the Russulales and the Polyporales (Herter)
Gaum. (Tab. 1).
pe ¥
Within the Hymenochaetales poroid species were chosen, to represent major
subgroups within Phellinus s. 1. Quél. (Phellinus s. str., Fomitiporia Miurrill,
Fuscoporia Murrill, Phellinidium Fiasson & Niemela, Phellopilus Niemela, Wagner
& Fischer, Porodaedalea Murrill, Phylloporia Murrill) and Inonotus s. l. P. Karst.
(nonotus s. str., Inocutis Fiasson & Niemela, Inonotopsis Parm., Onnia P. Karst.),
furthermore the genus Coltricia S.F. Gray. Additional species from the corticioid
genus Hymenochaete and from the irpicoid genus Hydnochaete were included.
Dichostereum Pilat and Vararia species represent the corticioid Lachnocladiales. The
Russulales are represented by the poroid Bondarzewia montana (Quél.) Singer and
agaricoid Russula violacea Quél. From the Polyporales Fomes fomentarius (L.: Fr.)
Fr. and Fomitopsis pinicola (Sw.: Fr.) P. Karst. were chosen. Tremella foliacea
(Pers.: S.F. Gray) Pers. (Heterobasidiomycetes) was selected as an outgroup. For the
26 species a part of the nuclear large subunit of the ribosomal DNA (nLSU rDNA)
was sequenced (24 species), respectively sequences were obtained from GenBank (2
species; see Tab. 1).
Material and Methods
Table |. List of taxa, included in the phylogenetic analysis; source of fungal material
(HB: Helmut Besl, YCD: Yu-Cheng Dai, MF: Michael Fischer, TN: Tuomo
Niemelaé, TW: Tobias Wagner, REG: Herbarium of the University of
Regensburg) and sequence data base accession number.
Species Origin of stocks (stock Substrate Accession
number) number
Asterodon ferruginosus Pat. Finland (YCD 3186) REG ' on fallen trunk of AF323735
Pinus sylvestris.
Asterostroma medium Bres. Germany (CBS 119.50) unknown AF323736
Asterostroma ochroleucum Bres. Germany (HB 9/89) REG on dead wood AF323737
Coltricia perennis (L.: Fr.) Murrill Germany (MF 92-96) REG ongroundunder AF311004
Pinus sylvestris
Dichostereum durum (Bourd. & Galz.) Pilat France (CBS 707.81) dead stump of AF323738
Carpinus spec.
Dichostereum effuscatum (Cooke & Ellis) USA (CBS 516.80) Betula nigra AF323739
Boidin & Lanquetin
Fomes fomentarius (L.: Fr.) Fr. Germany (TW 85) REG Fagus sylvatica AF311047
Fomitiporia punctata (P. Karst.) Murrill Germany (MF 85-74) REG = Corylus avellana =AF311007
(=Phellinus punctatus (Fr.) Pilat)
Fomitopsis pinicola (Sw.: Fr.) P. Karst. Germany (TW 321) REG Betula AF311048
Fuscoporia ferruginosa (Schrad.: Fr.) Murrill Germany (MF 82-930) REG Fagus sylvatica AF311032
(=Phellinus ferruginosus (Schrad.: Fr.) Pat.)
Hydnochaete duportii Pat. France; La Réunion (CBS Casuarina AF323740
941.96) equisetifolia
Hymenochaete rubiginosa (Dicks.: Fries) Germany (TW 22.9.97) REG on dead Quercus AF323741
eve spec.
Inocutis rheades (Pers.) Fiasson & Niemelaé Germany (TW 385) REG Populus tremula AF311019
(=/nonotus rheades (Pers.) Bond. & Sing.)
Inonotopsis subiculosa (Peck) Parm. China (YCD 2203) REG Abies alba AF311020
(=Inonotus subiculosus (Peck) J. Erikss. &
Strid)
Inonotus hispidus (Bull.: Fr.) P. Karst. Germany (MF 92-829) REG Fraxinus excelsior AF311014
Onnia triquetra (Fr.) Imazeki Germany (TW 411) REG Pinus sylvestris AF311024
(=/nonotus triqueter (Fr.) P. Karst.)
238
Phellinidium ferrugineofuscum (P. Karst.) Finland (TN 6121) REG Picea abies AF311031
Fiasson & Niemela
(=Phellinus ferrugineofuscus (P. Karst.)
Bourd. & Galz.)
Phellinus igniarius (L.: Fr.) Quél. Germany (MF 83-1110a) Salix fragilis AF311033
REG
Phellopilus nigrolimitatus (Romell) Niemela, Germany (MF 85-823) REG Larix decidua AF311036
Wagner & Fischer
(=Phellinus nigrolimitatus (Romell) Bourd. &
Galz.)
Phylloporia ribis (Schumach.: Fr.) Ryvarden Germany (MF 82-828) REG Ribes uva-crispa AF311040
(=Phellinus ribis (Schum.: Fr.) P. Karst.)
Porodaedalea pini (Brot.: Fr.) Murrill France (TW 11.4.97) REG dead wood of AF311037
(=Phellinus pini (Brot.: Fr.) Ames) Pinus spec.
Tremella foliacea (Pers.: S.F. Gray) Pers. Germany (MF 97-1117) deciduous wood AF311051
REG
Vararia gallica (Bourd. & Galz.) Boidin France (CBS 656.81) unknown AF323742
Vararia ochroleuca (Bourd. & Galz.) Donk France; Dr6me (CBS litter of Quercus =AF323743
465.61) spec. and
Juniperus spec.
GenBank:
Russula violacea Qué. AF218559
Bondarzewia montana (Quél.) Sing. AF042646
Scanning electron microscopy
Small sections from context and hymenium of herbarized fruiting bodies were
fixed on metal stubs. The samples were coated with a 1.4 nm gold-palladium layer in
a Polaron SEM SC 515 Sputter Coater. Microscopy and photography were done with
a Digital Scanning Microscope DSM (Zeiss).
DNA isolation
DNA was isolated from cultured mycelia or herbarium specimens. Cultures were
grown on 2% malt extract agar, ME (2% malt extract, 2% agar, 0.05% yeast extract
in distilled water) at 23°C. Total DNA was isolated as described by Lee & Taylor
(1990). DNA pellets were air-dried and were resuspended in 100 uL TE buffer (10
mM Tris HCl, 1mM EDTA, pH 8.0). Quantity and quality of DNA were examined
on 1% agarose gels (Biorad).
PCR amplification and DNA sequencing
DNA usually was diluted 1:1000 in distilled water. Approximately 1400 bases
(b) of the nLSU rDNA were amplified using Taq polymerase (Eurogentec) and
primers LROR (ACC CGC TGA ACT TAA GC) and LR7 (TAC TAC CAC CAA
GAT CT) on a Biometra TRIO-Thermoblock, using the following parameters: 94° C
denaturation step (1 min.), 47° C annealing step (45 sec.), and 72° C primer
extension (2 min.). The cycle was repeated 37 times. A final incubation step at 72° C
(7 min.) was added after the final cycle. PCR products were purified with the
QlIAquick PCR Purification Kit (Qiagen). Cycle sequencing reactions were set up
with primers LROR and LRS (TCC TGA GGG AAA CTT CG) using the ABI
PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied
Biosystems, CA). Parameters for the reactions were according to Binder et al. (1997).
239
Cycle sequencing products were run on an ABI 377 automated DNA sequencer
(Applied Biosystems).
Phylogenetic analysis
Approximately 900 b of the sequences, starting from primer LROR, were
automatically aligned using ClustalX (Thompson et al., 1997). A final alignment was
performed by eye. Gaps in the alignment, due to insertions and deletions, were
treated as missing data. All positions have been included in the final alignment. The
sequences obtained have been deposited in GenBank (nos. see Tab.1). The distance
analysis was calculated with components of the PHYLIP 3.5c packet (Felsenstein,
1995) integrated in ClustalX. The distance matrix was generated using Kimura 2-
parameter distances, weighting transition:transversion ratio 2:1. Neighbour-joining
(NJ, standard parameters) was used to calculate the tree. To estimate branching order,
a bootstrap analysis (Felsenstein, 1985) was run with 1000 heuristic replicates.
Maximum parsimony (MP) analysis was performed with PAUP 4.0b2 (Swofford,
1999) using heuristic search, with tree-bisection-reconnection (TBR) branch-
swapping algorithm, MulTrees=on, and zero length branches collapsed. Maxtrees
option was set to autoincrease. Bootstrap analysis was run with 100 replicates.
Both, the NJ tree and the MP tree, were rooted with Tremella foliacea.
Results
The alignment of the 26 sequences results in 898 sites with 371 variable
characters, of which 242 characters are parsimony informative. A length variation of
the sequenced nLSU rDNA region separates the taxa investigated in two distinct
groups. Sequences of the Lachnocladiales (Dichostereum and Vararia) and
Asterostroma ranged between 822 b and 829 b. The sequences of the remaining taxa,
including Asterodon, vary from 853 b (Coltricia perennis (L.: Fr.) Murrill) to 879 b
(Phylloporia ribis (Schuhmach.: Fr.) Ryvarden). The length differences of 50 b — 57
b are caused by insertions/deletions, which are located at positions 409 to 417 and
548 to 577 in the final alignment. The fragment of the outgroup Tremella foliacea is
849 b long.
The MP analysis produces 2 trees, each with 1062 steps, consistency index (CI)
0.50, retention index (RI) 0.58 and rescaled consistency index (RC) 0.29. The MP
trees (data not shown) show the same topology as the NJ tree (Fig. 4). The strict
consensus of the two MP trees (Fig. 5) and the NJ tree (Fig. 4) show both
Hymenochaetales (MP, 86%; NJ, 96%) and Lachnocladiales (MP, 100%; NJ, 100%)
well supported as monophyletic groups. Within the Hymenochaetales, internal nodes
are weakly supported by bootstrap values.
Asterodon ferruginosus is distincly included in the Hymenochaetales. It clusters
next to Phellopilus nigrolimitatus (Romell) Niemela, Wagner & Fischer, Fuscoporia
ferruginosa Schrad.: Fr.) Murrill, Inonotopsis subiculosa (Peck) Parm., Phellinidium
ferrugineofuscum (P. Karst.) Fiasson & Niemela and Coltricia perennis (MP, 58%;
NJ, 60%). Hymenochaete rubiginosa (Dicks.: Fr.) Lév. and Hydnochaete duportii
Pat. (MP, 92%; NJ, 100%), respectively Onnia triquetra (Fr.) Imazeki and
Porodaedalea pini (Brot.: Fr.) Ames (MP, 53%; NJ, 98%) are sister groups. Within
the Lachnocladiales, Asterostroma (A. ochroleucum Bres., A. medium Bres.) is the
240
seuhebseesaesersejeasarsariarsepiaidesderserrs
ban tetesarsaescedystesesarnstntindeepn ah
Figs. 1-3. Scanning electron micrographs of an asteroseta from Asterodon ferruginosus
(1), of an asteroseta from Asterostroma ochroleucum (2) and of a section from
the hydnoid hymenophore of Asterodon ferruginosus with hymenial setae (3):
67
98
74
100
96
61
61
100
100
100
98
99
97
100
0.01
241
Inocutis rheades
Inonotus hispidus
Phylloporia ribis
Phellinus igniarius
Porodaedalea pini
Onnia triquetra
82
Fomitiporia punctata
Hymenochaete rubiginosa
Hydnochaete duportii
sajejaeyoouswAY
Phellinidium ferrugineofuscum
Inonotopsis subiculosa
Phellopilus nigrolimitatus
Asterodon ferruginosus
Fuscoporia ferruginosa
Coltricia perennis
se Asterostroma medium
Asterostroma ochroleucum
Vararia gallica
Vararia ochroleuca
sajeipejoouyse7y
Dichostereum effuscatum
Dichostereum durum
Fomes fomentarius
Fomitopsis pinicola
Bondarzewia montana
Russula violacea
Tremella foliacea
Fig. 4. Phylogram obtained by Neighbour-joining analysis of nLSU rDNA sequences
of 26 taxa from the Hymenochaetales, the Lachnocladiales, the Polyporales
and the Russulales. The tree was rooted with Tremella foliacea. Bootstrap
values greater than 50% of 1000 replicates are indicated above the branches.
242
58
92
86
53
100
99
87
100
66
96
78
81
90
Fig. 5. Strict consensus tree of 2 most parsimonious trees (1062 steps) obtained from
parsimony analysis of nLSU rDNA sequences of 26 taxa from the
Hymenochaetales, the Lachnocladiales, the Polyporales and the Russulales.
The tree was rooted with Tremella foliacea. Bootstrap values greater than 50%
Phellinidium ferrugineofuscum
Coltricia perennis
Fuscoporia ferruginosa
Asterodon ferruginosus
Phellopilus nigrolimitatus
Inonotopsis subiculosa
Hymenochaete rubiginosa
Hydnochaete duportii
Porodaedalea pini
Onnia triquetra
Inocutis rheades
Phellinus igniarius
Fomitiporia punctata
Phylloporia ribis
Inonotus hispidus
Asterostroma medium
Asterostroma ochroleucum
Vararia gallica
Vararia ochroleuca
Dichostereum effuscatum
Dichostereum durum
Fomes fomentarius
Fomitopsis pinicola
Bondarzewia montana
Russula violacea
Tremella foliacea
of 100 replicates are indicated above the branches.
sajeyeaeyoouowApY
sojeipejoouyoe
243
sister group (MP, 99%; NJ, 100%) to Vararia (V. gallica (Bourd. & Galz.) Boidin, V.
ochroleuca (Bourd. & Galz.) Donk). Asterodon and Asterostroma are evidently two
independent lineages within the Hymenochaetales and the Lachnocladiales. The
remaining taxa (Fomes (Fr.) Fr., Fomitopsis P. Karst., Bondarzewia Sing. and
Russula Pers.) form a third clade (MP, 81%; NJ, 96%), which appears as a sister
clade to the Lachnocladiales (MP, 96%; NJ, 98%).
Discussion
The topologies of both the NJ tree and the MP tree (Figs. 4, 5), clearly
demonstrate the two genera Asterodon and Asterostroma as not closely related to
each other. In addition, the phylogenetic analysis supports the view of a
monophyletic origin of the Hymenochaetales and the Lachnocladiales (Jahn, 1963,
1981; Domanski et al., 1973; Oberwinkler, 1977; Julich 1984; Corner, 1991;
Ryvarden, 1991; Hibbett & Donoghue, 1995; Wagner & Fischer, 2001) and a
polyphyletic origin of Phellinus s. l. and Inonotus s. l. (Murrill, 1904, 1905, 1907;
Donk, 1969; Fiasson & Niemela, 1984; Dai, 1995, 1999; Fischer, 1996; Niemela et
al. 2001; Wagner & Fischer, 2001).
Asterodon ferruginosus is distinctly positioned within the Hymenochaetales. This
correlates with the typical characteristics of this order, occurring within Asterodon, as
mentioned above. It is related to Phellopilus, Phellinidium, Inonotopsis, Fuscoporia
and Coltricia, but none of them is a distinct sister group. By the asterosetae and the
hydnoid hymenophore, Asterodon is well separated from all these taxa. Additional
morphological and anatomical differences support this separation. The most
characteristic are: Phellopilus nigrolimitatus varies by its cylindrical basidiospores
and a dark line in the context; Phellinidium ferrugineofuscum is different by the
abundant macrosetae in the trama; Fuscoporia ferruginosa has typical crystal hyphae
in the pores; Inonotopsis subiculosa is different by the absence of setae; Coltricia
perennis also misses the setae, produces stipitate basidiocarps and, besides, a
mycorrhizal association with pine and bearberry is suggested (Danielson, 1984). A
close relationship to the irpicoid and the corticioid taxa is not supported by the
molecular analysis. It is interesting to note that the corticioid Hymenochaete and the
irpicoid Hydnochaete appear as sister groups, positioned within poroid
representatives of the Hymenochaetales. So, on the basis of the generated molecular
dataset, the suggested evolutionary lineage from corticioid to hydnoid or to poroid
basidiocarps (Ryvarden, 1991) is not supported within the Hymenochaetales. A
common hydnoid ancestor for Asterodon and Hydnochaete is unlikely; this type of
hymenophore seems to have developed independently within the two genera.
Asterostroma ochroleucum and A. medium stand quite distant from Asterodon
and the Hymenochaetales. Asterostroma is the sister group to Vararia within the
Lachnocladiales. A homogeneous characteristic within the genera of the
Lachnocladiales clade, Asterostroma, Vararia and Dichostereum, are the
gloeocystidia (Parmasto, 1970; Jiilich, 1984; Hallenberg & Eriksson, 1985; Boidin et
al., 1997; Boidin & Michel, 1998). However differences in the exospore of the
basidiospores are significant. They vary from tuberculate (Asterostroma subgen.
244
Asterostroma sect. Asterostroma) over ornamented (Dichostereum) to smooth
(Vararia, Asterostroma subgen. Austroasterostroma and Asterostroma_ subgen.
Asterostroma sect. Laevispora). The amyloidity of spore walls is also heterogeneous,
basidiospores of Asterostroma subgenus Austroasterostroma are not amyloid,
whereas basidiospores of the remaining taxa are amyloid. A close relationship of
Asterostroma and the Russulales, here represented by Russula and Bondarzewia, can
be rejected by the phylogenetic analysis. Although Russula and Bondarzewia have
ornamented exospores and gloeoplerous hyphae, they form no distinct clade with the
Lachnocladiales. A relationship of Asterostroma and Vararia to Hymenochaete also
is not indicated.
The results of the phylogenetic analysis (Figs. 4, 5) suggest that asterosetae
occurring within Asterodon and Asterostroma have no homologous origin, but a
parallel, independent development can be assumed.
The asterosetae of Asterodon (Fig. 1) have to be regarded as an apomorph
formation of the typical hymenochaetoid setae. In Asterodon the asterosetae are
reduced to the basal area of the basidiocarp. The formation of the different types of
setae within Asterodon (asterosetae, extrahymenial and hymenial setae), were
described by Corner (1948) as dependent from the position within the basidiocarp, in
correlation with so called form-factors. The question why the formation of
asterosetae within the Hymenochaetales only appears in Asterodon ferruginosus,
remains unsolved. Asterosetae of Asterodon are not dextrinoid.
The asterosetae of Asterostroma (Fig. 2) can be suggested to have derived from
the dichohyphae of Dichostereum and Vararia, both structures showing a dextrinoid
reaction in Melzer (Hallenberg & Eriksson, 1985; Boidin et al., 1997). Within
Asterostroma asterosetae occur abundantly in the whole basidiocarp. To emphasize
the different taxonomic positions of Asterodon and Asterostroma, the stellate
structures should be termed differently. The term asterosetae should be restricted to
Asterodon, concerning Asterostroma the term asterohyphae would be adequate.
Based on differences in staining behaviour and anatomy of the basidiospores .a
possibly polyphyletic origin of the genus Asterostroma should be proved by the
inclusion of species from the subgenus Austroasterostroma and the subgenus
Asterostroma section Laevispora. These were not available for this study.
Acknowledgements: Special thanks go to Drs Helmut Besl, Yu-Cheng Dai, Michael
Fischer and Tuomo Niemela for providing specimens. Manfred Binder, Michael
Fischer and Tuomo Niemela are thanked for reviewing the manuscript.
References
Binder, M., Besl, H. & Bresinsky, A. (1997). Agaricales oder Boletales?
Molekularbiologische Befunde zur Zuordnung einiger umstrittener Taxa.
Zeitschrift fiir Mykologie 63, 189-196.
Boidin, J., Lanquetin, P. & Gilles, G. (1997). Contribution a la conaissance du genre
Asterostroma Massee 1889 (Basidiomycotina). Bull. Soc. Mycol. France 113,
269-301.
245
Boidin, J. & Michel, H. (1998). Les genres Vararia et Dichostereum en Europe
(Basidiomycotina, Lachnocladiaceae). Bull. Soc. Mycol. France 114 (1), 1-4.
Bourdot, H. & Galzin, A. (1928). Hyménomyceétes de France. 761pp. Sceaux.
Corner, E. J. H. (1948). Asterodon, a clue to the morphology of fungus fruit bodies:
with notes on Asterostroma and Asterostromella. Transactions of the British
Mycological Society 31, 234-245.
Corner, E. J. H. (1991). Ad Polyporaceas VII. Beihefte zur Nova Hedwigia 101, 1-
1e75¢
Dai, Y.-C. (1995). Changbai wood-rotting fungi 3. The genus Phellinidium
(Basidiomycetes) and a new species, P. aciferum. Annales Botanici Fennici
32, 63-73.
Dai, Y.-C. (1999). Phellinus sensu lato (Aphyllophorales, Hymenochaetaceae) in
East Asia. Acta Botanica Fennica 166, 1-115.
Danielson, R. M. (1984). Ectomycorrhizal associations in jack pine stands in
northeastern Alberta. Canadian Journal of Botany 62, 932-939.
Domanski, S., Ortos, H. & Skirgielto, A. (1973). Fungi. Polyporaceae II (pileatae)
Mucronoporaceae II (pileatae), Ganodermataceae, Bondarzewiaceae,
Boletopsidaceae, Fistulinaceae. 332 pp. Warsaw, Poland.
Donk, M. A. (1933). Revision der niederlandischen Homobasidiomycetae-
Aphyllophoraceae. II. Med. Bot. Mus. Herb. Univ. Utrecht 9, 1-278.
Donk, M. A. (1969). Revision der niederlandischen Heterobasidiomycetidae und
Homobasidiomycetidae-Aphyllophoraceae. Bibliotheca Mycologica 21, 236-
259%
Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the
bootstrap. Evolution 39, 783-791. .
Felsenstein, J. (1995). PHYLIP (Phylogeny Inference Package) version 3.5c.
Distributed by the author. Department of Genetics, University of
Washington, Seattle.
Fiasson, J. L. & Niemela, T. (1984). The Hymenochaetales: a revision of the
European poroid taxa. Karstenia 24, 14-28.
Fischer, M. (1996). On the species complexes within Phellinus: Fomitiporia
revisited. Mycological Research 100, 1459-1467.
Hawksworth, D. L., Kirk, P. M., Sutton, B. C. & Pegler, D. N. (1995). Ainsworth &
Bisby’s Dictionary of the Fungi. Edition 8. CAB International: Wallingford,
UK.
Hallenberg, N. & Eriksson, J. (1985). The Lachnocladiaceae and Coniophoraceae of
North Europe. Fungiflora, 96 pp.
Hansen, L. & Knudsen, H. (1997). Nordic macromycetes. Vol. 3. Heterobasdioid,
aphyllophoroid and gastromycetoid basidiomycetes, 444 pp. Nordsvamp,
Copenhagen, Denmark.
Hibbett, D. S. & Donoghue, M. J. (1995). Progress toward a phylogenetic
classification of the Polyporaceae through parsimony analysis of
mitochondrial DNA sequences. Canadian Journal of Botany 73 (Suppl. 1),
S583-S861.
Jahn, H. (1963). Mitteleuropaische Porlinge (Polyporaceae s.1.) und ihr Vorkommen
in Westfalen (unter Ausschlu8 der resupinaten Arten). Westfdlische Pilzbriefe
4, 1-143.
246
Jahn, H. (1981). Die resupinaten Phellinus-Arten in Mitteleuropa mit Hinweisen auf
die resupinaten /nonotus-Arten und Poria expansa (Desm.) [= Polyporus
megaloporus Pers.]. Bibliotheca Mycologica 81, 37-151.
Jiilich, W. (1984). Die Nichtbldatterpilze, Gallertpilze und Bauchpilze, 626 pp. Gustav
Fischer Verlag: Stuttgart, Germany.
Keller, J. (1997). Atlas des Basidiomycetes vues aux microscopes electroniques, 173
pp., 324 pls. Union des Societes Suisses de Mycologie: Switzerland.
Lee, S. B. & Taylor, J. W. (1990). Isolation of DNA from fungal mycelia and single
cells. In: PCR protocols (ed. M. A. Innis, D. H. Gelfand, J. J. Sninsky & T. J.
White), pp. 282-287. Academic Press: San Diego, California.
Moore, R. T. (1980). Taxonomic significance of septal ultrastructure in the genus
Onnia Karsten (Polyporineae/Hymenochaetaceae). Botaniska Notiser 133,
169-175.
Miiller, W. H., Stalpers, J. A., van Aelst, A. C., de Jong, M. D. M., van der Krift, T.
P. & Boekhout, T. (2000). The taxonomic position of Asterodon,
Asterostroma and Coltricia inferred from the septal pore cap ultrastructure.
Mycological Research, 104 (12), 1485-1492.
Murrill, W. A. (1904). The Polyporaceae of North America-IX. Bulletin of the Torrey
Botanical Club 31, 593-610.
Murrill, W. A. (1905). The Polyporaceae of North America-XI. Bulletin of the Torrey
Botanical Club 32, 353-371.
Murrill, W. A. (1907). (Agaricales) Polyporaceae. North American Flora 9, 1-131.
Niemela, T., Wagner, T., Fischer, M. & Dai, Y.-C. (2001). Phellopilus gen. nov. and
its affinities within Phellinus sensu lato and Inonotus sensu lato
(Basidiomycetes). Annales Botanici Fennici 38, 51-62.
Oberwinkler, F. (1977). Das neue System der Basidiomyceten. In: Beitrdge zur
Biologie der niederen Pflanzen (ed. W. Frey, H. Hurka & F. Oberwinkler),
pp. 59-105. Gustav Fischer Verlag: Stuttgart, Germany.
Parmasto, E. (1970). The Lachnocladiaceae of the Soviet Union. With a key to the
boreal species, 168 pp., 105 pls. Tartu, Estonia.
Patouillard, N. (1900). Essai taxonomique sur les familles et les genres des
Hyménomycétes, 184 pp. Thesis, Paris, France.
Reid, D. (1965). A monograph of the stipitate stereoid fungi. 388pp. Wien.
Ryvarden, L. (1982). The genus Hydnochaete Bres. (Hymenochaetaceae). Mycotaxon
15, 425-447.
Ryvarden, L. (1991). Genera of Polypores, nomenclature and taxonomy. Synopsis
Fungorum 5, 363 pp. Fungiflora: Oslo, Norway.
Swofford, D. L. (1999). PAUP: phylogenetic analysis using parsimony, version
4.0b2. Smithsonian Institution, Washington, D.C.
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G.
(1997). The ClustalX windows interface: flexible strategies for multiple
sequence alignment aided by quality analysis tools. Nucleic Acids Research
24, 4876-4882.
Wagner, T. & Fischer, M. (2001). Natural groups and a revised system for the
European poroid Hymenochaetales (Basidiomycota) supported by nLSU
rDNA sequence data. Mycological Research 105, in press.
MYCOTAXON
Volume LXXIX, pp. 247-251 July-September 2001
A NEW SPECIES OF MYELOCHROA AND NEW RECORDS IN
THE LICHEN FAMILY PARMELIACEAE (ASCOMYCOTINA) FROM
SIKKIM, INDIA
P. K. DIVAKAR & D. K. UPRETI
Lichen Laboratory, National Botanical Research Institute, Rana Pratap Marg,
Lucknow-226 006, Uttar Pradesh, India
email: sanjeeva_n@yahoo.com
G. P. SINHA
Botanical Survey of India, Sikkim Himalayan Circle, Gangtok,
Sikkim-737 101, India
JOHN A. ELIX
Department of Chemistry, The Faculties, Australian National University,
Canberra, ACT 0200, Australia
email: John.Elix@anu.edu.au —
ABSTRACT : Myelochroa sikkimensis (Parmeliaceae)
from Sikkim, India is described as new to science. An
additional two species of Parmeliaceae are reported
for the first time from India.
KEY WORDS: Myelochroa sikkimensis, Arctoparmelia, Hypotrachyna
The genus Myelochroa was established recently (Elix & Hale 1987; Elix 1994a)
to accommodate species which differed from all the other members of
Parmelina sens. lat. in having a yellow-orange medulla (at least in part) due
to the presence of ergochromes (secalonic acids and/or eumitrins) and in
containing hopane triterpenes. At that time 19 species were recorded for the
genus, which had a predominantly East Asian - North American
distribution. Since then several new species and new combinations of
Myelochroa have been reported, including M. coreana Park (1990), M.
nothofagi Elix (1996), M. siamea Kurokawa (1998), M. crenulata (Zhao) Hale
ex DePriest & B. W. Hale (1998), M. salazinica and M. sinica Wang, Chen &
Elix (2001). Further, Myelochroa immiscens (Nyl.) Elix & Hale and M.
lindmanii (Lynge) Elix & Hale have been transferred to Parmotrema
(Kurokawa & Arakawa 1997) since these two species have rather broad lobes
248
with a relatively wide erhizinate zone on the lower surface and lack
triterpenes present in other members of Myelochroa. Consequently 23
species were accepted in this genus before the present study, and we are now
describing a further new species. Throughout the present work chemical
constituents were identified by thin layer chromatography (Culberson 1972;
Culberson & Johnson 1982; Elix & Ernst-Russell 1993), high performance
liquid chromatography (Feige et al. 1993; Elix et al. 1997) and comparison
with authentic samples.
Myelochroa sikkimensis Divakar, Upreti, G.P. Sinha & Elix, sp. nov.
Thallus ut in Myelochroa crenulata sed magnus, coriaceus, lobis latioribus
et elobulatibus differt.
Type: INDIA. North Sikkim: Lachung, ca. 2650 m, on bark, G. P. Sinha 1115,
15 July 1996; holo: BSHC.
Thallus corticolous, foliose, loosely to moderately adnate, coriaceous, to 8
cm wide. Lobes imbricate, subirregular to sublinear, 2-6 mm wide; margins
crenate or dentate, ciliate; cilia simple, dense, evenly distributed, to 0.5 mm
long. Upper surface pale grey to grey, flat, emaculate, irregularly cracked,
+with black discoloured patches, isidia, soredia and lobules absent. Medulla
intense lemon-yellow. Lower surface black to the margin; rhizines dense,
forming a thick mat, simple, squarrose or irregularly branched, to 1 mm
long. Apothecia not seen. Pycnidia black, immersed. Conidia bacilliform or
weakly bifusiform, 4.5-6.5 x 1 um.
Chemistry. Cortex K+ yellow; medulla K+ pale yellow, C-, KC-, P-;
containing atranorin (major), secalonic acid A (major), xantholepinone A
(major), xantholepinone D (trace), zeorin (major), 16p-acetoxyhopane-6a,22-
diol (major), 6a,16B-diacetoxyhopane-22-ol (major), leucotylin (minor), 60-
acetoxyhopane-168,22-ol (trace).
Myelochroa_ sikkimensis closely resembles M. crenulata (Zhao) Hale ex
DePriest & B. Hale (Zhao 1964), as these two species have similar loosely to
moderately adnate thalli with prominent cilia, lack soredia and isidia and
contain secalonic acid A, xantholepinone A, zeorin, 16B-acetoxyhopane-
60,22-diol, 6a,16f-diacetoxyhopane-22-01 and leucotylin in the medulla.
However, M. sikkimensis can clearly be separated from M. crenulata by the
larger thallus with broader lobes (2-6 mm cf. 1.5-3 mm wide) and more
particularly, the lack of dense imbricate lobules in the thallus centre. The
yellow pigments (of unknown structure), xantholepinone A and
xantholepinone D are representatives of a group of such pigments first
identified in the related species, Myelochroa xantholepis (Mont. &
v.d.Bosch) Elix & Hale. Myelochroa sikkimensis also appears to be related to
Myelochroa sinica Wang, Chen & Elix (2001), a saxicolous species with
identical chemistry which lacks lobules, but differs in having very narrow
lobes (0.5-1.2 mm wide), sparse marginal cilia (dense in M. sikkimensis) and
Fig.
249
Figure 1. Myelochroa sikkimensis (holotype in BSHC). Scale bar = 5.0 mm.
simple rhizines (squarrose to irregularly branched in M. sikkimensis). At
present, the new species is known from the type locality.
New Records of Parmeliaceae for Sikkim, India
Arctoparmelia subcentrifuga (Oxner) Hale, Mycotaxon 25: 252 (1986)
Arctoparmelia subcentrifuga is distinguished by the black to black-brown
lower surface [similar to A. separata (Th. Fr.) Hale] and the markedly and
coarsely rugose-pustulate upper surface. This species is known from
Greenland, North America, Siberia and Nepal (Hale 1986).
Specimen Examined
INDIA. North Sikkim: Llonak Valley, 4600 m, over mosses on rock, Sinha
1613, 3 Sep. 1999 (BSHC).
250
Hypotrachyna radiculata (Kurok.) Elix, Australasian Lichenology 48: 35
(2001)
This species is chemically identical with Hypotrachyna majoris (Vain.) Hale
[atranorin (minor), chloroatranorin (minor), salazinic acid (major),
consalazinic acid (minor), zeorin (minor)] and both species have +capitate,
terminal or subterminal soralia. Hypotrachyna radiculata is distinguished
by the marginal cilia and the lack of revolute or hooded lobe apices.
Previously this species was known only from Australia (Elix 1994) and
Papua New Guinea (Kurokawa 1979).
Specimens Examined
INDIA. East Sikkim: track between Premlakha and Tonjabir, on bark, G. P.
Sinha 897, 7 April 1996 (BSHC). Uttar Pradesh: Almora district, 4 km from
Loharkhet towards Dhakuri, 2280 m, on Quercus trunk, Awasthi 7551, 8
June 1970 (AWAS).
ACKNOWLEDGEMENTS. The authors (Divakar & Upreti) thank the Director NBRI for
providing laboratory facities for this work. We thank Stuart Hay and Neal McCracken of
the Photographic Unit, ANU, for preparing the photograph.
LITERATURE CITED
Culberson, C. F. (1972). Improved conditions and new data for the identification of lichen
products by a standardized thin-layer chromatographic method. Journal of
Chromatography 72: 113-125.
Culberson, C. F. & Johnson, A. (1982). Substitution of methyl tert.-butyl ether for diethyl
ether in the standardized thin-layer chromatographic method for lichen products.
Journal of Chromatography 238: 483-487.
DePriest, P. T., & Hale, B. W. (1998). New combinations in Parmelioid genera (Ascomycotina,
Parmeliaceae). Mycotaxon 67: 201-206.
Elix, J. A. (1994a). Myelochroa. Flora of Australia 55: 66-67.
Elix, J. A. (1994b). Parmelinopsis. Flora of Australia 55: 131-138.
Elix, J. A. (1996). New species in the lichen family Parmeliaceae (Ascomycotina) from
Australia and Oceania. Mycotaxon 59: 407-417.
Elix, J. A., & Ernst-Russell, K. D. (1993). A Catalogue of Standardized Thin Layer
Chromatographic Data and Biosynthetic Relationships for Lichen Substances, 2nd Edn.
(Australian National University, Canberra).
Elix, J. A. & Hale, M. E. (1987). Canomaculina, Myelochroa, Parmelinella, Parmelinopsis,
and Parmotremopsis, five new genera in the Parmeliaceae (lichenized Ascomycotina).
Mycotaxon 29: 233-244.
Elix, J. A., Wardlaw, J. H., Archer, A. W., Lumbsch, H. T., and Pliimper, M. (1997). Four new
depsidones from Pertusaria and Lecanora lichens. Australasian Lichenology 41: 22- 27.
Feige, G. B., Lumbsch, H. T., Huneck, S. & Elix, J. A. (1993). The identification of lichen
substances by a standardized high-performance liquid chromatographic method. Journal
of Chromatography 646: 417-427.
Hale, M. E. (1986). Arctoparmelia, a new genus in the Parmeliaceae (Ascomycotina).
Mycotaxon 25: 251-254.
Kurokawa, S. (1979). Enumeration of species of Parmelia in Papua New Guinea. (Academia
Scientific Book Inc.: Tokyo).
Kurokawa, S. (1998). A new record and new species in Myelochroa (Parmeliaceae). Journal
of Japanese Botany 73: 12-14.
251
Kurokawa, S. & Arakawa, S. (1997). Revision of Japanese species of Myelochroa
(Parmeliaceae). Bulletin of the Botanic Gardens of Toyama 2: 23-43.
Park, Y.S. (1990). The macrolichen flora of south Corea. Bryologist 93: 105-160.
Wang, S-L., Chen, J-B., and Elix, J. A. (2001). Two new species of the lichen genus Myelochroa
(Parmeliaceae, Ascomycota) from China. Mycotaxon 77: 25-30.
Zhao, J. D. (1964). A preliminary study on Chinese Parmelia. Acta Phytotaxonomica Sinica
9: 139-166.
MYCOTAXON
Volume LXXIX, pp. 253-260 July-September 2001
A NEW SPECIES AND NEW RECORDS IN THE LICHEN FAMILY
PARMELIACEAE (ASCOMYCOTINA) FROM THE PHILIPPINES
JOHN A. ELIX
Department of Chemistry, The Faculties, Australian National University,
Canberra, ACT 0200, Australia
email: John.Elix@anu.edu.au
FELIX SCHUMM
Schreiberstrasse 36, D-70199 Stuttgart, Germany
email: Schumm@CompuServe.com
ABSTRACT : Parmotrema negrosorientalum from
the Philippines is described as new to science. In
addition, 13 species of Parmeliaceae are reported for
the first time for the Philippines.
KEY WORDS: Parmotrema negrosorientalum, Hypotrachyna, Hypogymnia, Parmotrema,
Platismatia, Rimelia
In recent years there has been a significant increase in interest and
appreciation of the lichen flora of Philippines, with localised studies of
lichen biodiversity (Elix & Bawingan ined.), as well as several intensive
field investigations by F. Schumm (lichens) & U. Schwarz (bryophytes). We
have now undertaken a detailed survey of the recent collections of
Parmeliaceae from the Philippine islands of Leyte, Mindanao and Negros
culminating in our describing a species new to science and 13 new records
for the country. Throughout the present work chemical constituents were
identified by thin layer chromatography (Culberson 1972; Culberson &
Johnson 1982; Elix & Ernst-Russell 1993), high performance liquid
chromatography (Feige et al. 1993; Elix et al. 1997) and comparison with
authentic samples.
Parmotrema negrosorientalum Elix & Schumm, sp. nov. Fig. 1
Thallus ut in Parmotrema rampoddense sed magnus, coriaceus, superfice
superiore maculata et sporis majoribus differt.
254
Type: PHILIPPINES. Negros, Negros Oriental Province: Mt Talinis (Cuernos
de Negros), Lunga Nature Trail between Camp Vendiola (9°16'N, 123°11'E)
and Lake Nailig (9°15'N, 123°10'E), 1170 m, on bark, F. Schumm & U.
Schwarz, 10 Aug. 2000; holo: herb. Schumm 7521.
Thallus corticolous, foliose, loosely adnate, coriaceous, to 8-12 cm wide.
Lobes imbricate, subirregular, 5-12 mm wide; margins crenate or irregularly
incised-dentate, ascending or revolute; cilia moderately dense, 0.2-5.0 mm
long; lobules rare along the lobe margins. Upper surface pale grey to grey-
green, flat, tmaculate, irregularly cracked, twith black discoloured patches,
isidia absent; soralia linear on small incised marginal laciniae or on
ascending lobe margins, sometimes spreading submarginally, with
marginally sorediate lobes becoming involute; soredia farinose, becoming
blackened, with orange patches on older lobes in the thallus centre.
Medulla white, becoming orange-red in older lobes particularly adjacent to
lower cortex. Lower surface black, with a white to pale brown erhizinate
marginal zone; rhizines unevenly distributed, simple, slender, to 1 mm
long. Apothecia rare, submarginal, stipitate to substipitate, 3-10 mm wide;
disc perforate or imperforate, becoming undulate distorted; thalline exciple
strongly rugose and maculate, becoming sorediate, thalline margin crenate.
Ascospores ellipsoid, 26-30 x 10-17 um. Pycnidia rare, immersed - only
immature pycnidia observed.
Chemistry. Cortex K+ yellow; medulla K-, C-, KC+ red, P-; pigmented
medulla K+ violet; containing atranorin (minor), chloroatranorin (minor),
alectoronic acid (major), a-collatolic acid (major), dehydrocollatolic acid
(minor), skyrin (minor).
Parmotrema negrosorientalum closely resembles P. rampoddense (Nyl.)
Hale, as these two species have similar loosely adnate thalli with prominent
cilia, marginal soralia and contain alectoronic acid, a-collatolic acid and
skyrin in the medulla. However, P. negrosorientalum can clearly be
separated by the larger, coriaceous thallus (membranaceous in P.
rampoddense), the often maculate upper surface (emaculate in P.
rampoddense), ultimately perforate apothecial discs (imperforate in P.
rampoddense), and the much larger spores (26-30 x 10-17 um cf. 10-12 x 6-7
uum). In overall morphology P. negrosorientalum closely resembles P.
lobulascens (Steiner) Hale, but the latter species lacks the orange-red
pigmentation of the lower medulla and soralia. This pigmentation is due to
substantial concentrations of the bis-anthraquinone, skyrin. At present, the
new species is known from several localities in Negros Oriental Province in
the Philippines.
Specimens Examined
PHILIPPINES. Negros, Negros Oriental Province: type locality, F. Schumm
& U. Schwarz, 10 Aug. 2000 (CANB, herb. Schumm 7463, 7465, 7466); Mt
Talinis (Cuernos de Negros), Lunga Nature Trail near Lake Yagumyum,
259
Figure 1. Parmotrema negrosorientalum (isotype in CANB). Scale bar = 5
mm.
9°15'N, 123°11'E, 1360 m, on bark, F. Schumm & U. Schwarz, 11 Aug. 2000
(CANB, herb. Schumm 7571).
New Records of Parmeliaceae for the Philippines
Hypotrachyna corneola Kurok. & Moon, Bull. Bot. Gard. Toyama 5: 41 (2000)
Previously this species was only known from Papua New Guinea
(Kurokawa & Moon 2000).
Specimen Examined
PHILIPPINES. Mindanao, Bukidnon Province: Intavas, west of Malabalay at
foot of Mt Kitanglad, 8°12'N, 124°57'E, 1270 m, on bark, F. Schumm & U.
Schwartz, 18 Aug. 1999 (herb. Schumm 6237). Cotabato Province: Mt Apo,
256
Marbel River Campsite, 7°00'N, 125°15'E, 1490 m, on bark, F. Schumm & U.
Schwartz, 9 Aug. 1999 (herb. Schumm 8031).
Hypotrachyna imbricatula (Zahlbr.) Hale, Smithsonian Contr. Bot. 25: 41
(1975)
A widely distributed subtropical-tropical species also known from the
Americas, Southeast Asia, Australia, Papua New Guinea and Hawaii (Elix
1994a; Hale 1975).
Specimen Examined
PHILIPPINES. Mindanao, Bukidnon Province: Intavas, west of Malabalay at
foot of Mt Kitanglad, 8°12'N, 124°57'E, 1270 m, on bark, F. Schumm & U.
Schwartz, 18 Aug. 1999 (CANB, herb. Schumm 6246).
Hypotrachyna physcioides (Nyl.) Hale, Smithsonian Contr. Bot. 25: 54 (1975)
A common species in tropical America, India, Thailand, Malaysia and
Papua New Guinea (Hale 1975; Kurokawa 1979; Pooprang et al. 1999).
Specimens Examined
PHILIPPINES. Mindanao, Bukidnon Province: west of Malabalay,
intermediate camp site, Mt Kitanglad, 8°10'N, 124°56'E, 1870-2800 m, on bark
in tropical montane rainforest, F. Schumm & U. Schwartz, 19 Aug. 1999
(herb. Schumm 6297). Cotabato Province: summit of Mt Apo, 6°59'N,
125°16'E, 2900 m, on rocks, O. L. Bernabe, 12 Aug. 1999 (CANB, herb.
Schumm 6194, 6202); between Lake Venado and summit of Mt Apo, 6°59'-
7°00'N, 125°16'-125°20'E, 2200-2800 m, on bark in tropical montane
rainforest, F. Schumm & U. Schwartz, 11 Aug. 1999 (herb. Schumm 6151,
6181).
Hypotrachyna reducens (Nyl.) Hale, Smithsonian Contr. Bot. 25: 60 (1975)
A temperate and tropical species also known from Australia, Malaysia
(Sabah), New Guinea, Central and South America (Elix 1994a; Hale 1975;
Kurokawa 1979).
Specimen Examined
PHILIPPINES. Mindanao, Bukidnon Province: west of Malabalay,
intermediate camp site, Mt Kitanglad, 8°10'N, 124°56'E, 1870-2800 m, on bark
in tropical montane rainforest, F. Schumm & U. Schwartz, 19 Aug. 1999
(CANB, herb. Schumm 6273).
257
Hypogymnia zeylanica (R. Sant.) Awasthi & Singh
This species was previously known only from Sri Lanka, India (Awasthi &
Singh 1971) and Papua New Guinea (Elix & Jenkins 1989).
Specimen Examined
PHILIPPINES. Cotabato Province: Mt Apo, swamp region on west bank of
Lake Venado, 7°00'N, 125°16'E, 2210 m, on bark in open montane area, U.
Schwartz, 20 Mar. 1999 (B, herb. Schumm 5479).
Parmotrema cooperi (J. Steiner & Zahlbr.) Sérus., Bryologist 87: 4 (1984)
This species was previously known from Africa, Madagascar, Asia, India
(Hale 1965; Krog & Swinscow 1981) and Australia (Elix 1994b).
Specimen Examined
PHILIPPINES. Cotabato Province: near Ilomavis, on the road past
Kidapawan, 7°02'N, 125°11'E, 730 m, on Cocos palm, F. Schumm & U.
Schwartz, 7 Aug. 1999 (CANB, herb. Schumm 5885).
Parmotrema dilatatum (Vain.) Hale, Phytologia 28: 335 (1974)
This species is widespread in Africa, India, Australia, New Zealand, Papua
New Guinea and South America (Elix 1994b; Hale 1965; Krog & Swinscow
1981; Louwhoff & Elix 2000).
Specimen Examined
PHILIPPINES. Mindanao, Bukidnon Province: west of Malabalay,
intermediate camp site, Mt Kitanglad, 8°10'N, 124°56'E, 1870-2800 m, on bark
in tropical montane rainforest, F. Schumm & U. Schwartz, 19 Aug. 1999
(CANB, herb. Schumm 6303).
Parmotrema lobulascens (Steiner) Hale, Phytologia 28: 337 (1974)
Previously this species was known from Africa (Krog & Swinscow 1981) and
Asia (Hale 1965).
Specimens Examined
PHILIPPINES. Mindanao, Bukidnon Province: west of Malabalay,
intermediate camp site, Mt Kitanglad, 8°10'N, 124°56'E, 1870-2800 m, on bark
in tropical montane rainforest, F. Schumm & U. Schwartz, 19 Aug. 1999
(herb. Schumm 6272). Cotabato Province: Mt Apo, near Lake Venado,
7°00'N, 125°16'E, 2200 m, on bark in tropical montane rainforest, F.
Schumm & U. Schwartz, 10 Aug. 1999 (CANB, herb. Schumm 6071, 6084).
258
Parmotrema permutatum (Stirt.) Hale, Phytologia 28: 338 (1974)
This species is known from Africa, India, Indonesia, Papua New Guinea,
Australia, Central and South America (Elix 1994b; Hale 1965; Krog &
Swinscow 1981;Louwhoff & Elix 2000).
Specimen Examined
PHILIPPINES. Mindanao, Cotabato Province: near the Lake Agko campsite
at foot of Mt Apo, 7°01'N, 125°13'E, 1240 m, on bark, F. Schumm & U.
Schwartz, 7 Aug. 1999 (herb. Schumm 5941).
Parmotrema rampoddense (Ny]l.) Hale, Phytologia 28: 338 (1974)
A widespread species known from West Africa, North, Central and South
America, Sri Lanka and India (Hale 1965), Australia (Elix 1994b) and Papua
New Guinea (Louwhoff & Elix 2000).
Specimens Examined
PHILIPPINES. Leyte, Leyte Province: Lake Kasudsuran near Barangay
Liberty (Ormoc City), 11°02'N, 124°45'E, 740 m, on bark, F. Schumm & U.
Schwartz, 23 Aug. 2000 (herb. Schumm 7943, 7948). Mindanao, Cotabato
Province: near the Lake Agko campsite at foot of Mt Apo, 7°01'N, 125°13'E,
1240 m, on bark, F. Schumm & U. Schwartz, 7 Aug. 1999 (herb. Schumm
5916, 5978); Mt Apo, near Lake Venado, 7°00'N, 125°16'E, 2200 m, on bark in
tropical montane rainforest, F. Schumm & U. Schwartz, 10 Aug. 1999 (herb.
Schumm 6115). Negros, Negros Oriental Province: Mt Talinis (Cuernos de
Negros), Lunga Nature Trail between Barangay Lunga (9°17'N, 123°14'E)
and Camp Vendiola (9°16'N, 123°11'E), 1030 m, on bark, F. Schumm & U.
Schwarz, 10 Aug. 2000 (herb. Schumm 7443); Mt Talinis (Cuernos de
Negros), Lunga Nature Trail between Camp Vendiola (9°16'N, 123°11'E) and
Lake Nailig (9°15'N, 123°10'E), 1180 m, on bark, F. Schumm & U. Schwarz,
10 Aug. 2000 (herb. Schumm 7467, 7533); Mt Talinis (Cuernos de Negros),
Lunga Nature Trail, between Lake Yagumyum and Bediao-Dauin, 9°15'N,
123°11'E, 1240 m, on bark, F. Schumm & U. Schwarz, 12 Aug. 2000 (herb.
Schumm 7613).
Parmotrema sancti-angelii (Lynge) Hale, Phytologia 28: 339 (1974)
This pantropical species has been reported previously from Central and
South America, eastern and southern Africa, Papua New Guinea and
Australia (Elix 1994b; Hale 1965; Krog & Swinscow 1981; Louwhoff & Elix
2000).
Specimens Examined
PHILIPPINES. Cotabato Province: near Ilomavis, on the road past
Kidapawan, 7°02'N, 125°11'E, 730 m, on bark, F. Schumm & U. Schwartz, 7
Aug. 1999 (CANB, herb. Schumm 5869, 5874, 5903, 5908).
259
Platismatia regenerans W. Culb. & C. Culb., Contr. U.S. Natl Herb. 34:
547.(1968)
This species has been reported previosly from the high mountains of Sabah,
Malaysia (Culberson & Culberson 1968).
Specimen Examined
PHILIPPINES. Cotabato Province: Mt Apo, swamp region on west bank of
Lake Venado, 7°00'N, 125°16'E, 2210 m, on bark in open montane area, U.
Schwartz, 20 Mar. 1999 (herb. Schumm 5485).
Rimelia austrocetrata (Elix & J.Johnst.) Hale & A. Fletcher, Bryologist 93: 26
(1990)
This Australasian species is known from Australia, New Zealand, Papua
New Guinea, Norfolk and Lord Howe Islands (Elix 1994c; Hale & Fletcher
1990; Louwhoff & Elix 1999, 2000).
Specimens Examined
PHILIPPINES. Cotabato Province: between Lake Venado and summit of Mt
Apo, 6°59'-7°00'N, 125°16'-125°20'E, 2200-2800 m, on bark in tropical
montane rainforest, F. Schumm & U. Schwartz, 11 Aug. 1999 (CANB, herb.
Schumm 6126); Mt Apo, swamp region on east bank of Lake Venado,
7°00'N, 125°16'E, 2210 m, on mossy rocks, U. Schwartz, 20 Mar. 1999 (B,
herb. Schumm 5441).
ACKNOWLEDGEMENTS
We thank Stuart Hay and Neal McCracken of the Photographic Unit, ANU,
for preparing the photograph.
LITERATURE CITED
Awasthi, D. D. & Singh, K. P. (1971). Additions to the lichen flora of India. Geophytology
1: 97-1021.
Culberson, C. F. (1972). Improved conditions and new data for the identification of lichen
products by a standardized thin-layer chromatographic method. Journal of
Chromatography 72: 113-125.
Culberson, C. F. & Johnson, A. (1982). Substitution of methyl tert.-butyl ether for diethyl
ether in the standardized thin-layer chromatographic method for lichen products.
Journal of Chromatography 238: 483-487.
Culberson, W. L., Culberson, C. F. (1968). The lichen genera Cetralia and Platismatia
(Parmeliaceae). Contributions from the United States National Herbarium 34: 447-558.
Elix, J. A. (1994a). Hypotrachyna. Flora of Australia 55: 49-59.
Elix, J. A. (1994b). Parmotrema. Flora of Australia 55: 140-162.
Elix, J. A. (1994c). Rimelia. Flora of Australia 55: 186-188.
Elix, J. A., & Ernst-Russell, K. D. (1993). A Catalogue of Standardized Thin Layer
Chromatographic Data and Biosynthetic Relationships for Lichen Substances, 2nd Edn.
(Australian National University, Canberra).
260
Elix, J. A. & Jenkins, G. A. (1989). New species and new records of Hypogymnia. Mycotaxon 35:
469-476.
Elix, J. A., Wardlaw, J. H., Archer, A. W., Lumbsch, H. T., and Plumper, M. (1997). Four new
depsidones from Pertusaria and Lecanora lichens. Australasian Lichenology 41: 22- 27.
Feige, G. B., Lumbsch, H. T., Huneck, S. & Elix, J. A. (1993). The identification of lichen
substances by a standardized high-performance liquid chromatographic method. Journal
of Chromatography 646: 417-427.
Hale, M. E. (1965). A monograph of Parmelia subgenus Amphigymnia. Contributions from the
United States National Herbarium 36: 193-358.
Hale, M. E. (1975). A revision of the lichen genus Hypotrachyna (Parmeliaceae).
Smithsonian Contributions to Botany 32: 1-29.
Hale, M. E. & Fletcher, A. (1990). Rimelia Hale & Fletcher, a new lichen genus
(Ascomycotina: Parmeliaceae). Bryologist 93: 23-29.
Krog, H. & Swinscow, T. D. V. (1981). Parmelia subgenus Amphigymnia (lichens) in East
Africa. Bulletin of the British Museum (Natural History), Botany Series 9: 143-231.
Kurokawa, S. (1979). Enumeration of species of Parmelia in Papua New Guinea. (Academia
Scientific Book Inc.: Tokyo).
Kurokawa, S. & Moon (2000). New species and new records in Hypotrachyna (Parmeliaceae).
Bulletin of the Botanical Gardens of Toyama 5: 9-24.
Louwhoff, S. H. J. J. & Elix, J. A. (1999). The lichen family Parmeliaceae (Ascomycotina) on
Lord Howe Island, Australia. Mycotaxon 68: 429-463.
Louwhoff, S. H. J. J. & Elix, J. A. (2000). Parmotrema and allied lichen genera in Papua New
Guinea. Bibliotheca Lichenologica 73: 1-152.
Pooprang T., Boonpragob, K. & Elix, J. A. (1999). New species and new records in the
Parmeliaceae (Ascomycotina) from Thailand. Mycotaxon 71: 111-127.
MYCOTAXON
Volume LXXIX, pp. 261-265 July-September 2001
USTILAGO DEYEUXICOLA SP. NOV. FROM CHINA
Kalman VANKY! & Lin GUO 2
' Herbarium Ustilaginales Vanky (HUV)
Gabriel-Biel-Str. 5, D-72076 Tiibingen, Germany
e-mail: VANKY.K @cityinfonetz.de
2 Systematic Mycology & Lichenology Laboratory
Institute of Microbiology, Academia Sinica
Beijing 100080, China
e-mail: guol@sun.im.ac.cn
ABSTRACT: A new species of Ustilaginomycetes, Ustilago deyeuxicola
on Deyeuxia angustifolia from China is described and illustrated. It is
compared with the smut fungi of Deyeuxia and Calamagrostis, and a key to
these species is presented.
KEY WORDS: Calamagrostis, Deyeuxia angustifolia, Ustilaginomycetes,
smut fungi.
INTRODUCTION
A smut fungus on the leaves of Deyeuxia angustifolia (Kom.) Y. L. Chang was
collected in China. Deyeuxia, in the subfam. Pooideae, tribe Aveneae, subtribe
Alopecurinae, is considered by many agrostologists to be a synonym of
Calamagrostis. According to Clayton & Renvoize (1986:135), Calamagrostis,
with c. 270 species in temperate regions throughout the world and on tropical
mountains, is variable and sometimes divided into three genera: Deyeuxia P.
Beauv., Calamagrostis Adanson, and Aniselytron Merr.
On DEYEUXIA three smut fungi have been described: 1. Tilletia deyeuxiae
L. Ling (1945:1), type on D. sylvatica (Schrader) Kunth var. /axiflora Rendle,
China. 2. 7. inolens McAlpine (1896:154), type on D. forsterii Kunth, Australia,
and 3. Ustilago deyeuxiae L. Guo (1993:51), type on D. arundinacea (L.)
Beauv., China. This last species is very close to Ustilago scrobiculata Liro
(1924:68), type on Calamagrostis arundinacea (L.) Roth, Finland, and they are
considered by the senior author to be synonyms.
262
On CALAMAGROSTIS seven smut fungi have been reported: 1. Tilletia
deyeuxiae (see above). 2. Urocystis calamagrostidis (Lavrov) Zundel
(1953:312), based on Tuburcinia calamagrostidis Lavrov (1937:2), lectotype
(designated by Zundel) on C. epigeios (L.) Roth, Ukraine. 3. Ustilago
calamagrostidis (Fuckel) G. P. Clinton (1902:138), based on Tilletia
calamagrostidis Fuckel, in Fuckel, Fgi. rhenani exs. no. 1925, 1867, type on C.
epigeios (L.) Roth, Germany. 4. U. hypodytes (Schitdl.) Fries (1832:518), based
on Caeoma hypodytes Schlechtendal (1824:129), type on Elymus arenarius L.,
Germany. The occurrence of this smut on Calamagrostis is doubtful and has to
be verified. 5. U. scrobiculata (see above). 6. U. striiformis (Westend.) Niessl
(1876:1), based on Uredo striiformis Westendorp (1851:406), type on Holcus
lanatus L., Belgium, and 7. Ustilentyloma brefeldii (Krieger) Vanky (1991:491),
based on Entyloma brefeldii Krieger, 1896:(145), and in Krieger, Fgi. saxon. no.
104, 1896, type on Phalaris arundinacea L., Germany.
- No smut fungus is known on ANISELYTRON.
RESULTS
The fungus on Deyeuxia angustifolia from China differs from all known smut
fungi on Deyeuxia and Calamagrostis, mentioned above (comp. the key below).
It is described as:
Ustilago deyeuxicola Vanky & L. Guo, sp. nov.
Typus in matrice Deyeuxia angustifolia (Kom.) Y. L. Chang (Calamagrostis
angustifolia Kom., det. Liu Liang), China, Heilongjiang, Fuyuan, 48°21' N,
134°18' E, 8. VIII.2000, leg. L. Guo 1890. Holotypus in HMAS 80864. Isotypus
in HUV 19500!
Sori in foliis et vaginis foliorum strias longas, parallelas inter venas formantes,
cca. 0,5 mm lati, 0,5-5 cm longi vel propter coalescentiam longiores, primo
subepidermales, serius disrupti et massam atrobrunneam, semiagglutinatam usque
pulveream sporarum ostendentes et saepe laminam foliorum contundentes.
Sporae subglobosae, ovoideae, late ellipsoidales usque parum irregulares
(5,5-)6-7,5 x 6,5—-10 pm, flavidobrunneae; pariete aequaliter crasso (cca. 0,5
uum), rarius usque moderate dense, subtiliter verruculoso. Imago obliqua sporae in
microscopio LM levis vel indistincte undulata.
Sori (Fig. 1) in the leaves and leaf-sheaths forming long, paralell striae
between the veins, c. 0.5 mm wide, 0.5—5 cm long or longer by confluence, first
subepidermal, later bursting and revealing the dark brown, semi-agglutinated to
powdery mass of spores which are scattered and the leaf-blades often shred.
Spores (Figs. 2, 3) subglobose, ovoid, broadly ellipsoidal to slightly irregular
(5.5—-)6-7.5 x 6.5—-10 pm, yellowish-brown; wall evenly thick (c. 0.5 um),
sparsely to moderately densely, finely verruculose; spore profile seen in LM is
smooth to indistinctly wavy.
On Gramineae: Deyeuxia angustifolia (Kom.) Y. L. Chang (Calamagrostis
angustifolia Kom.), China. Known only from the type collection.
263
4
Fig. 1. Sori of Ustilago deyeuxicola Vanky & L. Guo on Deyeuxia angustifolia
(Kom.) Y. L. Chang, forming striae on the leaves and leaf sheaths (type). To
the right a healthy inflorescence. Bar = 1 cm.
264
Key to the smut fungi of Calamagrostis, including Deyeuxia
1. Sori inconspicuous. Spores subhyaline to pale yellow, embedded
in the leaf tissue, not powdery ..................:ceeceeeeeeeeeeees Ustilentyloma brefeldii
— Sori conspicuous. Spores pigmented, powdery ...............cccccccceeceeserteeeeeeseteeees 2
2. Spores agglutinated in permanent balls surrounded by sterile cells ...................
Sia a ay Mp OA I ty AW cok Eto, Pee EC eae Urocystis calamagrostidis
<=) Spores NOtAN, DALISMn uk dN ee RA eu Cia aM Okc Na nee We Ee caste emer 3
3. Sori naked surrounding the internodes. Spores 4—6(—7) um long.......................
cae al OMe Ie Rae ON ecg A Mle hk Ws, (?)Ustilago hypodytes
— Sori otherwise. Spores larger ...............0..ccceeeee BM PARC C EN ERI AD Oo Mei bie a a, 4
4. Sori in seeds. Spores longer than 19 wm, tuberculate ..........000.. eee 5
— Sori in leaves forming striae. Spores shorter than19 tm, verrucose
orjechinulate me 2t teak en hel ee ee ee ee ies sf ey erg ee nee Me 6
5. Spores 19-26 um long, tubercles 1.5—2 um high ................... Tilletia deyeuxiae
— Spores 36—44 pm long, tubercles up to 5 pm high..................... Tilletia inolens
6: Spores 12-19 um long i.e eae renee ee hc! a ae ace etree eee Re 7
Sy Sporesysmalleg aes W941. cycle Oh Sean 2) Ov eae ecw. As cee ece em Rei 8
7. Spores with irregular warts the bases of which are confluent into
irregular, interrupted meshes............ Ustilago scrobiculata (incl. U. deyeuxiae)
— Spores with regular, isolated, prominent, densely situated spines
which are not fusing). aie sem ineian eeen. Ustilago calamagrostidis
8. Spores 9-15(—16) um long, finely to prominently, densely echinulate.
Spore profile finely serrulateny 4. Weer ccr tn uneees rede ce Ustilago striiformis
— Spores 6.5—10 um long, sparsely, finely verruculose. Spore profile smooth......
SEMA Ey SEO TRADE ENED 24 oh CRON MENT DS AB OE Ta, We ee Led UncteE AN me Ustilago deyeuxicola
265
Sorus and spore morphology of Ustilago deyeuxicola on Deyeuxia (tribe
Aveneae) are rather close to those of U. davisii Liro on Glyceria species (tribe
Meliceae). However, U. deyeuxicola differs from U. davisii in having smaller and
darker spores. These, in U. davisii are 8-12 pm long, pale brown, minutely,
moderately densely punctate to verrucose-echinulate.
ACKNOWLEDGEMENTS
The authors are grateful to Dr. S. Toth (Géd6ll6, Hungary) for providing the
Latin description, to Dr. R. G. Shivas (Herb BRIP, Qld., Australia) for reading
the manuscript and serving as pre-submission reviewer, and to Prof. Liu Liang
(Beijing, China) for identifying Deyeuxia angustifolia.
REFERENCES
Clayton, W. D. & Renvoize, S. A. 1986. Genera graminum. Grasses of the world.
— London, 389 pp.
Clinton, G. P. 1902. North American Ustilagineae. — J. Mycol. 8:128-156.
Fries, E. 1829-1832 ("1832"). Systema mycologicum, etc. Vol. 3. sectio 1. —
Gryphiswaldae, pp. 1-260, 1829; sectio 2. — Gryphiswaldae, pp. 261-524,
1832.
Guo, L. 1993. Ustilago deyeuxiae sp. nov. and three smut species new to China.
— Mycosystema 6:51-55.
Krieger, W. 1896. Fungi saxonici exsiccati. Diagnosen der bisher noch nicht
veréffentlichen Arten. — Hedwigia, Beibl. 35:(143)-(145).
Lavrov, Sist. Zametki Mater. Gerb. Krylova Tomsk. Gosud. Univ. Kujbyseva
ia VRE
Ling, L. 1945. A contribution to the knowledge of the Ustilaginales in China. —
Mycol. Pap. 11:1-12.
Liro, J. I. 1924. Die Ustilagineen Finnlands I. — Ann. Acad. Sci. Fenn., Ser. A,
17(1):1-636.
McAlpine, D. 1896. Australian fungi. — Agric. Gaz. New South Wales 7:147-156
+2-Pls;
Niessl v., G. 1876. Mycologische Notizen. — Hedwigia 15:1-2.
Schlechtendal, D. F. L 1824. Flora Berolinensis, Pars 2. Cryptogamia. — Berlin.
XIV + 284 pp.
Vanky, K. 1991. Taxonomical studies on Ustilaginales. VIII. — Mycotaxon
41:483-495.
Westendorp, G. D. 1851. Notice sur quelques cryptogames inédites ou nouvelles
pour la flore belge. — Bull. Acad. Roy. Sci. Belgique 18:384-417 + PI.
Zundel, G. L. 1953. The Ustilaginales of the World. — Pennsylvania State Coll.
School Agric. Dept. Bot. Contrib. 176:X1I + 1-410.
Figs. 2, 3. Spores of Ustilago deyeuxicola Vanky & L. Guo in LM and in SEM
(type). Bars = 10 pm.
n
MYCOTAXON
Volume LXXIX, pp. 267-274 July-September 2001
HYALOSETA NOLINAE, ITS ANAMORPH MONOCILLIUM NOLINAE,
AND NIESSLIA AGAVACEARUM, NEW MEMBERS OF THE
NIESSLIACEAE, HYPOCREALES, FROM LEAVES OF AGAVACEAE
Annette W. Ramaley
7 Animas Place,
Durango CO 81301
Abstract: Hyaloseta, a new genus with superficial, setose ascomata and unitunicate asci, is described from
dead leaves of Nolina micrantha. The accompanying anamorph is Monocillium nolinae, a new species, in
which the hyphae bear setae like those on the ascomata of Hyaloseta. Niesslia agavacearum sp. nov. is
described from leaves of Dasylirion leiophyllum. No anamorph has been discovered for this species.
Key words: ascomycete, Dasylirion, fungi, Nolina, systematics
INTRODUCTION
Nolina micrantha 1.M. Johnst. and Dasylirion leiophyllum Engelm. are plants in the
Agavaceae that have long, slender, fibrous leaves arising from a short subterranean or
above-ground caudex. Both genera are perennials, and the leaves may remain on the
caudex for several years while decomposition takes place. Two species of superficial,
small, setose ascomycetes were discovered on dead leaves of these plants. The lack of
paraphyses, setose ascomata with unitunicate asci, hyaline, 1-septate ascospores, and
peridia having ftextura epidermoidea, place these fungi in the Hypocreales. The
families in this order have been revised and extensively redescribed, and new genera
and new species of existing genera within these families have also been described
(Samuels and Barr 1997; Rossman ef a/. 1999),
MATERIALS AND METHODS
Conidiophores on small portions of the subiculum surrounding Hyaloseta ascomata
were suspended in a drop of sterile tap water on commercial potato dextrose agar
(PDA, BBL) in a Petri plate, and the conidial suspension was spread with a sterile
glass rod. Germlings from single conidia were then isolated and grown on PDA at
room temperature.
268
FIG. 1-4. Hyaloseta nolinae. F1G. 1. Top view of ascoma. Bar = 100 ym. FIG. 2.
Textura epidermoidea of ascomata with more or less circular bases of broken setae.
Bar = 10 pm. FIG. 3. Ascus and ascospores. Bar = 10 pm. FIG. 4. Hyaline setae
with swollen, ellipsoid tips on ascomata. Bar = 10 pm. FIG. 5. Monocillium nolinae.
Conidiophore and conidia. Bar = 10 pm.
269
TAXONOMY
Hyaloseta A.W. Ramaley gen. nov.
Ascomata in subiculo hyalino insidens, superficialia, sphaeroidea, ostiolum periphysibus, papilla nulla.
Peridium molle, tenue, ex stratis cellularum brunnearum extra et stratis cellularum hyalinarum, aliquantum
compressarum intra compositum, stratum extimum ex textura epidermoidea compositum; setas hyalinas
ferens. Asci unitunicati, octospori. Ascosporae 1-septatae, hyalinae.
Ascomata in a hyaline subiculum, superficial, sphaeroid, the ostiole periphysate,
lacking a papilla. Peridium soft, thin, composed of brown cell layers on the outside
and somewhat compressed, hyaline cell layers on the inside, the outermost layer
composed of fextura epidermoidea, bearing hyaline setae. Asci unitunicate,
octosporous. Ascospores 1-septate, hyaline. Monotype: Hyaloseta nolinae.
Hyaloseta nolinae A.W. Ramaley sp. nov. FIGS. 1-4
Anamorph: Monocillium nolinae A.W. Ramaley sp. nov.
Ascomata solitaria vel aggregata, in subiculo hyalino cum fungis aliis foliis emortuis insidens, superficialia,
sphaeroidea, collabentia, (50-) 75-125 (-150) ym diam, ostiolo, papilla nulla. Peridium molle, tenue, paries
6.4-16 pm crassus, ex 4-7 stratis cellularum brunnearum extra et stratis cellularum aliquantum
compressarum, hyalinarum intra compositum, stratum extimum ex textura epidermoidea compositum; setas
aseptatas, hyalinas, crassiparietibus, usque ad 48 um longas ferens, septum basale raro, setae expansae,
apex plus minusve ellipsoideus, lucens, elongatus, usque ad 3.2 wm crassus, setae ascomatibus super basim
incrassatam saepe disrumpentes. Asci unitunicati, oblongi, 28-48 x 3.2-4.8 jum, octospori. Aliquot fili
grandicellularis, deliquescentia, tenuiparietibus, hymenio apice inter ascos juvenes extensi. Ascosporae
oblongae-ellipsoideae, 5.6-7.2 (-9.6) x 2.4 pm, 1-septatae, hyalinae, laeves, tenuiparietibus, utraque
hemispora plerumque biguttulata, plus minusve in asco biseriatae.
HOLOTYPUS: U.S.A. NEW MEXICO: Lincoln County, Valley of Fires, U. 8S. Hwy
380, mile 61, along roadside, 22 October 1997. In foliis emortuis Nolina micrantha
I.M. Johnst., a Annette Ramaley n. 9706B lectus in UC depositus.
Ascomata solitary or aggregated, on hyaline hyphal subiculum on dead leaves with
other fungi, superficial, sphaeroid, collabent, (50-) 75-125 (-150) um diam., ostiolate,
lacking a papilla. Peridium soft, thin, wall 6.4-16 ym thick, composed of 4-7 brown
cell layers on the outside, and somewhat compressed hyaline cell layers on the inside,
the outermost layer of fextura epidermoidea; ascomata bearing aseptate, thick-walled,
hyaline setae up to 48 ym long, basal septum rare, setae expanding to a glistening,
elongate, swollen, more or less ellipsoid tip, up to 3.2 wm wide, often broken from
ascomata above the thickened base. Asci unitunicate, oblong, 28-48 x 3.2-4.8 ym,
octosporous. Among young asci, a few large-celled, thin-walled deliquescent
filaments extend to the hymenium from the apex. Ascospores oblong-ellipsoid, 5.6-
270
7.2 (-9.6) x 2.4 wm, 1-septate, hyaline, smooth, thin-walled, each hemispore usually
biguttulate, more or less biseriate in ascus.
Monocillium nolinae A.W. Ramaley sp. nov. biGs5
Mycelium album, superficiale, plerumque effusum, subiculum crassius in areis aliquot, apprime prope
ascomata formans. Hyphae hyalinae, ramosae, setas fragiles, crassiparietibus, apicibus elongatis,
strumulosis plus minusve elliopsoideis et conidiophora hyalina, aramosa, laevia, aseptata, strumulosa
ferentes. Conidiophora ex cellula conidiogena usque ad 40 ym longa constantia, septum basale destitutum,
omnia collectionem singularem, terminalem conidiorum incoloratorum ferentia. Conidia ellipsoidea, 2.8-
6.4 x 1.2-2.0 pm, aseptata, hyalina, laevia, tenuiparietibus.
HOLOTYPUS: NEW MEXICO. Lincoln County, Valley of Fires, U. 8S. Hwy 380,
mile 61, along roadside, 22 October 1997. Jn foliis emortuis Nolina micrantha |. M.
Johnst., a Annette Ramaley n. 9706B lectus in UC depositus.
Mycelium white, superficial, mostly effuse, forming thicker subiculum in some areas,
especially near ascomata. Hyphae hyaline, branched, bearing brittle, thick-walled
setae with elongate, swollen, more or less ellipsoid apices, and conidiophores.
Conidiophores consisting only of a conidiogenous cell, hyaline, unbranched, smooth,
aseptate, swollen, up to 40 um long, a short collarette occasionally visible, usually
lacking a basal septum separating it from hypha, each bearing a single, terminal,
accumulation of hyaline conidia. Conidia ellipsoid, 2.8-6.4 x 1.2-2.0 wm, aseptate,
hyaline, smooth, thin-walled.
Characteristics in culture on PDA: After 2 d germinating conidia consist of a single
filament 75-175 pm long, or with one to a few very short branches; after 3 d the
hyphae have many short branches. After 1 w, colonies approximately circular, 1.1-1.5
mm diam., white, flat. After 8 d, conidia present, colony with numerous conidio-
phores each consisting of a single cell. Conidiophores 22.4-40 wm long, usually ca
0.8 ym wide at the base, usually separated from the hyphae bearing them by a basal
septum, thin-walled from ca. the midpoint to the apex, thicker-walled below, usually
inflated, up to 2.4 um broad at the midpoint, then tapering to ca. 0.8 ym at the tip;
mononematous, each conidiophore terminated by a single phialide. Phialides
thickened periclinally, a short collarette occasionally visible. Conidia ellipsoid, 4.8-
6.4 x 1.6-2.4 pm, unicellular, hyaline, smooth. After 3 w, colonies ca. 13 mm diam.,
somewhat raised, margins white, becoming pale yellow on reverse, white aerial
hyphae formed centrally, hyphal ropes also formed, aerial hyphae and hyphal ropes
may bear conidiophores. Setae developing after ca 2 w, similar to those found in
nature but more often with a basal septum separating the seta from the hyphal cell
bearing it, sometimes elongating into a hyphal branch.
271
- Ascospores were not cultivated so cultures of the teleomorph and presumed anamorph
could not be compared. However, setose ascomata in the conidiogenous subiculum
bearing the same distinctive setae, and development of similar setae and
conidiogenous cells in cultures from conidia unite the stages.
Within the Hypocreales, Hyaloseta has characteristics of both the Niessliaceae and the
Bionectriaceae as delimited by Rossman et a/. (1999). In the Niessliaceae, in which
setose members are common, the superficial ascomata are dark colored at maturity,
whereas most members of the Bionectriaceae have pale-colored ascomata. As is true
for the Bionectriaceae, with few setose members, Hyaloseta ascomata are usually
aggregated and the setae are hyaline, not brown as in the Niessliaceae. Cell walls of
textura epidermoidea are common in the Niessliaceae but also present in some of the
Bionectriaceae. Although Hyaloseta ascomata have characteristics of both families,
the Monocillium anamorph has been found only in the Niessliaceae.
Five species of Monocillium described by Gams (1971) have structures that more or
less resemble the setae of AZ nolinae. Monocillium indicum S. B. Saksena, M.
constrictum W. Gams, and M. bulbillosum W. Gams were not linked to a perfect
phase, but their cultural characteristics separate them from A/. nolinae. Though not
directly comparable, colony growth of MM. nolinae is slower than any of these species.
In 10 days, colonies of MZ. indicum attain 20-22 mm diam, M. constrictum 7-8 mm
diam, and Af. bulbillosum 8-9 mm diam whereas the slow-growing colonies of AZ.
nolinae are only 1.1-1.5 mm diam in 7 days. Monocillium constrictum colonies are
whitish-rose-pale orange and those of AZ bulbillosum have a pale rose reverse,
whereas colonies of M4. indicum are white or light ocher, and M. nolinae has white
colonies that become pale yellow on the reverse after ca 3 weeks. In contrast to the
ellipsoid conidia of M. nolinae, M. indicum conidia are napiform, and M. constrictum
conidia are obovate to clavate. Both M. indicum and M. bulbillosum form sclerotia in
culture. Other Monocillium species with structures resembling M7. nolinae setae were
linked to perfect phases. The teleomorph for 14 granulatum (Fuckel) W. Gams is
Niesslia exosporioidea (Desm.) Winter and for another Monocillium in culture,
Niesslia exigua (Sacc.) Kirschst. All these Monocillium species have hyaline setose
appendages, but in contrast to Hyaloseta, the Niesslia teleomorphs have robust, deep
brown setae quite different in appearance from those of the anamorphs. Photographs
of a sixth Monocillium-like entity show upright, hyaline, hyphal appendages (Hyde et
al. 1999) resembling MZ. nolinae setae. Niesslia palmicola K.D. Hyde, Goh, J.E.
Taylor & J. Frohl., the teleomorph, bears similar appendages. This fungus can be
distinguished from Hyaloseta in several ways. The conidiogenous cells are septate
and thin-walled except at the swollen apex, whereas conidiogenous cells of AZ. nolinae
are aseptate and have thickened walls below the subapical swelling. The teleomorphs
are distinguished by the fextura epidermoidea of the Hyaloseta peridium, rather than
272
FIG. 6-8. Niesslia agavacearum, FIG. 6. Ascoma. Bar = 20 ym. FIG. 7. Asci. Bar
=10 yum. FIG. 8. Ascospores. Bar = 5 ym.
textura angularis, and ascospores of Hyaloseta are considerably smaller (5.6-7.2 x 2.4
pm vs 10-15 x 2.5-4 wm). In addition, the hyphal and ascomatal appendages of
Hyaloseta are thick-walled setae rather than thin-walled hairs. Although the
Monocillium anamorph is similar to those of some Niesslia species, the Hyaloseta
teleomorph is distinguished by possessing thick-walled, hyaline setae expanded
apically, rather than the darkly pigmented, pointed, setae typical of the genus Niess/ia.
Niesslia agavacearum A.W. Ramaley sp. nov. FIGS. 6-8
Anamorph: Incognita
Ascomata superficialia, saepe in gregibus parvis, super stromatibus hypharum brunnearum adpressarum,
globosa, 36-60 pm diam, plerumque subbrunnea, setosa, ostiolata. Peridium tenue, ex 1 (-2) stratis
273
cellularum brunneparietibus extra, stratum extimum ex textura epidermoidea sed saepe obscura per
pigmentum positum, et 1-2 stratis cellularum compressarum, hyalinarum intra constans; 4-8 setas usque ad
50 pm longas, acutas, brunneas, crassiparietibus, plerumque aseptatas, interdum septo prope basem
strumulosam ferens. Asci unitunicati, 19.2-22.4 x 6.4 pm, ellipsoidei vel brevioblongi, octospori.
Ascosporae cylindraceae-fusoideae, extrema rotunda, 12-15.2 (-19.2) x 1.6-2.4 pm, 1-septatae, hyalinae,
laeves, cellula omnis biguttulata, in asco congestae. Aliquot periphyses breves adsunt.
HOLOTYPUS: U.S.A. NEW MEXICO: Lincoln County, Valley of Fires, U. 8. Hwy
380, along roadside, 28 October 1998, in foliis emortuis Dasylirion leiophyllum
Engelm., a Annette Ramaley n. 9815A lectus in BPI depositus.
Ascomata superficial, often in small groups, atop stromata of appressed, brown
hyphae, globose, 36-60 (-72) ym diam., usually pale brown, setose, ostiolate.
Peridium thin, composed of | (-2) layers of compressed, brown-walled ceils externally,
outermost layer of fextura epidermoidea though its presence is often obscured by
pigment deposition, and 1-2 layers of compressed, hyaline cells internally; bearing 4-8
setae each up to 50 pm long, pointed, brown, thick-walled, usually aseptate,
occasionally with a septum near the swollen base. Asci unitunicate, 19.2-22.4 x 6.4
pm, ellipsoid to short oblong, 8-spored. Ascospores cylindric-fusoid, ends rounded,
12-15.2 (-19.2) x 1.6-2.4 ppm, 1-septate, hyaline, smooth-walled, each cell biguttulate,
crowded in the ascus. A few short periphyses present.
The minute, superficial, brown, setose ascomata with fextura epidermoidea,
unitunicate asci, and hyaline, 1-septate ascospores suggest placement in this family
and genus. A few ascomata of this species were observed on leaves of Nolina
micrantha as well as the Dasylirion substrate.
Ascomata of Niesslia agavacearum are usually in small groups atop appressed, brown,
hyphal stromata that may cover large areas of the leaves on which the ascomata
appear. Hyphae extending from the walls of ascomata are pale brown, 1.6-2.4 »m
diam. with septa up to 16 ym apart. Hyphae of the stromata are variable, but typically
have sculptured walls that are much darker colored, broader, and shorter than the
hyphal cells extending from the ascomata. It has not been possible to determine the
relationship between the Miesslia ascomata and the extensive hyphal stromata, but N.
agavacearum has never been observed apart from the stromata. All trials to cultivate
Niesslia agavacearum were unsuccessful.
Niesslia is a widespread genus with eight species which have been examined recently
enough to be described or redescribed in terms allowing comparison with N.
agavacearum . Gams descriptions (1971) of N. exosporioides, N. exigua, N. exilis
(Albertini & Schwein.) G. Wint., and N. coloradensis (Cash & Davidson) W. Gams
separate these four species from N. agavacearum. Ascospores of N. exigua and N.
coloradensis are ellipsoid, and for both species shorter than N. agavacearum
274
ascospores (7.0-8.5 um vs 12-15.2 wm). The length of ascospores of N. exilis, the type
species, approaches that of N. agavacearum ascospores, but N. exilis asci are longer
and narrower (30-50 x 3-5 wm vs 19.2-22.4 x 6.4 ym), and the ascospores are uni- to
biseriate within an ascus rather than crowded as they are in asci of N. agavacearum.
Niesslia exosporioides is much like N. exilis, but the few setae may be up to 100 um
long vs. 30-50 ym for N. exilis setae. Niesslia palmicola (Hyde et al. 1999)
ascospores are as long as ascospores of N. agavacearum, but those of N. palmicola are
broader (10-15 x 2.5-4 wm vs 12-15.2 x 1.6-2.4 ym). In addition, N. palmicola
ascomata bear hyaline hairs expanded at the tips rather than pointed, brown setae.
Information provided by Barr (1993) for N. erysiphoides (Ellis & Everh.) Barr and N.
lanea (Dearness) Barr distinguishes these species from N. agavacearum. Niesslia
erysiphoides ascospores are larger than those of N. agavacearum (16.5-25 x 2-3 ym
vs 12-15.2 x 1.6-2.4 pm), the asci are larger (33-44 x 7.5-9 wm vs 19.2-22.4 x 6.4
pm), and the ascomata are found in a thin, brown subiculum, not on an appressed,
brown, hyphal stroma. Niesslia lanea is comparable to N. exilis, but the ascospores
are relatively broad. Niesslia pulchriseta (Peck) Barr has small ascospores (5.5-7.5 x
1-1.5 ym) and huge setae (Barr ef al. 1986). In addition to these characters, the
minute ascomata of N. agavacearum distinguish it from all other species. Niesslia
agavacearum is therefore designated a new species of the genus.
ACKNOWLEDGEMENTS
I gratefully acknowledge Dr. Amy Rossman's review of this manuscript. Her
suggestions that were incorporated improved its content and clarity. I also thank her
for supplying help with references to the literature.
LITERATURE CITED
Barr, M.E. 1993. Redisposition of some taxa described by J. B. Ellis. Mycotaxon 46: 45-76. ;
Barr, M_E., C.T. Rogerson, S.J. Smith, and J.H. Haines. 1986. An annotated catalog of the Pyrenomycetes
described by Charles H. Peck. Bull. New York State Mus. Nat. Hist. 459: 1-74.
Gams, W. 1971. Cephalosporium-artige Schimmelpilze (Hyphomycetes). Gustav Fischer Verlag. Stuttgart.
262 p.
Hyde, K.D., T.K. Goh, J.E. Taylor and J. Frohlich. 1999. Byssosphaeria, Chaetosphaeria, Niesslia and
Ornatispora gen. nov., from palms. Mycol. Res. 103: 1423-1439.
Rossman, A.Y., G.J. Samuels, C.T. Rogerson, and R. Lowen. 1999. Genera of Bionectriaceae,
Hyponectriaceae, and Nectriaceae (Hypocreales, Ascomycetes). Stud. Mycol. 42: 1-248.
Samuels, G.J. and M.E. Barr. 1997. Notes on and additions to the Niessliaceae (Hypocreales). Canad. J. Bot.
75: 2165-2176.
MYCOTAXON
Volume LXXIX, pp. 275-284 July-September 2001
THREE NOTEWORTHY AMANITAE OF SUBGENUS
LEPIDELLA FROM CHINA’
ZUO-HONG CHEN!, ZHU-LIANG YANG?" and ZHI-GUANG ZHANG!
'College of Life Sciences, Hunan Normal University, Changsha 410081, China
*Kunming Institute of Botany, Academia Sinica, Kunming 650204, China
Abstract: Three species of the genus Amanita with amyloid spores from China
are described and illustrated. They are A. sinocitrina, A. kotohiraensis, and A.
gymnopus. The first species is new to science, while the second is new for China.
The last taxon is reported based on a collection with a double annulus on the stipe.
Key words: taxonomy, Amanitaceae, new species
While studying the Chinese species of Amanita, we have found three
noteworthy taxa. They are reported herein. Color codes of the form "3B3" are from
Kornerup & Wanscher (1981); Color names with first letters capitalized (e.g., Deep
Olive-Buff) are from Ridgway (1912).
1. Amanita sinocitrina Z. L. Yang, Z. H. Chen & Z. G. Zhang, sp. nov. FIGS. 14
Pileus 4—6 cm latus, convexus vel plano-convexus, griseo-flavus, interdum brunne-
olus; margine non striata, non appendiculata; reliquiis volvae coactis, verrucosis vel
flocculosis, applanatis, tenuibus, griseis vel brunneis ornatus. Lamellae liberae, albae
vel albidae, confertae, lamellulis attenuatis. Stipes 6—9 x 0.5—1 cm, subcylindricus vel
sursum attenuatus, albidus, annulatus, bulbo subtruncato vel truncato, marginato, 1.5—
2.5 cm lato, volvae griseis vel brunneolis, verrucosis, flocculosis vel breviter limbatis.
Annulus membranaceus, albidus vel cremeus vel subflavus supra, albidus vel griseolus
vel brunneolus infra. Caro alba, sed tarde brunnescens. Basidia 25—35 x 8.5—10.5 ym,
4-sporigera. Sporae (5.5—) 6.0-7.5 (—8.0) x (5.0-) 5.5—7.0 (—7.5) ym, globosae vel
subglobosae, amyloideae. Fibulae absentes. Holotypus: Z.H. Chen 3691 (HKAS 36983),
24. VI. 1997, Yizhang, Hunan, China.
Etymology: sinocitrina is named for the Chinese mushroom because of its
similarity to A. citrina originally described from Europe.
Basidiocarps small to medium-sized (fig. 1). Pileus (3—) 4-6 cm in diameter,
convex to plano-convex, grey-yellow [3B3-6, 3C4—5; Deep Olive-Buff, Dark
Olive-Buff], sometimes brownish [5C4—6], with indistinct, innate, radial fibrils;
volval remnants as felty, verrucous to floccose patches, 2-5 mm wide, ca. 1 mm
thick, grey to brownish, randomly arranged, often washing off in wet weather;
margin smooth, non-appendiculate. Lamellae free, white to pale cream-colored,
* The project was supported by the National Natural Science Foundation of China
(No. 39800007 & 30070005).
** Corresponding author (e-mail: zlyang@public.km.yn.cn).
276
crowded; lamellulae attenuate, evenly distributed. Stipe 6-9 =< 0.5—1 cm, subcy-
lindric or somewhat tapering upward, with apex slightly expanded, white to dirty
white, covered with yellowish squamules above annulus, with whitish to greyish
squamules or fibrils under annulus; basal bulb subabrupt to abrupt, marginate, 1.5—
2.5 cm wide, upper margin covered with greyish to brownish, verrucous to floccose
volval remnants, sometimes submembranous and forming a brief limb around bulb
margin. Annulus persistent, superior to nearly medium, membranous, whitish to
cream-colored or pale yellowish on upper surface, whitish to greyish or brownish
on lower surface. Trama white, very slowly turning brownish when exposed,
especially in the bulb. Smell unknown.
/ a\\ry
C77) / PO NAWNY
Lite aN ‘ ‘
agelide 0 \ dis Ne
SSS Soong TIP
Vat
CaN
1
Figs. 1-3: Amanita sinocitrina (HKAS 36983, holotype).
1. Basidiocarps; 2. Hymenium and subhymenium; 3. Basidiospores.
Lamellar trama bilateral. Mediostratum 30-40 um wide, composed of abun-
dant fusiform to long ellipsoid, inflated cells (60-90 <x 20-25 um), mixed with
fairly abundant to abundant, filamentous hyphae, 2-7 um wide; vascular hyphae
rare. Lateral stratum composed of fairly abundant to abundant fusiform to long
ellipsoid, inflated cells (55-100 =x 15-20 um), mixed with fairly abundant to
abundant filamentous hyphae, 3—8 um wide, diverging at an angel of ca. 30°-45° to
the mediostratum; septa without clamps. Subhymenium (fig. 2) 30-40 (-50) um
thick, with 2-3 (-4) layers of subglobose to ovoid to short ellipsoid, inflated cells,
8—25 (—30) x 7-20 (—25) um, occasionally mixed with barely inflated elements, 3—7
pat i
~ um wide. Basidia (fig. 2) [130/6/5]'! (20—) 25-35 (40) x (8.0—-) 8.5—10.5 (—11.5)
um, clavate, 4-spored, rarely 1- or 2-spored; sterigmata 3—5 um long; basal septa
without clamps. Basidiospores (fig. 3) [135/6/5]? (5.5—) 6.0-7.5 (8.0) x (5.0-)
5.5—7.0 (—7.5) um [Q = 1.0—-1.15 (-1.20), Q = 1.08 + 0.05], globose to subglobose,
rarely broadly ellipsoid, amyloid, colorless, hyaline, thin-walled, smooth; apiculus
small. Lamellar edge appearing as sterile, somewhat gelatinized, incomplete strip,
30-70 um wide in side view, composed of very abundant, globose to subglobose or
ovoid (20-40 x 15-30 pum) to ellipsoid (35-50 x 20-30 um), sometimes
sphaeropedunculate (30-50 =x 15-30 um) inflated cells, single and terminal, or in
chains of 2—3 and terminal, thin-walled, colorless, hyaline to subhyaline, mixed
with scattered to fairly abundant, filamentous hyphae, 2-6 um wide, thin-walled,
gelatinized. Pileipellis 40—90 um thick; upper layer 20—50 (—70) um thick, strongly
gelatinized, composed of subradially and loosely arranged, gelatinized, filamentous
hyphae 1—5 pm wide, thin-walled, colorless, hyaline; lower layer (20-40 um thick)
composed of radially and compactly arranged hyphae 3-10 (—12) um wide,
subhyaline, colorless or with brownish vacuolar pigments, with terminal cells not
distinctly inflated; vascular hyphae rare. Volval remnants (fig. 4) on pileus
composed of irregularly arranged elements; inflated cells very abundant, globose to
subglobose to ovoid (20-80 x 20-60 um) or ellipsoid (40-60 x 25-30 um), single
and terminal, or in chains of 2—3 and terminal, thin- to slightly thick-walled (up to
0.5 ym thick), colorless, hyaline, colorless or with brownish to greyish, vacuolar
pigments; filamentous hyphae fairly abundant to abundant, 2—7 um wide, frequently
septate, thin-walled, colorless, hyaline or occasionally with brownish to brown,
vacuolar pigments; vascular hyphae rare. Volval remnants on upper margin of bulb
on stipe base similar to those on pileus, but with filamentous hyphae somewhat
more abundant. Stipe trama composed primarily of longitudinally arranged, long
clavate, terminal cells, 250-400 x 25—40 um, mixed with scattered (in interior) to
fairly abundant to abundant (on. stipe surface) filamentous hyphae 2-8 (-12) um
wide; vascular hyphae rare. Annulus composed of subradially arranged,
filamentous hyphae 2—5 (—8) um wide, thin-walled, colorless, hyaline to subhyaline,
frequently branching, anastomosing; inflated cells rare, clavate to fusiform (25—45
x 9-12 um), thin-walled, hyaline to subhyaline, almost colorless, usually single and
terminal; vascular hyphae rare.
Specimens examined: CHINA. HUNAN PROVINCE: Yizhang County, Mangshan, alt.
900 m, 24-VI-1997, Z.H. Chen 3691 (HKAS 36983, holotype!); same location, alt.
1200 m, 27-VII-1997, Z.H.Chen 3712 (HKAS 36982); same location, alt. 900 m, 24-
VI-1997, Z.H. Chen 3690 (HKAS 36981); same location, 29-I[X-1981, Y. C. Zong & X.
L. Mao 65 (HMAS 42248, as A. porphyria in Mao et al., 1986); same location, 27-IX-
1981, X. L. Mao & Y. C. Zong 20 (HMAS 52613, as A. porphyria in Mao et al., 1986).
Habitat and Distribution: on ground in mixed forests. Only known from central
China.
' 130 mature basidia from 6 basidiocarps of 5 collections measured in 5%KOH solution.
* 135 spores from 6 basidiocarps of 5 collections measured in 5% KOH solution; Q is
used to mean "length/width ratio" of a spore; Q means average Q of all spores +
sample standard deviation.
278
Fig. 4: Crushed volval remnants from pileus
of Amanita sinocitrina (HKAS 36983, holotype).
Observations: Amanita sinocitrina belongs in Amanita subgenus Lepidella section
Validae (Fr.) Quél. in the sense of Yang (1997). It is characterised by its small to
medium-sized basidiocarp with a grey-yellow pileus, grey to brownish volval
remnants, a whitish to yellowish annulus, a subabrupt to abrupt, marginate bulb on
the base of the stipe, small basidia and spores. Amanita sinocitrina is related to
members around A. citrina (Schaeff.) Pers. However, A. sinocitrina differs from A.
citrina, originally described from Europe, by its differently colored pileus with
somewhat darker colored volval remnants, smaller basidia and significantly smaller
spores (Breitenbach & Kranzlin, 1995: 146; and unpublished data of Yang studying
material from Germany-HKAS 31449 and 31537). HMAS 42248 & 52613 were
regarded as A. porphyria (Alb. & Schw.: Fr.) Fr. by Mao ef al. (1986). But A.
porphyria differs from A. sinocitrina in its differently colored pileus and annulus,
larger (longer and wider) basidia, and significantly larger spores (Breitenbach and
Kranzlin, 1995: 152). Furthermore, the inflated cells in the volval remnants on the
pileus of A. sinocitrina are more abundant than those of A. porphyria as compared
with material of the latter collected from Germany-HKAS 31531, which has spores
measuring [30/1/1] (7.5—) 8.5—10.0 (-10.5) = (7.0—) 8.0-9.5 (-10.0) um [Q = 1.0-
1.07 (1.09), Q = 1.04 + 0.03], and basidia [30/1/1] measuring 35-53 x 9.5—12.0
(—13.0) pm.
Amanita sinocitrina is also similar to A. citrina var. grisea (Hongo) Hongo, A.
citrina f. lavendula (Coker) Vesely, A. brunnescens Atk. var. brunnescens, A.
279
-brunnescens var. pallida Krieger, A. brunnescens f. straminea E. J. Gilb., A.
aestivalis Singer ex Singer and A. asteropus Sabo ex Romagn. Nevertheless, A.
citrina var. grisea, described from Japan, has a darker colored pileus, pallid yellow
annulus, larger basidia and larger spores (Hongo, 1958). Amanita citrina f.
lavendula, originally described from the United States, is distinguished from A.
sinocitrina by, among others features, its differently colored pileus with lavender
volval remnants and somewhat smaller spores. Amanita brunnescens from eastern
North America usually has larger basidiocarps with umbrinous brown, innate radial
striations or fibrils on the pileus covered with whitish to pallid volval remnants, a
white stipe with a usually longitudinally cleft bulb, longer basidia, and larger spores
(Tulloss et al., 1995; Jenkins, 1986). Amanita brunnescens f. straminea E. J. Gilb.
has a differently colored pileus and stipe, and larger spores (Gilbert, 1941). Amanita
brunnescens var. pallida and A. aestivalis, both described from eastern North
America, have a paler colored pileus, a longitudinally splitting bulb, larger basidia
and larger spores (Tulloss et al., 1995; Jenkins, 1986). Amanita asteropus, described
from Europe, has a differently colored pileus with differently colored volval
remnants, and without innate, radial fibrils, a longitudinally splitting bulb, trama or
surface of stipe turning rapidly brown-orange when injured, and larger spores
(Tulloss & Massart, 1998).
2. Amanita kotohiraensis Nagasawa & Mitani, Mem. Natn. Sci. Mus., Tokyo 32:
93, Figs. 1-7 (2000). FIGS. 5-8
Basidiocarps small to medium-sized (fig. 5). Pileus (3—) 5-8 cm in diameter,
convex to applanate, sometimes slightly depressed at disc, white, but sometimes
cream-colored over disc; volval remnants as felty to verrucous patches, 2-4 (—15)
mm wide, 1—1.5 mm thick, white, randomly arranged, sometimes nearly completely
glabrous (volval remnants washed off by rain?); margin smooth, appendiculate.
Lamellae free, yellowish to pale yellow, crowded; lamellulae attenuate, evenly
distributed. Stipe 6—13 < 0.5—1.5 cm, subcylindric or usually tapering upward, with
apex slightly expanded, white, often covered with white squamules or fibrils
especially towards the stipe base; basal bulb subglobose, 1.5—4 cm wide, upper part
covered with white, subgranular to verrucous or subconical volval remnants,
irregularly arranged or in incomplete concentric rings. Annulus superior to
subapical, pendant from attachment 1—2.5 cm below apex of stipe, white, finely and
radially striate above, membranous, sometimes shredding or torn from stipe during
dasidiocarp expansion and then fugacious. Trama white, unchanging. Smell
unpleasant, even when dried.
_ Lamellar trama bilateral. Mediostratum 30—40 um wide, composed of fairly
abundant to abundant subfusiform to long ellipsoid, inflated cells (90-110 =< 15-20
um), mixed with abundant, filamentous hyphae 2-5 um wide, often clamped;
vascular hyphae rare. Lateral stratum composed of fairly abundant to abundant
fusiform to long ellipsoid, inflated cells (55-90 x 10-25 um), mixed with abundant
filamentous hyphae 2—7 um wide, often clamped, diverging at an angel of (30°-)
45°-60° to the mediostratum. Subhymenium (fig. 6) 30-40 um thick, with 2-3
layers of subglobose to ellipsoid or irregularly formed, inflated cells, 9-27 x 8-15
um, sometimes mixed with barely inflated elements, 5-7 um wide; septa usually
clamped. Basidia (fig. 6) 35-50 =< 8-13 um, clavate, 4-spored, occasionally 2-
280
spored; sterigmata 3—5 um long; basal septa usually with clamps. Basidiospores
(fig. 7) [185/8/5] (7.0—) 7.5—9.5 (—11.0) x 5.0-6.5 (—7.0) um [Q = (1.21-) 1.27—1.60
(—1.73), Q = 1.44 + 0.10], broadly ellipsoid to ellipsoid, rarely elongate, amyloid,
colorless, hyaline, thin-walled, smooth; apiculus small. Lamellar edge appearing as
20 um
Figs. 5—7: Amanita kotohiraensis (HKAS 36995).
5. Basidiocarps; 6. Hymenium and subhymenium; 7. Basidiospores.
sterile, incomplete strip up to 120 um wide in side view, composed dominantly of
subglobose to broadly clavate or sphaeropedunculate, inflated cells (18-40 =x 17-23
uum), single and terminal, sometimes in chains of 2—3 and terminal, thin-walled,
colorless, hyaline, often clamped; filamentous hyphae rare. Pileipellis 70-100 um
thick; upper layer 30-50 um thick, strongly gelatinized, composed of subradially
arranged, filamentous hyphae up to 5 wm wide, gelatinized, thin-walled, colorless,
hyaline; lower layer (40-50 um thick) composed of subradially and compactly
arranged hyphae 3—5 ym wide, hyaline to subhyaline, often clamped; vascular
hyphae rare. Volval remnants (fig. 8) on pileus composed of (very) abundant,
subglobose to ovoid (25-60 x 20-50 um), sometimes ellipsoid (35-80 x 20-40 um)
inflated cells, single and terminal or in chains 2—3 and terminal, thin-walled,
colorless, hyaline; filamentous hyphae fairly abundant to locally abundant, more
abundant in volval remnant base than elsewhere, 2-7 um wide, often clamped,
frequently branching and anastomosing, interwoven, thin-walled, colorless, hyaline
or sometimes with slightly yellowish contents; vascular hyphae rare, 2—7 (—10) um
wide. Volval remnants on upper part of basal bulb similar to those on pileus, but
281
with filamentous hyphae somewhat more abundant and inflated cells often in
shorter chains. Stipe trama composed primarily of longitudinally arranged, long
clavate, terminal cells, 280-400 <x 20-35 um, mixed with scattered filamentous
hyphae 1.5—7 um wide, often clamped; vascular hyphae rare. Annulus composed of
abundant inflated cells, narrowly clavate to broadly clavate (30-80 x 10-25 um),
becoming broadly ellipsoid, ovoid to subglobose or sphaeropedunculate (30-50 x
15-35 pm) towards the upper surface, thin-walled, hyaline, often single and
terminal; filamentous hyphae fairly abundant, 2-5 um wide, thin-walled, colorless,
hyaline, frequently branching, anastomosing, often clamped; vascular hyphae rare.
WW
ee anaes
NOSE
Fig. 8: Crushed volval remnants from pileus of A. kotohiraensis (HKAS 36996).
Specimens examined: CHINA. JIANGSU PROVINCE: Nanjing Municipality, Lingusi,
17-VIII-1957, S.C. Teng 4923b (HMAS 19941b). ANHUI PROVINCE: Huangshan
Municipality, Huangshan, 30-VIII-1957, S.C. Teng 5150 (HMAS 20106). HUNAN
PROVINCE: Yizhang County, Mangshan, alt. 900 m, 7-VII-2000, Z.H. Chen 3677
(HKAS 37051); same location, alt. 1200 m, 6-VII-2000, Z.H.Chen 4006 (HKAS 36996);
same location, alt. 1200 m, 24-VII-1997, Z.H. Chen 3702 (HKAS 36995).
Habitat and Distribution: on ground in mixed forests. Described from Japan, and new
_to China.
o
Observations: The volval remnants on the pileus of the specimens cited above
were rather difficult to analyse. They are probably composed of more or less
irregularly arranged elements. But in the protologue of A. kotohiraensis, elements in
the volval remnants on the pileus are described as perpendicularly oriented to the
282
pileus surface (Nagasawa & Mitani, 2000). Further observations on well-dried
specimens are needed. Amanita kotohiraensis is representative of subsection
Solitariae section Lepidella of the subgenus Lepidella (Bas, 1969). Nagasawa &
Mitani (2000) suggested that it is closely related to A. microlepis Bas, described
from the United States. But it differs from A. microlepis by its differently colored
pileus and lamellae, and smaller spores. Furthermore, the volval remnants on pileus
of A. kotohiraensis usually tend to be in patches rather than in warts as in A.
microlepis (see Bas, 1969; Jenkins, 1986).
HMAS 19941b and 20106 were identified by S. C. Teng as A. caesarea var. alba
Gillet and A. verna (Bull.: Fr.) Lamarck respectively. But A. caesarea var. alba,
assignable to section Caesareae Singer ex Singer of subgenus Amanita, has a striate,
non-appendiculate pileus only occasionally with volval remnants, truncate
lamellulae, a firm and saccate volva on the stipe base lacking a bulb, and inamyloid
spores. Amanita verna, belonging in section Phalloideae (Fr.) Quél., has a non-
appendiculate pileal margin, a firm and membranous, limbate volva composed
mainly of filamentous hyphae, distinctly larger spores, and lacks clamps.
3. Amanita gymnopus Corner & Bas, Persoonia 2: 259, Pl. 4a, fig. 16 (1962)
FIGS. 9-10
Basidiocarps medium-sized to large (fig. 9). Pileus 6-9 cm in diameter, convex,
becoming concave when over mature, white to cream-colored to brownish; volval
remnants as yellowish to brownish, thin, submembranous, adnate patches, randomly
arranged; margin smooth, appendiculate. Lamellae free, cream-colored to yellow-
ish, then ochraceous, crowded; lamellulae attenuate, evenly distributed. Stipe 7-10
x 0.7—1.5 cm, subcylindric or slightly tapering upward, with apex slightly expanded,
whitish to brownish, or with pinkish brown tinge; basal bulb broadly clavate to
subglobose, 1.5—2.5 cm wide, white to dirty white, pruinose to subsquamulose near
top, nearly glabrous below, without volval remnants, base often with a few rhizoids.
Annulus apical to subapical, whitish to cream-colored, radially striate above,
membranous to submembranous; with a smaller and firmer second annulus 2—3 cm
apart from the apex. Trama white to cream-colored, but turning slowly brownish
when exposed. Smell strong, of "sulphur".
Basidia 40-50 x 8-11 um, clavate, 4-spored; sterigmata 4—S pm long; basal
septa often with clamps. Basidiospores (fig. 10) [30/1/1] 6.0-7.5 (8.0) x (5.0-)
5.5-6.5 um [Q = 1.08-1.23 (—1.34), Q = 1.14 + 0.07], subglobose to broadly
ellipsoid, rarely ellipsoid, amyloid, colorless, hyaline, thin-walled, smooth; apiculus
small. Pileipellis hardly differentiated, composed of + radially arranged filamentous
hyphae 2—5 um wide, thin-walled, nearly colorless or with yellowish contents, not
gelatinized or only the hyphae of upper part slightly gelatinized, sometimes
clamped; vascular hyphae rare. Volval remnants on pileus composed of dominantly
filamentous hyphae 2-5 wm wide, colorless and hyaline or sometimes with
yellowish contents, sometimes clamped; inflated cells scattered, narrowly clavate to
broadly clavate, sometimes ovoid to subglobose, 25-40 x 8-18 um, single and
terminal, sometimes in chains of 2—3 and then terminal, thin-walled, subhyaline or
with yellowish contents; vascular hyphae rare. Stipe trama composed primarily of
longitudinally arranged, long clavate, terminal cells, 250-400 x 25-35 um, mixed
with scattered filamentous hyphae 2—9 um wide; vascular hyphae rare. Annulus
bs ee ee rll le
283
- composed of abundant to very abundant inflated cells, ovoid to ellipsoid (35-60 x
20—40 um), sometimes subglobose (25—40 x 20-35 um), thin-walled, subhyaline or
with yellowish to pale brownish contents, single or in chains of 2—3 and terminal;
filamentous hyphae scattered to locally fairly abundant, 2-6 um wide; vascular
hyphae rare. The second annulus (the lower one) composed mainly of filamentous
hyphae 2-6 um wide; inflated cells rare, only locally (fairly) abundant, subglobose
to ellipsoid, 20-60 x 20-40 um; vascular hyphae rare.
Figs. 9-10: Amanita gymnopus (HKAS 37012).
9. Same basidiocarp in two views; 10. Basidiospores.
Specimen examined: CHINA. HUNAN PROVINCE: Yizhang County, Mangshan, alt.
600 m, 15-VII-1996, Z.H. Chen 3680 (HKAS 37012).
Habitat and Distribution: on ground in mixed forests. Described from Malaysia, and
also reported from Japan, and China.
Observations: Amanita gymnopus was first reported from Fujian Prov., southeast
China by Huang (1998: 135) but only with a very brief description. The collection
cited above agrees well with the original concept of A. gymnopus (Corner & Bas,
1962; Bas, 1969) except that the stipe bears a second annulus, a feature probably
not consistent in the species, because fruitbodies both with and without a second
annulus of this taxon have been observed (see Hongo, 1974; Imazeki et al., 1988;
Hongo & Izawa, 1994). Bas (1969: 558) interprets the second annulus as (part of)
the limbus internus in A. ochrophylla. This interpretation needs to be verified in the
future. Amanita ochrophylla (Cooke) Clel., described from Australia, is closely
related to A. gymnopus, but the former differs from the latter by its stipe without
rhizoids, different structure of the volval remnants on the pileus, and significantly
larger spores (Bas, 1969; Reid, 1980; Wood, 1997). According to Reid (1980), and
Wood (1997), A. ochrophylloides Reid, and A. ochraceobulbosa Wood are closely
related to A. ochrophylla. However, A. ochrophylloides, still not a well known
284
species, is distinguished from A. gymnopus by, among other features, its strobili-
form volval remnants with different structure on a pale brown pileus, pale golden
yellow lamellae, a short limbate volva on the bulb, and larger spores (Reid, 1980).
Amanita ochraceobulbosa differs from A. gymnopus by its verrucous, conical to
pyramid volval remnants on the pileus composed mainly of inflated cells, white to
cream lamellae, and significantly larger spores (Wood, 1997). The question may
still be open whether A. ochrophylloides and A. ochraceobulbosa are closely
related to A. ochrophylla or A. gymnopus.
ACKNOWLEDGMENTS
The authors are very grateful to Dr. R. E. Tulloss, Roosevelt, New Jersey, for his
valuable published and unpublished data on Amanita, and for critically reviewing the
manuscript.
LITERATURE CITED
Bas C. 1969. Morphology and subdivision of Amanita and a monograph of its section
Lepidella. Persoonia 5: 285—579.
Breitenbach J. and Kranzlin F. 1995. Pilze der Schweiz. Band 4. Switzerland: Verlag
Mykologia.
Corner EJH, Bas C. 1962. The genus Amanita in Singapore and Malaya. Persoonia 2:
241-304.
Gilbert EJ. 1941. Amanitaceae. In: Iconographia mycologia 27, Suppl. 1 (2-3) (ed. J.
Bresadola). Italy: Mediolani.
Hongo T. 1958. Notes on Japanese larger fungi (13). Journ. Jap. Bot. 33: 344—350.
Hongo T. 1974. Notulae Mycologicae (13). Mem. Fac. Liberal Arts Shiga Univ., Pt. 2,
Nat. Sci. 24: 44-51.
Hongo T, Izawa M. 1994. Kinoko. Japan: Yama-kei Publishers Co., Ltd.
Huang NL (ed.). 1998. Colored Illustrations of Macrofungi (Mushrooms) of China.
China: China Agricultural Press.
Imazeki R, Otani Y, Hongo T. 1988. Fungi of Japan. Tokyo, Japan: Yama-kei Publishers
Co: Lid:
Jenkins DT. 1986. Amanita of North America. USA: Mad River Press, Inc.
Kornerup A, Wanscher JH. 1981. Taschenlexikon der Farben. 3. Aufl. Gdttingen,
Deutschland: Muster-Schmidt Verlag.
Mao XL, Zong YC, Yao BP. 1986. The distributional features of macrofungi in Mt.
Mang, Hunan. Acta Mycol. Sinica. Suppl. I: 397-406.
Nagasawa E, Mitani S. 2000. A new species of Amanita section Lepidella from Japan.
Mem. Natn. Sci. Mus., Tokyo 32: 93-97.
Reid DA. 1980. A monograph of the Australian species of Amanita Pers. ex Hook.
(Fungi). Austr. Journ. Bot. Suppl. Ser. 8: 1—97.
Ridgway R. 1912. Color standards and nomenclature. USA: Publ. by author.
Tulloss RE, Massart F. 1998. Quelques observations courtes et préliminaires sur
Amanita asteropus et Amanita aestivalis. Docum. Mycol. 28: 73—76 + 119.
Tulloss RE, Stephenson SL, Bhatt RP, Kumar A. 1995. Studies on Amanita (Amani-
taceae) in West Virginia and adjacent areas of the mid-Appalachians. Preliminary
results. Mycotaxon 56: 243-293.
Wood AE. 1997. Studies in the genus Amanita (Agaricales) in Australia. Austr. Syst.
Bot. 10: 723-854.
Yang ZL. 1997. Die Amanita-Arten von Siidwestchina. Biblioth. Mycol. 170: 1-240.
MYCOTAXON
Volume LXXIX, pp. 285-288 July-September 2001
STUDIES IN NEOTROPICAL POLYPORES 13
CERIPORIOPSIS CYSTIDIATA SP NOV.
CLARICE LOGUERCIO-LEITE & GUSTAVO VERNET DE COSTA
GONCALVES
Laboratorio de Micologia, Departamento de Botanica, CCB, Universidade Federal de
Santa Catarina, 88090 400, Floriandépolis, SC, Brazil, clleite@ccb.ufsc.br
and
LEIF RYVARDEN
Botany Department, University of Oslo, P. O. Box. 1045, Blindern, N-0316 Oslo,
Norway, leif.ryvarden@bio.uio.no
ABSTRACT
Ceriporiopsis cystidiata is described as new and characterized by a whitish to cream
resupinate basidioma, a monomitic hyphal system and smooth, thin-walled hymenial
cystidia. A key to Ceriporiopsis species in the neotropics is provided.
Key words: Polyporaceae, tropical America.
INTRODUCTION
Ceriporiopsis was described by Domanski (1963) to accommodate species with a
resupinate, mostly light-coloured basidioma, a monomitic hyphal system with
clamped generative hyphae and smooth, basidiospores without reaction in Melzer’s
reagent. All species produces a white rot in the attacked wood. It is a cosmopolitan™
genus, and 26 names are registered in the genus (CBS database: www.cbs.knaw.nl)
out of which a number have later been transferred to other genera. The genus is by
all probability artificial including species with different phylogenetic origin, kept
together only by a simple construction. Further DNA studies must be done to reveal
the phylogenetic affiliations of species currently kept in the genus.
Presence of cystidia has hitherto not been known in the genus, but recently
Ryvarden (2000) described Ceriporiopsis obscurus Ryvarden based on specimens
from Africa where thin-walled and smooth cystidia were present in the hymenium.
Otherwise the species was characterized by a deep reddish colour, thin-walled and
angular pores 4.5 per mm and ellipsoid basidiospores 4.5-5 x 2.5-3.5 um and without
reaction in Melzer’s reagent.
The mycota of the neotropics is still not well known and recently a Brazilian
straw-coloured resupinate polypore came to us for identification. A microscopical
examination revealed it to be a Ceriporiopsis species in having the general characters
outlined above. However, cystidia were present in the hymenium making it the
second species in the genus with this character. The Brazilian collection, in contrast
to C. obscurus, has a whitish basidiocarp, longer basidiospores and larger pores, even
if the type of cystidia in both species were rather similar.
286
A key to the known neotropical species of the genus gave no clue to its
identity, neither did other mycotas such as Gilbertson & Ryvarden (1986-87),
Ryvarden & Gilbertson (1993-94), Nufiez & Ryvarden (2000), Ryvarden & Johansen
(1980). Apparently the species does not have a name and its is described below. A
key to Ceriporiopsis in the neotropics with the new species is provided.
MATERIAL AND METHODS
Basidiomata were studied according to the methodology of Loguercio-Leite & Wright
(1991). Colours are according to Munsell (1975) and herbaria abbreviations listed by
Holmgren et al. (1990).
5 um
Fig. 1. Ceriporiopsis cystidiata, A) hymenium and cystidia, B) basidiospores. From
the holotype.
Ceriporiopsis cystidiata Loguercio-Leite, G. V. de C. Gonc., Ryvarden nova sp. Fig 1
Basidiocarpus annuus, resupinatus, niveus vel cremeus; poris angularis vel elongatus,
2-3 per mm, tubulis concoloribus mm; contextus tenuis, concoloribus; systema
hypharum monomiticum, hyphis fibulati, hyalinis, tenui-tunicatis vel crassi-tunicatis,
2-3 um; cyistidia laeves, tenutuincatae 10-15 x 4-8 um; basidiosporis cylindricis,
hyalinis, levibus, tenui-tunicatis, 5-6 (7) x 2.5-3.5 um, inamyloideis.
Holotypus: Brasilia Insula Santa Catarina, Saco Grande (UCAD), leg. G. Gongalves
1089, 30 IX 1997 in Herb. FLOR no 11894, conservatus est; isotypus in O .
Basidiocarps annual, resupinate, fragile, margin whitish to pale tan when dry, pale
brown (7.5YR 5/8), narrow, pore surface yellow (1OYR 8/8, 7/6, 7/8) when dry,
pores angular, with thin, entire dissepiments, 2-3 per mm; tubes concolorous with the
pore surface, subiculum whitish, almost absent.
287
Hyphal system monomitic; subicular generative hyphae hyaline, thin- to slightly
thick-walled, often branched, with abundant clamps, 2-3 um in diam.
Cystidia present in the hymenium, smooth, clavate to slightly irregular, rounded or
with a papillae 10-15 x 4-8 um, occasionally with a few apical crystals.
Basidia clavate 4-sterigmate, 15-18 x 4-5, with a basal clamp.
Basidiospores cylindric, hyaline, smooth, distinctly apiculate, negative in Melzer's
reagent, 5-6 (7) x 2.5-3.5 pm.
Substrata. Unknown hardwood tree.
Distribution. Known only from the type locality.
Remarks. The species is the only one it the genus from the American continent with
smooth hymenial cystidia, thus it should be easy to recognize microscopically. As to
basidiospores and pores, it reminds one of C. resinascens (Romell) Domanski of
Europe (see Ryvarden & Gilbertson 1993:201), a non-cystidiate species with
brownish basidiocarps because of resinous material. C. gilvescens (Bres.) Domanski,
the type species, has smaller pores and spores, 4-5 per mm and 3.5-4.5 x 1.5-2 um
respectively.
KEY TO NEOTROPICAL SPECIES OF CERIPORIOPSIS
LRRotes OLS pen muy eee ae ees eer cera ahd Metcene sre CORTE cco MOM OA ce ARR LAL 2
PR POTES ATO Ae cccer consis tesco UGE MS RE Cee a eee In cake sa RIMORD, SeeS DN de sisee cess: 3
2: Basidiospores allantoidsS:5=5:x 1-102 puri Eee courant een tad. Mecaanns C. loweii
Pe ASiKUOSPOICS CLIINSOIG, 3-20 X COUT test etre este iemeds eeu ciucees ss cet: C. flavilutea
Si basidiospores 6-10 im Lon wot gee, ec cme eeerca.). pee cearee eyes tee te erat ance C. cermusata
BSSSASIMOSDOTES SONIC ws Met a sets meee ret ener ree Nec hu atts gat cn ss Nee deeoseaiveteades 4
4. Pores irregular, up to 3 per mm becoming daedaleoid to sinuousS.................eeeeee 5
AAROLES MTICLEMLUCSS ATI UAL LO TOU tien nies oe sncoey neue ato uet yn boeteurtes deme trss ccbioncs seed 6
5. Basidiospores 3-4 um long, pores irpicoid to daedaleoid,
NORE eer URL EA Ray iaies sey a aces sat CE tt hy ip eran Mary be Men OL ERS Se C. latemarginata
5. Basidiospores 4-5 um long, pores round to angular, in parts split,
SESS ore OF OTE ae Apa aat dt tL See leh oo ae ad as Lee ae Oh Rise Lo A C. balaenae
De ASCO iS NON ESE SLIDE LIS Mere ear b ng dont tens 1a stead meeetr aio ett Sita seat nasa oat obs ‘
G2 asiulOspOLes ce LLIPSOId TO CV ANCIaG al poets ees tey cae ceacee aves ei ee crea ata teen tanoer ot enone ess 8
J, SSASUUIOSPOTES 259-3 OK C= Lio MINI Gy, Nuevos ter tetlereeculadch lov vdceh tock ceenOue ned betel C. mucida
T sRRASIMIOSPOTCS, 5-0 K Ae ALITA ee, Me ee eee rece obe Lod a cccent Seteteasat ey peceenOre C. rivulosus.
8. Smooth cystidia present, basidiospores cylindric,
me BO Deo TEE ff LE env eg ape AU A ASE ANS ER RAE an ape en RE Se lon Bale C. cystidiata
8. Cystidia absent, basidiospores ellipsoid, 3.5-4.5 X 2.5-3 UM ...... eee eeeeeeeeeeeeeeeeeeee 9
9. Basidiospores slightly amyloid, pore surface white .............ceeeeeseeeeeeeee C. myceliosa
9. Basidiospores non-amyloid, pore surface pale brown .............-.:e0eee C. umbrinescens
288
ACKNOWLEDGEMENTS
Professor K. Hgiland, University of Oslo, has kindly acted a presubmission reviewer,
and his help is acknowledged.
LITERATURE
Domaniski, S. 1963: Two new genera of fungi belonging to the group "Poria Pers. ex
S. F. Gray". Acta Soc. Bot. Pol. 32:731-739.
Gilbertson, & Ryvarden, L. 1993-94: North American polypores, Fungiflora, Oslo,
Norway.
Holmgren, P.K., Holmgren, N.H. & Barnett, L. C. 1990. Index Herbariorum. Pt. 1.
The Herbaria of the World. International Association for Plant Taxonomy,
New York Botanical Garden, NY. 693p.
Loguercio-Leite, C. & Wright, J.E. 1991.New South American polypores
(Polyporaceae) from Santa Catarina Island, SC, Brazil. Mycotaxon, 41(1):
167-172.
Munsell, L. 1975. Munsell Soil Color Charts. U. S. Dep. Agric. Handlb. 18 — Soil
Survey Chart.
Nijiez, M. & Ryvarden, L. 2000: North East Asian polypores, vol 1. Synopsis Fung.
13:1-168.
Rajchenberg, M. 1987. Type studies of Polyporaceae (Aphyllophorales) described by
J. Rick. Nord. J. Bot. 7: 553-568.
Ryvarden, L. 2000. African polypores, a critical checklist. Micologia 2000: 465-478.
Ryvarden, L. & Gilbertson, R. L. 1993-94: European polypores, Synopsis Fung. 6-
7:1-763.
Ryvarden, L.& Johansen, I. 1980. A preliminary polypore flora of East Africa.
Fungiflora, Oslo, Norway.
MYCOTAXON
Volume LXXIX, pp. 289-306 July-September 2001
NEW SPECIES OF AMANITA FROM THE DOMINICAN
REPUBLICA, GREATER ANTILLES
ORSON K. MILLER, JR.
Dept of Biology, Virginia Polytechnic Institute
and State University, Blacksburg, VA 24061
E-mail: Orsonk@cs.com
D. JEAN LODGE’
Center for Forest Mycology Research, U.S.D.A. Forest Service,
P.O. Box 1377, Luquillo, PR 00773-1377, USA
E-mail: djlodge@coqui.net
ASTRACT
Three new species of Amanita are described from the Dominican
Republic on the island of Hispaniola. One of the new species is in
subgenus Lepidella section Amidella and two are in subgenus Amanita.
One of the latter two species is in section Amanita, but the other cannot
be placed below subgenus.
Key words: Pinus, Hispaniola.
"The Forest Products Laboratory in Madison is maintained in cooperation
with the University of Wisconsin, while the lab in Puerto Rico is maintained
in cooperation with the USDA-Forest Service International Institute of
Tropical Forestry. This article was written and prepared by a U.S.
Government employee on official time, and the information is therefore in
the public domain and not subject to copyright.
290
INTRODUCTION
The Island of Hispaniola, including the Dominican Republic, has a single
native pine Pinus occidentalis Swartz which grows in extensive areas
from about 850 to nearly 2500 m elev. which 1s the easternmost extent of
native pine in the Caribbean. It is either scattered or in nearly pure stands.
It has been planted in a few areas, but not extensively. Extensive natural
populations of P. occidentalis occur on over 335,000 hectares throughout
the mountains of Hispaniola (Darrow & Zanoni, 1993). It is a unique
situation in that it is the only ectomycorrhizal conifer species throughout
its range in the Dominican Republic with only very restricted additional
distributions in Cuba. The new species reported in this paper have all
been under or near Pinus occidentalis and are putatively ectomycorthizal
with it.
MATERIALS AND METHODS
Color comparisons made using Kornerup and Wanscher (1967) are
designated Met. (e.g., Met 6E-4 indicates the plate, row, and color block).
In some cases, pileus colors were recorded using Cailleux (1948) and are
noted as Caill. (e.g., Caill. T73 indicates row T, color block 73). A few
others were recorded as Ridgway (1912) color names as reproduced by
Smithe (1975) and are given in capitalized form, e.g. (Drab Gray) and
accompanied by Munsel color notations in parentheses (e.g., 0.1Y
6.8/2.1). Collection numbers preceeded by CFMR DR- refer to a unique
number in the database for the Basidiomycetes of the Greater Antilles
project; ledger numbers are also presented, if assigned. Chemical reagents
including Melzer’s solution, Gum-guaiac, 2% Phenol, and Ferric sulphate
were used for spot testing tissue samples when appropriate. Drawings
were made from mounts in 3% KOH or Melzers solution. Smell and taste
were recorded when possible from fresh material. The E value is the
length divided by the width of the basidiospore and the E,, value is the
mean of E of N = 31 spores unless otherwise stated. For color images of
several of the taxa described here see:
http://www.cortland.edu/NSF/ga. html.
TAXONOMY
Amanita occidentalis O.K. Mill. & Lodge sp. nov. Figs. 1-3,10-
12515;
Pileus 45-65 mm latus, late convexus, siccus, pallide alutaceus in
superficie reliquiis volvae universalis in maculis conspicuis albis vel
sordide et pallide brunneolis ornatus, in margine obscure
striatus. Lamellae fere liberae, modice latae, obscure albae, lamellulis
sparsis, curtis. Stipes 48-100 mm longus, supra volvam (4-) 8-25
mm latus, in superifice fibrillis elevatis primo brunneolis aetate
albescentibus ornatus; volva saccata, alba aetate colore brunneo tincta.
Contextus mollis, in pileo atque stipite superiore albus, in parte inferiore
colore bruneo tinctus, in centro infirmus. Odor gratus sed non
distinctus.
Pileipellis mixocutem formans, hyphis filamentosis 2.4—4.5 um diam.,
in superficie intertextis vel fere rectis, tenuitunicatis, simplici-septatis, in
3% KOH atque solutione Melzeri hyalinis vel luteolis reagentibus
praedita. Pileitrama e hyphis tenuitunicatis, hyalinis, filamentosis atque
cellulis interspersis, 2.7-44.0 um diam., inflatis, tenuitunicatis
composita. Trama lamellaris e hyphis divergentibus, tenuitunicatis,
filamentosis atque cellulis 2.7-44.0 um diam., subvesicularibus vel
inflatis composita. Basidia 44-53 x 9.8 - 11.7 um diam., longe clavata,
tenuitunicata, hyalina, 4-spora. Basidiosporae (9-)10-14 x 5.5-9.0 um
(Em = 1.68:E = 1.47-2.03) late ellipticae, tenuitunicatae, in solutione
Melzeri amyloideae. Holotypus sub Pinus occidentalis Republica
Dominicana, La Vega Prov., Valle Nueva, 2200 m elev., O.K. &
H.H. Miller & D. J. Lodge, OKM 27082 lectus.
Pileus 45-65 mm broad, broadly convex, moist, brownish orange,
Tawny (5.0 YR 5.0/7.0) at the disc to Raw Sienna (7.5 YR 5.5/9.0)
fading to pale orange with pinkish tint, Pale Pinkish Buff over the
margin, light tan ground color with conspicuous white to sordid light
orange brownish (Tawny Olive. 1.0 Y 5.2/4.5); patches of universal
veil scattered over the surface; margin with short obscure striations.
Lamellae nearly free, medium broad, dull white with scattered short
lamellulae. Stipe 48-100 mm long, (4—)8-25 mm wide above the volva,
292
dail
Figures 1-3, Amanita occidentalis. Fig. 1. Cheilocystidia. Fig. 2.
Basidia. Fig. 3. Basidiospores. Bar = 10 wm
enlarging to a clavate base, with raised brownish surface fibrils which are
nearly white in age. Annulus superior, friable, disappearing with age.
Volva saccate, white, tinted orange-brown in age. Context soft, white in
cap and upper stipe, tinted brown below with a soft enteria Odor pleasant
but not distinctive.
Pileipellis an ixomixocutis with filamentous hyphae 2.4-4.5 2m diam
interwoven to nearly erect at the surface, thin-walled, simple septate,
hyaline to yellowish in 3% KOH and Melzers solution. Pileitrama a
combination of thin-walled, hyaline, filamentous hyphae interspersed
with large inflated thin-walled cells 2.7-43.0 4m diam. Lamellar trama
divergent, a combination of thin-walled filamentous hyphae and swollen
ee ee ee Ee
— Ee
295
to inflated cells 2.7-44.0 um diam. Subhymenium a textura intricata of
cells 7-13 x 5-8.5 4m diam, thin-walled, hyaline and several cells thick.
Universal veil in cross section reveals interwoven hyphae 4.2-15 ,m
diam, dense on the inner face with infrequent ovoid to swollen cells (up to
106 x 33 ym) toward the middle, thin-walled, simple septate, hyaline in
3% KOH. Cheilocystidia 25-27 x 17-22 um, ovoid to globose, thin-
walled, hyaline usually in a single layer. Basidia 44-53 x 8.0-11.7 um
diam long clavate, thin-walled, hyaline, 4-spored. Basidiospores
(9-)10-14 x 5.5-9.0 wm (Em = 1.68:E = 1.47-2.03), broadly elliptical,
thin-walled, hyaline in 3% KOH and dark blue (amyloid) in Melzers
solution.
Habit, habitat and distribution. On ground under pure Pinus
occidentalis stand near the Fundacion Moscoso Puello cabin at Valle
Nuevo, 2200 m elev. Fruiting from November to January.
Material examined. Dominican Republic: La Vega Prov., Valle Nuevo,
21 Nov. 1997, 2200 m asl, coll. D.J. Lodge and O.K. and H.H. Miller
OKM 27082 (HOLOTYPE) (CFMR DR-1250,JBSD 88204;); 30 July
1996, coll. D.J. Lodge CFMR DR-104 (CFMR; JBSD 88205).
Observations. The faint striations on the margin were not plicate-striate
and were often incomplete. The volval coloration was difficult to judge on
the old specimens, but it was orange-brown (apricot color) in DR-104,
which was young material. In addition, the annular zone noted on the
young specimens of DR-104 was not present in older specimens. A
comparison of the volval tissue (Fig. 10), the spore shape and size, and
the thick saccate volva (Fig. 15) leaves no doubt that both collections
represent the same species in two different stages of maturity. Both
fruitings occurred in the same area on the forested road mentioned above
in January and again in November.
In the North American literature, this taxon would be in Section Amidella
according to Jenkins (1986), and Subsection Amidellae (Gilb.) Drehmedl,
Vilgalys & Moncalvo according to Dremel et al. (1999). Species in
Amidella are characterized by a combination of friable volval remains on
the pileus, lack of strong striations on the cap margin, broadly elliptical
amyloid spores, and a saccate volva. The only species which seems close
294
to A: occidentalis is A. volvata (Pk.)Lloyd but the spores of that species
are smaller and narrower (8.6-10.2 x 5.5-7 ,2m with an E,, = 1.48) than in
our taxon which is mostly 10-14 x 5.5-9.0 zm with an E, = 1.68.
Amanita circinata O.K. Mill. & Lodge sp. nov. Figs.4-5,11-12,16
Pileus 40-82 mm latus, convexus, ad marginem involutus, siccus,
impolitus, subsericeus, rutilascens vel pallide aurantiacus vel carneus,
verrucis bubalinis vel flavis pyramidalibus ornatus. Lamellae liberae,
ageregatae, albae, lamellulis uniformibus praeditae, aequimarginatae.
Stipes 55-95 x 12-22 mm, siccus, albus, ad basem bulbosus annulis
concentricis pallide bubalescentibus vel ochraciusculis ornatus; annulus
didymus, superior fibrosus, inferior membranaceus. FPileipellis ex
hyphis laxe intertextis, filamentosis, tenuitunicatis 2.5-7.6 um diam., in
solutione 3 % KOH hyalinis, in solutione Melzeri luteolis reagentibus
composita. Pileitrama e hyphis intertectis usque 18 1m diam. atque
cellulis turgidis, irregularibus vel ovoideis in solutione KOH hyalinis, in
Melzeri aurantiaci-brunneis reagentibus composita. Lamellae e hyphis
divergentibus hyphis tramae similibus compositae. Volva universalis ex
cellulis globosis vel plerumque ovoideis, tenuitunicatis (18-)22-55 x
(10-)15-30 um atque hyphis sparsis, filamentosis 2.5-7 um diam
immixtis composita. Volva (9—)12-27 x (5.5-)7-13 «um diam, partialis e
cellulis ovoideis, fusiformibus vel irregulariter turgidis atque hyphis
aequinumerosis, filamentosis 3-8 um diam composita. Basidia 35-46 x
8-10.5 pm, clavata, tenuitunicata, 4-spora, hyalina. Basidiosporae
7.5-11.5 x 6.5-8.5 pm (Em = 1.32: E=1.15-1.46) brevi-ellipticae vel
subglobosae, tenuitunicatae, in solutione KOH atque Melzeri hyalinae
reagentes.
Holotypus sub Pino occidental, Las Placetas, Santiago Prov., Republica
Dominicana, 28 Jan. 1998, coll. D. J. Lodge, G. Dobler, M.
Castellano, J. Trappe, J.G. Torres & R. Ferreras, Leg. Lodge DJL43,
CFMR DR-587 lectus.
Pileus 40-82 mm broad, convex with enrolled margin, pale Burnt
Orange, Orange-Rufus (2.5 R 5.0/10.0) to Flesh Ochre (2.5 YR
295
sie
ae
SOA
Figures 4-5. Amanita circinata. Fig. 4. One and four spored basidia
and basidioles. Fig. 5. Basidiospores. Bar = 10 um
6.6/8.0) with Buff-Yellow (2.5 Y 8.0/7.0) pyramidal warts, dry, dull and
slightly silky. Lamellae free, white, 2 per mm; one length of lamellulae;
edges even. Stipe 55-95 x 12-22 mm, white above ring, slightly felty.
Annulus double, inferior, upper veil fibrous, white; lower veil
membranous, white with a yellow margin. Volval elements over base as
five to six Light Drab concentric rings on Drab Gray ground above; base
clavate to sub-bulbous, slightly cleft, white. Odor not distinctive.
Pileipellis of loosely interwoven, filamentous, thin-walled hyphae
296
2.5-7.6 zm diam, hyaline in 3% KOH light yellow in Melzers solution.
Pileitrama hyphae similar but larger, up to 18 zm diam, some swollen,
irregular to ovoid cells, hyaline in KOH, orange-brown in Melzers
solution (many hyaline cells but some pigment in cells and cell walls).
Lamellae of divergent hyphae, similar to trama. Universal veil a
combination of 50% globose to mostly ovoid thin-walled cells 9-24 x
7-14 um intermixed with 50% filamentous hyphae 1.5-4 «zm diam.
Annulus a combination of ovoid, fusiform, to irregular swollen cells (9-)
12-27 x (5.5-)7-13 «um diam. and an even number of filamentous
hyphae 1.5-4.5 um diam. Basidia 35-38 x 10 um clavate, thin-walled,
4-spored, hyaline. Basidiospores 7.5-11.5 x 6.5-8.5 um (Em = 1.32:
E=1,15-1.46), subglobose, rarely globose, thin-walled, hyaline in
Melzers solution and 3% KOH.
Habit, habitat, and distribution. Single or several on the ground under
Pinus occidentalis, fruiting in January.
Material examined. Dominican Republic, La Vega Prov., above
Manabao, Jose Cruz's farm, 19° 4' 46" lat., 70° 48' 11" long., 29 Jan.
1998; coll. D.J. Lodge, G. Dobler, M. Castellano, & J. Trappe, Leg.
Lodge DJL-59, CFMR DR-603 (CFMR; JBSD 88663) (HOLOTYPE);
Santiago Prov., Las Placetas, 1100 m elev., 19° 13'27" lat., 70° 53' 27"
long., 28 Jan. 1998, coll. D.J. Lodge, G. Dobler, M. Castellano, J. Trappe,
DR-603. Santiago Prov., La Placeta, Jan. 28, 1998, D. J. Lodge, G..
Dobler, M. Castellano. & J. Trappe, J.G. Torres & R. Ferreras, Leg.
Lodge DJL-43, CFMR DR-587 (CFMR; JBSD 88204).
Observations. The persistent pyramidal warts on the pileus and 5-6
persistent rings over the clavate bulb (Fig. 16) make this taxon instantly
recognizable when fresh or dried. The similar basal rings in Amanita
muscaria are only 2 to 3 on the upper bulb. The non amyloid spores
place it in the Subgenus Amanita section Amanita. A survey of the
literature does not reveal a similar taxon in papers by Jenkins (1986),
Pelger (1983, 1977), nor in Tulloss, Ovrebo, & Halling, (1992) or the
various papers of Tulloss.
297
Amanita cruzii O.K. Mill. & Lodge sp. nov. Figs. 6-9, 13-14, 17-18.
Pileus (30-)40-80 mm latus, conicus, convexus vel late convexus,
siccus, in statu juvenili volva universali alba, tenui, exteriore praeditus,
primo in tota superficie verrucis densis, albis, pyramidalibus in locis
non profunde depressis dispositis ornatus, cito abrasus volvam
interiorem, pulveraceam, ferrugineam (Met 6 C-D 7 usque Met 7
D6-7) superficiem totam cooperientem aperiens; color pilei pallide
aurantiacus, ad marginem primo reliquiis sparsis volvae partialis.
Lamellae \iberae, modice latae, subdistantes, ad marginem minute
fimbriatae, albae. Stipes 55-90 mm longus 4-13 (-20) mm latus, albus,
bulbum basalem versus expansus 17-28 mm latus, supra bulbum annulis
texturae elevatae atque in superficie reliquiis volvae universalis
ferrugineis, pulveraceis praeditus. Volva partialis in apice stipitis
evanescens, cito delapsa, in superficie inferiore ferruginea, pulveracea,
in superiore alba, lamellis striatis praedita. Contextus firmus, albus, in
dimidio inferiore stipitis in centro medullosus. Odor non distinctus vel
leniter raphani vel Solani tuberosi L.
Pileipellis trichodermium e cellulis terminalibus, clavatis, capitatis,
globosis vel irregularibus, 21-52 x 7-21 um latis compositum formans,
e subcute intertexta, filamentosa, tenuitunicata e hyphis hyalinis 3-6 pm
diam composita exorientem. Trama lamellaris e hyphis divergentibus
3.4-11 wm diam, tenuitunicatis, hyalinis composita.Volva universalis
tenuis. Volva exterior alba, verrucis pyramidalibus e cellulis ovoideis,
ellipticis vel pyriformibus compositis ornata, hyphis_ sparsis,
tenuitunicatis, filamentosis, 4-6.5 um diam. praedita. Volva interior
stratum ulveraceum, brunneum e cellulis ovoideis vel horizontaliter
bicapitatis 19-49 x 10-26 um diam atque hyphis filamentosis, hyalinis
1.7-4.0 4m compositum formans. Volva partialis e cellulis ovalis,
ellipticis vel globosis, saepe horizontaliter bicapitatis, tenuitunicatis
19-49 x 10-26 um diam atque hyphis filamentosis, tenuitunicatis,
hyalinis 2-3.5 um diam immixtis composita. Cheilocystidia 15-31 x
7.5-20 um, pyriformia, clavata vel globosa, tenuitunicata, in3% KOH
hyalina reagentia. Basidia 43-45 x 10-12 wm diam, clavata, 4-spora.
Basidiosporae 7-9 x 6-7 wm (Em = 1.26; E = 1.02-1.50) subglobosae
vel late ellipticae, hyalinae, tenuitunicatae, in solutione Melzeri non
298
amyloideae. Fibullae nullae
Holotypus in Re publica Dominicana, Santiago Prov., San Jose del
Les Matas, La Celestina Project, Nov. 24, 1999, O.K. & H. Miller OKM
27706 lectus.
Pileus (30-) 40-80 mm broad, convex to broadly convex, dry; universal
veil duplex, buttons have a thin, membranous, white outer layer with
pyramidal white warts which are centered within shallow depressions,
and are dense over the disc, soon sloughing off to reveal a powdery, rusty
brown (Met 6 C-D 7 to Met 7D 6-7) inner veil which completely covers
most surfaces; in age both veils give way to a smooth light orange (Met
6A2) ground color; in some specimens raised white squamules remain
over the disc; margin at first with scant remains of the partial veil.
Lamellae free, moderately broad, subdistant, white; with two lengths of
lamellulae; margin minutely fimbriate. Stipe 55-90 mm long, 4-13 (-20)
mm wide, expanding toward the basal bulb; basal bulb 17-28 mm wide,
white with rings of raised volval tissue above the bulb, with even to
patchy rusty brown powdery surface remnants of the inner universal veil.
Partial veil duplex, located at stipe apex, evanescent, falls away or is
appendiculate for a while; lower layer is composed of inner universal veil
material, rusty brown and powdery as on the pileus surface, attached just
at the apex; upper layer white, with lamellar striations, lacking powdery
material. Context firm and white throughout except for the lower half of
the stipe which is white and pithy in center. Odor indistinct, faint,
resembling raddish or potato.
Pileipellus a loose trichodermium of clavate, capitate, globose to
irregular terminal cell 21-52 x 7-21 «um, which arise from an interwoven,
filamentous, thin-walled subcutis of hyaline hyphae 3-6 um diam.
Pileitrama of loosely interwoven hyphae 3.4-10 (—24) «zm diam, thin-
walled and hyaline. Lamellar trama of divergent hyphae 3.4-11,2m diam,
thin-walled, hyaline. Clamp connections lacking in all tissue.
299
Figures 6-9. Amanita cruzii. Fig. 6. Cheilocystidia. Fig. 7. Trichodermual
cells of the pileipellis. Fig. 8. Basidia. Fig. 9. Basidiospores. Bar = 10 pm.
Universal veil duplex, thin, white outer veil with pyramidal warts, ovoid,
elliptic to pear shaped cells 16-68 x 13-33 wm (Em = 1.58: E=
1.06-3.47) thin-walled, hyaline with scattered thin-walled, filamentous
hyphae; inner veil a powdery brown layer of ovoid, rarely globose to
dumbbell shaped, cells 19-49 x 10-26 um diam [{E,, = 1.76: E= 1.0-3.1]
intermixed with about 20% filamentous hyaline hyphae 1.7-4.0 m in
300
diam. Partial veil of oval, elliptical to globose, often dumbbell shaped,
thin-walled cells 19-49 x 10-26 um diam [E, = 1.76: 1.0-3.1]
intermixed with 45% filamentous, thin-walled, hyaline hyphae 2-3.5 zm
diam, branched and simple septate in 3% KOH. Cheilocystidia 15-31 x
7.5-20 um wide, pyriforme, clavate, to globose, thin-walled, hyaline in
3% KOH. Basidia 43-45 x 10-12 um, clavate, 4-spored, thin-walled,
hyaline in 3% KOH. Basidiospores 7-9 x 6-7.5 um (Em 1.26; E =
1.02-1.50) subglobose to broadly ellipsoid, hyaline, thin-walled, non-
amyloid in Melzer's solution and hyaline to light yellow with a large
central yellow oil body in 3% KOH.
Habit, habitat and distribution: single or several fruiting bodies under
Pinus occidentais, in mixed woods or plantations, La Vega and Santiago
Provences, Dominican Republic. Fruiting from November to January.
Material examined: Dominican Republic: Cordillera Central, La Vega
Prov., above Manabao, Jose Cruz's farm, 19° 4' 46" lat., 70° 48' 11" long.,
14 Jan 1997, H. Miller & D.J. Lodge, OKM 26806 (VTMH 3920;
JBSD). Santiago Prov., 24 Nov. 1999, Parque Bermudez, Anton Sape
Bueno entrance, 19° 12' 7.4" lat., 70° 59' 0" long., 950 m elev., J.G.
Torrez & T.J. Baroni, OKM 27695; La Celestina, Community Forest, 25
Nov. 1999, O.K. & H. Miller, OKM 27706 (HOLOTYPE)(CFMR-
1411;JBSD); T.J. Baroni 35, TJB- 8998 (JBSD 94018; NY); D.J. at
O.K. & H. Miller, OKM 27710 (CFMR-1413; JBSD).
Observations: All developmental stages have been studied and the
distinctive duplex universal veil composed of a thin white outer veil with
pyramidal warts together with a powdery cinnamon to rusty brown inner
veil (Figs. 17 & 18), and the inamyloid spores are a unique combination of
characteristics not seen in any other Amanita. In addition, each wart is
centered in a shallow depression (Fig. 18) creating a scalloped pattern
over the surface of the buttons. Remains of the powdery universal veil are
often present on the surface of the lower part of the stipe (Fig. 17 on left),
and form a thick layer on the lower side of the partial veil. The range of
spore dimentions is very narrow (7-9.5 x 6-8 um; E, = 1.23:E =
1.0-1.5). This species was first discovered on the Jose Cruz plantation as
a single basidiome in 1997 (OKM 26806), and is named in his honor.
The non amyloid spores place it in the subgenus Amanita, where no
301
comparable taxon has been described. In addition, the stipe and general
stature of our taxon is more robust than other somewhat similar species
in subgenus Amanita. The cheilocystidia (Fig. 6) are located in a narrow
band on the lamellar edge, and are directly attached to hyphae of the
trama. The powdery inner universal veil remnants on the pileipellis are
the spherical to inflated cells identical to the ones illustrated in Fig. 14.
Amanita rufoferrunginea Hongo also has a powdery reddish brown
universal veil, but it differs from A. cruzii in having smaller spores (5.5-9
x 5-7.5 vs. 7-9.5 x 6-8 ~um), absence of white pyramidal warts, and the
universal veil is composed of larger filamentous hyphae and smaller
ovoid to swollen cells (11-18 vs. 10-26 zm wide). Another somewhat
similar taxon, A. aureofloccosa Bas, differs from A. cruzii in having
orange squamules on the pileus, and strongly amyloid spores that are
globose and 6.5-9.5 zm diameter (Pegler, 1977) rather than inamyloid,
subglobose to broadly ellipsoid, and 7~9 x 6-7.5 42m. None of the species
of Amanita described by Pegler (1983) in his flora of the Lesser Antilles
nor in other literature we have examined matches this new taxon.
Interwoven filamentous
Aman
S
_ Amanita occidantali
I ve js
with
.10
universa
1 largely composed of ovo
Fig
-12.
10
igures
ls
Pio EL
e. F
ta
ta circina
I
1s.
Figs
il
swollen cells and filamentous hypha
hyphae from
ig. 12.
10 pm
tissue
il
paritial ve
Universal ve
Bar =
id to swollen cells
1
Figures 13-14. Amanita cruzii. Fig. 13. White pyramidal warts of the
universal veil composed largely of ovoid to globose cells and filamentous
hyphae. Bar = 10 um.
304
Figures. 15-16. Amanita occidentalis. Button on right with thick
universal veil. Bar = 1 cm. Fig. 16. Amanita circinata. Note the
pyrimidial warts on the lower pileus. Bar = 1 em.
305
Figures 17-18. Amanita cruzii. Fig. 17. Specimen on the left exhibits
early maturity with much of the outer universal veil sloughed off leaving
the powdery inner veil. Specimen on the right is nealy mature with
remnants of the inner universal veil remaining but the superior partial veil
still in place. Bar. = 1 cm. Fig. 18. A young specimen showing the
scalloped surface and distinctive white pyramidal warts with the thin
white film in between which makes up the outer universal veil and the
powdery inner universal veil over the margin. Bar = | cm.
306
ACKNOWLEDGMENTS
The field work was funded under the US National Science Foundation’s
Biotic Surveys & Inventories Program, grant DEB-9525902 to the State
University of New York, College at Cortland, and a joint venture
agreement with the USDA-Forest Service, Forest Products Lab. We thank
our cooperators in the Dominican Republic, especially Sr. A. Ferrer of the
Fundacion Moscoso Puello; Sra. C. Cassanova, G. Dobler, J.G. Torres,
and the staff of Fundacion Plan Sierra; Ing. M. Mejia and Sra. D.
Rodrigez of the Jardin Botanico Dr. Raphael M. Moscoso of the Parques
Nacional. We wish to thank Dr. T.J. Baroni, J.G. Torres for collections
and S.A. Cantrell for logistical support. Hope Miller read the manuscript
and assisted in field work.
REFERENCES
Cailleux, A. 1948. Code des Couleurs des Sols. Boubée, France 13p.
Darrow, W. K. & T .A. Zanoni. 1993. El pino del las Hispaniola (Pinus
occidentalis Swartz) un pino subtropical poco conocido de
potencial economica. Moscovia 7: 15-37.
Drehmel, D., J.M. Moncalvo, and R. Vilgalys 1999. Molecular phylogeny
of Amanita based on large-subunit ribosomal DNA sequences:
implications for taxonomy and character evolution. Mycologia
91:610-618.
Jenkins, D. T. 1986. Amanita of North America. Mad River Press Inc.
Eureka, CA 198p.
Kornerup, A. and J. H. Wanscher 1967. Methuen Handbook of ein
Methuen & Co. Ltd. London 243 p.
Pegler, D.N. 1977. A Preliminary Agaric Flora of East Africa. Kew Bull.
Add. Ser. VI. 615p.
Pegler, D.N: 1983. Agaric flora of the Lesser Antilles. Kew Bull. Add.
Ser. 1X: 1-668.
Ridgeway, R. 1912. Standards and color nomenclature. Washington,
D.C. 44p., I-LII pl.
Smithe, F.B. 1975. Naturalist's color guide. New York: The American
Museum of Natural History. 29 p.
Tulloss, R.E., C.L. Ovrebo, R.E. Halling. 1992. Studies on Amanita
(Amanitaceae) from Andean Columbia. Memoirs of the New
York Botanical Garden V. 66, 1-46.
MYCOTAXON
Volume LXXIX, pp. 307-314 July-September 2001
Notes on discomycetes in Dongling Mountains (Beijing)
Zheng Wang’ & Ke-quan Pei
Systematic Mycology & Lichenology Laboratory
Institute of Microbiology, Academy of Sciences, Beijing, 100080, China
ABSTRACT
Investigation of discomycete diversity in the area around Dongling Mountains over the past two
years has resulted in the collection of more than 100 specimens. These belong to the following
families: Helvellaceae, Sarcoscyphaceae, Pezizaceae, Otideaceae, Sclerotiniaceae, Orbiliaceae,
Dermateaceae, Hyaloscyphaceae and Helotiaceae. Among them, Hymenoscyphus adlasiopodium
and Trichophaea donglingensis are proposed as new species. Several collections are new records
for China: Crocicreas fuscum, Hydnocystis japonica, Hymenoscyphus fructigenus, Mollisia cf.
caesia, Octospora humosa, Orbilia delicatula, Orbilia luteorubella, Peziza cf. pseudoviolacea,
Psilopezia deligata and Pulvinula militina.
Keywords: Hymenoscyphus adlasiopodium, Trichophaea donglingensis, new species.
INTRODUCTION
The Dongling Mountains are located west of Beijing on the boarder of Beijing
City District and Hebei Province. The region ranges from 800-1500m in elevation
and can reach an elevation of nearly 2100m. The climate is temperate and
precipitation is abundant between May to September. The vegetation of the
mountains is mainly composed of secondary mixed forests of Populus, Salix,
Corylus, Quercus and Juglans and plantations of Pinus, which were introduced in the
past twenty years. Work centered at the ecological research station of The Institute of
Botany, Chinese Academy of Sciences which provides good access to field sites and
good working conditions. Several expeditions to the region were organized recently
by the Systematic Mycology and Lichenology Laboratory, Academy of Sciences
(SMLL) in order to study the diversity of various groups of fungi. These were funded
by the Director's Fund from Institute of Microbiology and a major program
(39893360) of National Natural Science Foundation of China. More than 100
specimens of discomycetes were collected by the writers and their associates, and all
materials were deposited in the Herbarium of Microbiology Academia Sinica
(HMAS). Based on these collections 50 taxa are reported in this paper, including
Hymenoscyphus adlasiopodium and Trichophaea donglingensis, which are new to
* Current address: Department of Biology, Clark University, Worcester, MA 01610, U.S.A.
308
sciences. In the list that follows the name in boldface type indicate taxa not
previously reported from China (Zhuang 1998).
ASCOCORNYE CYLICHNIUM (Tul.) Korf
ASCOCORNYE SARCOIDES (Jacq.) J. W. Groves & Wilson
CHLORENCOELIA TORTA (Schwein.) J. R. Dxion
CHLOROCIBORIA AERUGINASCENS (Ny]1.) Kanouse ex Ram., Korf & Batra
CIBORIA BATSCHIANA (Zopf) N. F. Buchw.
CROCICREAS FUSCUM (W. Phillips & Harkn.) S. E. Carpenter
GEOPORA PERPROLATA B. C. Zhang
HELVELLA ALBELLA Quél.
HELVELLA ATRA Holmsk.: Fr.
HELVELLA CHINENSIS (Velen.) Nannf. & L. Holm
HELVELLA CRISPA Scop.: Fr.
HELVELLA ELASTICA Bull.: Fr.
HELVELLA LACUNOSA Afzel.: Fr.
HELVELLA PEZIZOIDES Afzel.: Fr.
HUMARIA HEMISPHAERICA (Fr.) Fuckel
HYDNOCYSTIS JAPONICA (Tak. Kobay.) Trappe
Notes: Kobayasi (1963) erected a monotypic genus Protogenea in the Tuberales
based on P. japonica Tak. Kobay. He distinguished Protogenea from Hydnocystis
because ascomata in the genus Protogenea "are epigeous, have an apical opening,
and are not tomentose." Trappe (1975) treated Protogenea as a synonym of
Hydnocystis, and suggested that the information Kobayasi gleaned from a single
collection was insufficient and that some characters had been missed by Kobayasi.
The senior writer examined isotypes of P. japonica and H. piligera Tul. & Tul. (type
species of Hydnocystis) kept in Farlow Herbarium, and also examined several
collections from China (HMAS 75844 from Beijing, Dongling Mountains, HMAS
74673 and FH-WZ2209 from western Sichuan). The specimens examined share
several key characters of ascocarps, asci and ascospores, but all the Chinese
materials fit the description Kobayasi gave for P. japonica well. The surface of the
ascomata is nearly smooth. Another important character observed by the senior
writer in the Chinese material is that the paraphyses extend far beyond the asci, and
are free rather than fused at apex as is the case in H. piligera (Trappe 1979). We do
not regard this as justification to recognize Protogenea as a distinct genus. However,
we do suggest H. japonica represents a species distinct from H. piligera.
HYMENOSCYPHUS ADLASIOPODIUM Zheng Wang sp. nov. (Fig. 1)
Ab Hymenoscypho lasiopodio apotheciis 3-4mm diam, ascis 145-155 x 9- Ilum
differt. In caulibus radici busque gramineis ignotis cariosis evolutis.
Apothecia discoid, stiptate to subsessile, 3-4mm diam; hymenium orange-
yellow; receptacle paler than hymenium; stipes up to 4mm long. Ectal excipulum of
textura prismatica to textura angularis, ca 50-85um thick, Medullary excipulum of
textura intricata, 170-500um thick. Asci 8-spored, J+, 145-155 x 9-llpum.
Ascospores fusoid, irregularly uniseriate, possible indistinctly septate, multiguttulate,
20-30 x 3.5-5.0um. Paraphyses subcylindrical, 2.5-4.0um wide.
309
Fig 2.Ascospores a) ascospores of Karschia stygia, b) ascospores of Orbilia delicatula, ¢)
ascospores in a broken ascus of Tuber taiyuanense (HMAS 75888).
310
Holotype: on rotten roots of Carex humilis Leysser, Dongling Mountains,
Beijing, Zheng Wang (0242) 18 VIII 1998, HMAS 75878.
Other specimens examined: on rotten roots of Carex humilis Leysser,
Dongling Mountains, Beijing, Zheng Wang (0261), 18 VHUI 1998, HMAS 75880; on
root (or stem base) of a grass, Baihua Mountains, Beijing, HMAS 71819, 71820,
71821.
Zhuang & Wang (1998) described this fungus in detail under the name H.
lasiopodium (Pat.) Dennis. The species and H. lasiopodium were confused because
the ascospores are similarly shaped. They noted differences in morphology and
suggested it might be influenced by environmental conditions. H. /asiopodium is
distributed in the tropics, found on wood and rarely on herbaceous stems in very wet
areas, and it has smaller apothecia (1-1.5mm) with smaller asci (110-115 x 6-8um).
The senior author has collected H. adlasiopodium many times in the area around
Beijing (temperate region), and the morphological characters, host, and distribution
are always stable. Considering the difference between this species and H.
lasiopodium, two species should be recognized.
HYMENOSCYPHUS CAUDATAS (P. Karst.) Dennis
HYMENOSCYPHUS FRUCTIGENUS (Bull.: Fr.) Gray
The materials fit well the description of Lizon (1992).
HYMENOSCYPHUS REPANDUS (W. Phillips) Dennis
The first record of this species in China is from Taiwan (Wu, Wang & Chow
1996).
JAFNEA FUSICARPA (W. R. Gerard) Korf
KARSCHIA STYGIA (Berk. & M. A. Curt.) Massee (Fig. 2 a)
Although the placement of this genus is uncertain, the author follows Dennis
(1968) and treats it as a discomycetes. Unlike the description by Teng (1963), this
collection has longitudinally striated ascospores.
LACHNUM CF. CARICIS (Desm.) Hohn.
LACHNUM NUDIPES (Fuckel) Nannf.
LEOTIA LUBRICA Fr.
MICROSTOMA FLOCCOSUM (Schwein.) Raitv.
MOLLISIA CF. CAESIA (Fuckel) Sacc.
Based on description of Mollisia caesia by Seaver (1951), the Chinese material
seems close to it on account of its large ascospores (11-17 x 2-2.5um), but the
hymenium of the Chinese material is grayish instead of bluish-gray and some
ascospores seem to be uniseptate at maturity.
MOLLISIA CINEREA (Batsch) P. Karst.
OCTOSPORA CF. HUMOSA (Fr.) Dennis
The Chinese material agrees in spore size, but the excipulum differs from O.
humosa, as described by Rifai (1968) and Caillet & Moyne (1987) in its
pseudoparenchymatous construction.
ORBILIA DELICATULA (P. Karst.) P. Karst. (Fig. 2 b)
Scanning electron microscopy has proven informative for identification of the
species. The distinct ornamentation of the ascospores can best be seen in this way
(Pfister 1997).
311
ORBILIA LUTEORUBELLA (Nyl.) P. Karst.
The morphology of the Chinese materials fit the description by Seaver (1942)
but differs in the color of the hymenium, which is bright yellow rather than pale
yellowish-red.
PEZIZA MICHELII (Boud.) Dennis
PEZIZA CF. PSEUDOVIOLACEA Donadini
The almost smooth ascospores and purplish hymenium of the material fit the
concept of the species, but compared with the description of Hohmeyer (1986), the
Chinese material has smaller ascospore (11.5-13 x 5.5-6.5um vs. 13-16 x 7-9um).
PEZIZA SP.
Apothecium solitary, irregularly discoid, 38mm diam; disc shallowly concave,
dark brown; receptacle surface smooth, beige; hymenium 220-230um thick. Asci
subcylindrical, tapering towards the base, 8-spored, with faint bluing at the apex in
Melzer's reagent, ca 230 x 15um. Ascospores hyaline, ellipsoid, 13-15 x 8-9um,
mostly uniguttulate, surface usually covered by minute warts visible in optical
section; warts usually irregular in shape, less than 0.5m wide and up to 0.2u.m high.
Paraphyses cylindrical, septate, unbranched, 4-7um diam, slightly bent at the apex
encrusted blackish-brown drops.
Specimen examined: On rotten wood with mosses, Zheng Wang (2246), 16 IX
1998, HMAS 74659.
The specimen is unique in the small ascospores with fine irregular warts, beige
nearly white receptacle, and very slight reaction in Melzer's reagent. Such a
combination of characters is unknown to the writer in the wood-inhabiting members
of Peziza.
PEZIZA SUBUMBRINA (Boud.) M. M. Moser
PSILOPEZIA DELIGATA (Peck) Seaver
Compared with the description of Seaver (1942) and Pfister (1973), the Chinese
material has smaller ascospores (23-27 x 12.5-15um vs.28-35 x 15-20um). Zhuang
(1997) published P. dabaensis and emphasized that the excipulum of her species is
quite different from that of the known species in the genus. The material from the
Dongling Mountains fits the characteristics of P. dabaensis in many respects, but
differs from the former in having an excipulum like that seen in P. deligata and in P.
nummularialis (Pfister, 1973; Pfister & Candoussau 1981). P. nummularialis has a
range of the ascospores's size of 26-29 x 12-15um, which is closer to that of Chinese
material than P. deligata is, but P. nummularialis is found only in France.
Considering the wide distribution of the species P. deligata, and the similarities of
the fungal flora between East Asia and North American, P. deligata is accepted here
for the Chinese material rather than P. nummularialis.
PULVINULA LAETERUBRA (Rehm) Pfister
PULVINULA MILITINA (Berk.) Rifai
The stalk-like (unforked) bases of the asci are the defining character of this
species. Compared with the description by Rifai (1968), the asci of Chinese material
are somewhat tapering below instead of abruptly narrowing at the base.
312
SARCOSCYPHA VASSILJEVAE Raitv.
SCUTELLINIA COLENSOI Massee ex Le Gal
SCUTELLINIA CRINITA (Bull.: Fr.) Lambotte
SCUTELLINIA KERGUELENSIS (Berk.) Kuntze
SCUTELLINIA SUBHIRTELLA Svrcek
SMARDAEA MICROSPORA J. Z. Cao, B, Liu & M. Z. Fan
SMARDAEA PROTEA W. Y. Zhuang & Korf
SOWERBYELLA FAGICOLA J. Moravec
TARZETTA CATINUS (Holmsk.: Fr.) Korf & J. K. Rogers
TRICHOPHAEA BULLATA Kanouse
TRICHOPHAEA DONGLINGENSIS Zheng Wang sp. nov. (Fig. 3)
Ab speciebus allis Trichophaeae pilis subviolaceo-roseis differt.
Apothecium discoid, solitary, sessile, 1-2.5mm diam, purplish-pink; receptacle
surfaces brown and hairy. Hairs distributed over surface of receptacle, 4 or more in a
fascicle, brown, thick-walled, septate, 40-150 x 5-10um. Ectal excipulum of textura
angularis, ca 130-150um thick, cells 12-40 x 10-20um, arranged perpendicular to the
outer surface, sometimes stacked to form small pustules, the outermost layer of
brown and thick-walled cells. Medullary excipulum of fextura intricata, ca 150-
300um thick. Asci subcylindrical, narrower towards the base, 8-spored, apex not
blued in Melzer's reagent, 262-275 x 15-18um. Ascospores uniseriate, hyaline,
ellipsoid, surface slightly pustulate to nearly smooth, uniguttulate to biguttulate, 22-
26.5 x 12-14um. Paraphyses filiform, septate, swollen at the apex, to 4-6um.
Holotype: on soil, Dongling Mountains Beijing, 1998 IX 16, Zheng Wang
(2261), HMAS 74672.
Pige3. Trichophaea donglingensis (HMAS 74672) a) apices of hairs, b) bases of hairs and cells of
ectal excipulum, c) apex of ascus and several paraphyses, d) base of ascus. scale=20um.
313
The senior author and his colleagues' attention was drawn to these apothecia
because of their purplish-pink color. Superficially they are similar to the species of
the genus Scutellinia. Purplish-pink apothecia are not previously known in the
members of Trichophaea. The biguttulate ascospores and brown, thick-walled hairs
arising from the ectal excipulum place this species in Trichophaea but the color
distinguishes it from all other taxa in that genus. Trichophaea pallidibrunnea W.-y.
Zhuang & Korf, described as new mainly because of its light-yellowish hymenium
and pale brown hairs (Zhuang & Korf 1989), may be close to this species.
TRICHOPHAEA WOOLHOPEIA (Cooke & W. Phillips) Boud.
TUBER TAIYUANENSE B. Liu (Fig.2¢) ,
Neotype designated here: In soil about 5cm deep under pines, Hua-an Wen,
Xiao-qing Zhang & Zheng Wang (0294), 20 VII 1998, HMAS 75888.
The holotype of this species was destroyed in a fire. The collection, especially
the characters of its ascospores, fits the original description (Liu 1985) very well, so
it is designated neotype of Tuber taiyuanense Liu.
ACKNOWLEDGEMENTS:
Thanks are due to Professor Donald H. Pfister and Dr. Amy Rossman for review
of the manuscript, and to Professor Jian-yun Zhuang for correction of the Latin
diagnoses. The authors extend their gratitude to the National Natural Sciences
Foundation of China for a grant (39893360) to Professor Ma Ke-ping, Institute of
Botany, Chinese Academy of Sciences, and to the Institute of Microbiology for a
grant to Wang Zheng for supporting this expedition by providing assistance,
equipment, and documentation during the course of this work. Thanks are also due to
Miss Judith Warnement of Harvard University Herbaria Library, Mrs. Zhi-hong
Zhong of the Farlow Herbarium, Mr. Cao Zi-yu of the Institute of Botany in Beijing
and Dr. Pavel Lizon of Cornell University for great help. The authors also would like
to express their deep appreciation to the other members of the field expedition,
including Xiao-qing Zhang, Jian-bin Chen and Jian-yun Zhuang for their
encouragement, support and interest in the diversity of fungi in this area, and for
making the field and herbarium work possible in several different ways. Special
thanks are also due to Mrs. Xiang-fei Zhu and Mrs. Jia-yi Xie of the Institute for
their help in preparing figures and photographs used here.
BIBLIOGRAPHY:
Caillet, M. & G. Moyne (1987) Contribution a l'étude du genre Octospora Hedw. ex S. F. Gray
(Pezizales). Espéces a spores elliptiques ou fusiformes. Bull. Soc. Mycol. Fr. 103: 179-
226.
Dennis, R. W. G. (1968) British Ascomycetes. Verlag Von J. Cramer, Lehre, pp.1-455.
Hohmeyer, H. (1986) Ein Schlussel der Europaischen Arten der Gattung Peziza L. (A key to the
European species of the genus Peziza L.) Z. Mykol. 52: 163-179.
Kobayasi, Y. (1963) On a new genus Protogenea of the Tuberales. Trans. Mycol. Japan 4: 119-
120.
Liu, B. (1985) New species and new records of hypogeous fungi from China (I). Acta Mycol. Sin.
4: 84-89.
314
Lizon, P.(1992) The genus Hymenoscyphus (Helotiales) in Slovakia, Czechoslovakia. Mycotaxon
45: 1-59.
Pfister, D. H. (1973) The psilopezioid fungi. III. Genus Psilopezia. Can. J. Bot. 60: 355-365.
Pfister, D. H. (1997) Castor, Pollux and life histories of fungi. Mycologia 89: 1-23.
Pfister, D. H. & F. Candoussau (1981) The Psilopezioid fungi. VII. A new species of Psilopezia
from France. Mycotaxon 13: 367-368.
Rifai, M. A. (1968) The Australasian Pezizales in the Herbarium of the Royal Botanic Gardens
Kew. Verh. Kon. Ned. Akad. Wetensch., Afd. Natuurk. 11 57(3): 1-295.
Seaver, F. J. (1942) North American cup-fungi (Operculates). Supplemented edition. Seaver.
New York, pp.1-377.
Seaver, F. J. (1951) North American cup-fungi (Inoperculates). Seaver. New York, pp.1-428.
Teng, S. C. (1963) Fungi of China. Science Press. Beijing. (in Chinese)
Trappe, J. M. (1975) Generic synonyms in the Tuberales. Mycotaxon 2: 109-122.
Trappe, J. M. (1979) The orders, families, and genera of hypogeous Ascomycotina (truffles and
their relatives). Mycotaxon 9: 297-340.
Wu, S. H., Y. Z. Wang & W. N. Chow (1996) Catalogue of fungal specimens and cultures of
NMNS. Natl. Mus. Nat. Sci. Taiwan.
Zhuang W. Y. (1997) Fungal flora of the Daba Mountains: Discomycetes. Mycotaxon 66: 439-
444,
Zhuang W. Y. (1998) A list of discomycetes in China. Mycotaxon 67: 365-390.
Zhuang W. Y. & R. P. Korf (1989) Some new species and new records of discomycetes in China.
III. Mycotaxon 35: 297-312.
Zhuang W. Y. & Z. Wang (1998) Some new species and new records of discomycetes in China.
VIII. Mycotaxon 66: 429-438.
MYCOTAXON
Volume LXXIX, pp. 315-318 July-September 2001
GALIELLA CELEBICA FROM INDIA
D. C. PANT
Department of Mycology and Plant Pathology
Banaras Hindu University
Varanasi — 221005, INDIA
Abstract: Galiella celebica is reported for the first time from India.
The very faint ascospore markings have been verified with SEM
photographs. General characters and dimensions of apothecia and
ascospores have been compared with earlier records.
Key Words: Discomycetes, Pezizales, Sarcoscyphineae.
Korf (1957) published a new genus Galiella Nannf. & Korf with G. rufa
(Schwein.) Nannf. & Korf as the type species along with three other
species for which new combinations were provided in Galiella.
Creation of the new genus was necessary because Le Gal (1953) had
used the generic name Sarcosoma Casp. in a sense that excluded its
holotype (S. globosum).Thus the generic name Sarcosoma became
unavailable for the fungi treated by her under that generic name.
Though criticized by Le Gal (1958) and Boedijn (1959), the name
Galiella has been accepted by most authors. Cao, Fan and Liu (1992)
accepted the cyanophilic ornamentation of ascospores as one of the
most important diagnostic generic features in Sarcoscyphineae as
suggested by Korf (1973), and recorded 4 species of Galiella from
China.
The present paper deals with a curious looking fungus collected over
20 years ago in the subtropical forest of Naugarh near Varanasi. The
fungus has been identified as G. celebica and as an excellent modern
316
description of this species is available (Le Gal 1953) only a brief
discussion along with figures of the Indian specimen are provided.
Galiella celebica (Henn.) Nannf. in Korf (Mycologia 49: 108, 1957).
Apothecia up to 5 cm. diam. thick and gelatinous (compares well with
Hennings’ size of 3-6 cm.), although Le Gal had slightly smaller, 2-3
cm. diam, apothecia. The thick medullary excipulum of textura intricata
tissue is embedded in gel. Ascospore size is also very variable.
Hennings recorded spores 23-27 x 11-13 um, while Le Gal had larger
(26.5-34.5 x 10-17.5 um) spores. The Indian collection has the spores
16.5-34.5 x 10—-17.5 um with very faint markings (which this author
failed to observe for a long time and Prof. Korf points out [pers. comm.]
that preservation in FAA, perhaps, was responsible for the poor
reactivity of the markings to cotton blue dye). The apothecia are
clothed with short hairs.
As mentioned above the nature of spore surface was in doubt for a
long time until the spores were examined under the Scanning Electron
Microscope. The SEM photographs revealed the presence of minute
tubercles on the spore surface. Only after seeing the delicate but very
clear spore markings under SEM was the author able to confirm that
the minute markings can also be discerned under the light microscope.
Specimen examined: on rotting roots of an unidentified plant, Naugarh
Forest Chandauli, (Varanasi), leg. V. P. Tewari and K. B. Khare,
August 9, 1978, BHUPP 1659, CUP-IN 658.
Although there is no published record of a Galiella species from India,
Kaushal (1982) included a Galiella taxon. sp., collected from the neigh-
bouring Himalayan Kingdom of Bhutan, in his thesis. Efforts to locate
this specimen (PAN 18409) in the Panjab University Herbarium proved
futile. However, the description provided mentions the apothecia up to
1.7 cm. diam and gelatinous, ascospores 26.5-35 x 11.4-12.2 um
minutely warted, elliptic fusoid, and hymenial hairs up to 3 um wide
and septate. The accompanying figures in the thesis (pl. IX, figs.1-3),
however, neither indicate the presence of gel in the tissue nor the
hymenial hairs. Hymenial hairs are also not known in other species of
the genus. Therefore unless the specimen can be located and re-
examined the taxonomic status of this report from Bhutan will remain
doubtful.
cy ce 4
Plate |. Galiella celebica. 1. Apothecia, x0.5; 2. Ectal excipulum, x400; 3. Ascus, x600; 4. Septate
hairs, x 250; 5. Mature ascospores, x2100; 7-8. SEM photographs of ascospores, x750 and
x3700 respectively.
318
The present paper, therefore, constitutes the first record of a Galiella
species from India.
The author is thankful to Dr. R. P. Korf, Professor Emeritus,
Department of Plant Pathology, Cornell University, U.S.A., for the
identification of the specimen and many improvements in the
manuscript. Thanks are also due to Prof. J. P. Tewari, Department of
Agricultural Food and Nutritional Science, University of Alberta,
Canada, for help in SEM photographs.
References Cited
Boedijn, K. B. 1959. Notes on the genus Sarcosoma. Persoonia
1: 7-9.
Cao, J. Z., Le Fan and Bo Liu. 1992. Notes on the genus Galella in
China. Mycologia 84: 261—263.
Kaushal, R. 1982. Studies on operculate discomycetes of Eastern
Himalayas and adjoining hills. Ph.D. Theses, Panjab
University, pp.391+13 plates.
Korf, R. P. 1957. Two bulgarioid genera: Galiella and Plectania.
Mycologia 49: 107-111.
Korf, R. P. 1973. Discomycetes and Tuberales. Pp. 249-319, In: The
Fungi. Vol. IV A. A taxonomic review with keys. Eds.
G. C. Ainsworth, F. K. Sparrow and A. S. Sussman.
Academic Press, New York and London.
Le Gal, M. 1953. Les discomycétes de Madagascar. Prodr. Flore Myc.
Madagascar 4: 1-465.
Le Gal, M. 1958. Discomycétes du Maroc. |. Un Urnula nouveau:
Urnula megalocrater Malengon et Le Gal sp. nov.
Etude de lespéce, suivie d’une révision des
characteres des genres Urnula Fr. et Sarcosoma
Casp. Bull. Soc. Mycol. France 74: 155-177.
MYCOTAXON |
Volume LXXIX, pp. 319-328 July-September 2001
THE LICHEN GENUS TOPELIOPSIS IN AUSTRALIA AND
REMARKS ON AUSTRALIAN THELOTREMATACEAE
KLAUS KALB
Lichenologisches Institut Neumarkt, Im Tal 12
D-92318 Neumarkt, Germany
Email: klaus.kalb@neumarkt.netsurf.de
Key words: Lichenized fungi, Myriotrema, Leptotrema, Reimnitzia,
Thelotrema.
Abstract: The lichen genus Topeliopsis in Australia is mono-
graphed. Four species are kept in this genus, 7’. acutispora sp.
nova, 7. corticola sp. nova, T. muscigena comb. nova and T.
vezdae sp. nova. The recently described T. muscicola, the type
species of the genus, is reduced into synonymy with T. mus-
cigena. The description for the genus is emended. - The mono-
typic genus Reimnitzia gen. nov. is described for Thelotrema
santense and its position within the Thelotremataceae is dis-
cussed. Thelotrema heterosporum is synonymized with Reim-
nitzia santensis and reported from Australia-NT for the first
time; Thelotrema nostalgicum and T. vernicosum are new addi-
tions to the Australian lichen flora, the latter also for the Mas-
carene Islands. Thelotrema vernicosum is the correct name for
TT. piluliferum. - The genus Leptotrema is synonymized with
Myriotrema.
Introduction
The lichen genus Topeliopsis Kantvilas & Vézda has been described
recently (KANTVILAS & VEZDA 2000) to accommodate species of the
family Thelotremataceae with hyaline, thin-walled, non-halonate,
highly muriform ascospores, turning reddish or purple in iodine, 1-2 (-
4) per ascus. The excellent habitus drawings by Vézda in the paper
cited above called back to mind some of our collections made in 1988
in cool temperate rainforests of New South Wales and Queensland
(Australia). But the subsequent study of these specimens revealed
some major differences (e.g. spores halonate, transversely septate or
weakly muriform, thick-walled, turning deep blue in iodine, 8 per as-
cus). Therefore we restudied the type species of the genus, Topeliopsis
muscicola Kantvilas & Vézda (Isotype, hb. Vézda), and found it with-
out any doubt to be congeneric with our specimens. Consequently, the
diagnosis presented by KANTVILAS & VEZDA (2000), must be cor-
rected as far as coloration of the ascospores in iodine and the thicken-
320
ing of their walls are concerned, and be extended regarding the septa-
tion of the ascospores and their number per ascus.
Material and methods
This study is based mainly on the collections of the author and relevant type
material housed in the herbaria mentioned. Measurements of anatomical
details were performed in water-mounted slides. The chemistry was ana-
lysed by TLC or HPTLC, using the standardized method by CULBERSON &
KRISTINSSON (1970), CULBERSON (1972) and CULBERSON & JOHNSON
(1982).
The genus Topeliopsis Kantvilas & Vézda emend.!
Thallus crustose, sometimes evanescent; photobiont Trentepohlia.
Apothecia sessile or subimmersed, subglobose to barrel-shaped,
perithecioid or sometimes becoming gyalectoid, closed at first, later
opening by a terminal pore. Excipulum in section cupular, hyaline or
slightly yellowish, externally usually with a thin thalline layer, inter-
nally with hyaline periphyses. Disc markedly and persistently urceo-
late. Paraphyses straight, simple. Asci non-amyloid, cylindrical, thin-
walled, with a markedly thickened apex when young, 1-8-spored. As-
cospores hyaline, ellipsoid or oblong, thick-walled when mature, halo-
nate, with transverse septa, submuriform or highly muriform, turning
blue or purplish blue in iodine. Conidiomata unknown. Lacking lichen
substances detectable by TLC or HPTLC.
Fig. 1 shows an ascospore of 7. muscicola and it is clearly seen that
the spore belongs to a type with thickened walls. Only fully mature
ascospores show this character distinctly enough, young or even
semimature ascospores are thin-walled, even in T. corticola (fig. 2 and
3). Similar conditions are observed in the lichen genus Letrouitia,
where in transversely septate ascospores the thickened septa are eas-
ily observed as well as in submuriform ones, but very difficult or not to
be seen in muriform spores with many cells (HAFELLNER 1981).
The species
Topeliopsis acutispora Kalb sp. nova
Thallus tenuis, 20-65 ym crassus, typice muscos emortuos incrustans,
cinereo-albidus. Apothecia adnata vel in thallo semi-immersa, 0.4-
0.7mm lata, primum clausa, subglobosa vel doliiformia, primum
perithecioidea poro terminali, demum gyalectoidea, excipulo extus
fissurato, exfoliato, albo-pruinoso, in sectione 80-140 ym crasso,
hyalino vel pallide fusco, in Iodo partialiter caerulescenti, intus sub
ostiolum periphysibus copiosis, 15-25 wm longis et 2-3 pm crassis
instructo, disco demum aperto, carneo. Hypothecium hyalinum, vel
1 This description and also the layout of the species descriptions have been
taken from KANTVILAS & VEZDA (2000) with alterations where necessary.
32
dilute testaceum, 25-30 pm crassum. Hymenium hyalinum, 140-170
pm crassum. Paraphyses simplices, rectae, 1-1.5 4m crassae, apicibus
non incrassatis. Asci (tetra- vel) octospori; ascosporae hyalinae, oblon-
go fusiformes, halonatae, 90-130 x 9-12 ym, halo 1-2 wm crassus, cum
25-35 septis transversalibus, in Iodo fortiter caerulescentes.
Type: AUSTRALIA. Queensland: Cunninghams Gap National Park,
ca. 40 km NW of Warwick, cool temperate rainforest, 750 m, 28°00’ S,
152°24’, 12. VIII. 1988, leg.: K. & A. Kalb (21901, CANB-holotype).
Thallus usually muscicolous, seldom switching from bryophytes to
mouldering bark, crustose, thin (20-65 pm thick) to almost absent,
whitish grey to greenish grey, effuse, not delimited, continuous. Apo-
thecia adnate or partly innate in the thallus, 0.4-0.7 mm broad, at
first subglobose to barrel-shaped with the excipulum completely
closed, then opening by a ragged, central, ostiole-like pore, finally
gyalectoid. Excipulum pale pink, becoming radially fissured, scurfy,
exfoliating, whitish pruinose; disc completely enclosed at first, later +
exposed, persistently urceolate, flesh coloured. Excipulum at first with
algal cells at the outer edge, 80-140 um thick, hyaline, cupular and
extending beneath the hymenium, internally I+ partly bluish; pe-
riphyses abundant at the inner edge, at the upper part 25 ym long,
becoming shorter (15 wm) downwards. Hypothecium hyaline or very
light brown, 25-30 um thick. Hymenium hyaline, 140-170 pm thick, I-;
paraphyses simple, straight to somewhat flexuose, separating easily,
1-1.5 pm thick, ends not thickened, sometimes acute. Asci cylindrical,
140-160 x 30-45 um, easily rupturing and releasing the mature asco-
spores. Ascospores (4-) 8 per ascus, hyaline, halonate, 90-130 x 9-
12 um with both ends acute, halo 1-2 ym thick, with 25-35 thick, I+
deep blue septa and lentiform lumina.
Chemistry: no substances detectable with TLC and HPTLC.
Distribution and ecology: T. acutispora is overgrowing mosses or
smooth moldering bark with a high water-holding capacity in cool
temperate rainforests in New South Wales and southern Queensland.
Additional specimens examined:
AUSTRALIA. New South Wales: Styx River State Forest, ca. 68 km E of
Armidale, cool temperate rainforest along a rivulet, 800 m, 30°34’ S, 152°
13’ E, 11. VII. 1988, leg.: K. Kalb & J. Williams (hb. Kalb 20121), growing
together with JT. vezdae; Queensland: Lamington National Park; Beech-
mont Range, Binna Burra, cool temperate rainforest with Nothofagus
moorei, 900 m, 28°13’ S, 153°11’ E, 17. VIII. 1988, leg. K. & A. Kalb (hb.
Kalb 22003).
Remarks: Actually, all four known Topeliopsis species are externally
+ identical and are not discernible without microscopic investigations.
But also the slight differences in the dimensions of internal tissues
and structures are not sufficient to distinguish the species. As fur-
thermore the ecology within the genus is very homogenous too (differ-
ent species sometimes growing side by side), all these facts are not re-
322
peated in the English descriptions. The only way to separate the spe-
cies easily is by regarding the shape, dimensions and septation of the
ascospores and their number per ascus.
Topeliopsis corticola Kalb sp. nova
Thallus tenuis, 25-75 pm crassus, typice corticola, sed etiam muscos
emortuos incrustans, cinereo-viridis. Apothecia adnata vel in thallo
semi-immersa, 0,4-0,7 mm lata, primum clausa, subglobosa vel
doliiformia, primum _ perithecioidea poro terminali, demum
gyalectoidea, excipulo extus fissurato, exfoliato, crasse albo-pruinoso,
in sectione 50-100 ym crasso, hyalino vel pallide fusco, in Iodo
partialiter caerulescenti, intus sub ostiolum periphysibus copiosis, 20-
25 um longis et 2-3 wm crassis instructo, disco demum aperto, carneo.
Hypothecium hyalinum, 15-30 wm crassum. Hymenium hyalinum,
200 wm crassum. Paraphyses simplices, rectae, 1-1,5 wm crassae,
apicibus non incrassatis. Asci (tetra- vel) octospori; ascosporae
hyalinae, ellipsoideae, rectae vel leviter arcuatae, halonatae, 50-60 x
13-18 wm, cum 12-14 septis transversalibus, et 0-4 septis
eg aE ak in Iodo fortiter caerulescentes, halo 1-2 wm crassus
AF
Type: AUSTRALIA. New South Wales: Blue Mountains National
Park; Mount Wilson, Chimney Cottage, in a moist cool temperate rain-
forest, 1000 m, 33°30’ S, 150°23’ E, leg. K. & A. Kalb (20462, CANB-
holotype).
Additional specimen examined:
AUSTRALIA. New South Wales: New England National Park; Radar Sta-
tion Site, 1.5 km NW of Point Look Out, in a Nothofagus-forest along a rivu-
let, 1500 m, 30°29’ S, 152°25’ E, 10. VIII. 1988, leg. K. Kalb & J. Williams
(21227).
This species is separated from T. muscigena by 8 ascospores per ascus,
which are much smaller (50-60 x 13-18 um in T. corticola versus 100-
200 x 24-52 um in JT. muscigena) and with fewer septa (12-14/0-4 ver-
sus 30-50/6-15).
Chemistry: no substances detectable with TLC and HPTLC.
Topeliopsis muscigena (Stizenb.) Kalb comb. nova
= Thelotrema muscigena Stizenberger, Jahresber. St. Gall. nat.wiss. Ges.
1888/89: 247 (1890). — Type: South Africa, Cape Province, supra muscos ad
arbores in Monte Tabulari, VIII. 1887, leg.: Mac Owan (ZT-holotype!, PRE-
338, PRE-340, isotypes!).
Syn: Topeliopsis muscicola Kantv. & Vézda, Lichenologist 32: 348. — Type:
Tasmania, Quamby Bluff, 41°39’S, 146°42°E, on Nothofagus cunninghamii
in rainforest, 800 m, 10. VIIL. 1985, leg.: G. Kantvilas 202/85 (HO-holotype,
Vézda-isotype!).
A comparison of the types of T. muscicola and T. muscigena show that
they are identical in every respect. The spore size in T. muscigena is
323
100-165 x 24-39 um and fits well within the range given for T. musci-
cola (106-200 x 27-52 pm).
This is the only species in the genus with monospored asci.
ae peculiar distribution pattern (Kapensis — Australis) is also known
g. from the tree fern Todea barbara (L.) T. Moore (SCHMITHUSEN
(i961) and the lichen Collema leucocarpum Hook. fil. & Tayl. (DE-
GELIUS 1974).
Topeliopsis vezdae Kalb spec. nova
Thallus tenuis, typice muscos emortuos incrustans, sed raro etiam
cortices vetustas incolens, cinereo-albidus. Apothecia adnata vel in
thallo semi-immersa, 0,5-0,8 mm lata, primum clausa, subglobosa vel
doliiformia, primum perithecioidea poro terminali, demum gyalec-
toidea, excipulo extus fissurato, exfoliato, crasse albo-pruinoso, in sec-
tione 50-100 um crasso, hyalino vel pallide fusco, in Iodo partialiter
caerulescenti, intus sub ostiolum periphysibus copiosis, 20-30 pm
longis et 2-3 um crassis instructo, disco demum aperto, carneo. Hypo-
thecium hyalinum, 15-30 wm crassum. Hymenium hyalinum, 200 pm
crassum. Paraphyses simplices, rectae, 1-1,5 wm crassae, apicibus non
incrassatis. asci tetra- vel octospori; ascosporae hyalinae, oblongo fusi-
formes, halonatae, 55-100 x 10-16 ym, halo 1-2 ym crassus, cum 14-24
septis transversalis, in Jodo fortiter caerulescentes.
Type: AUSTRALIA. Queensland: Styx River State Forest, ca. 68 km
E of Armidale, cool temperate rainforest along a rivulet, 800 m, 30°34’
S, 152°13’ E, 11. VIII. 1988, leg. K. Kalb & J. Williams (19199, CANB-
holotype).
Additional specimens examined:
AUSTRALIA. Queensland: Lamington National Park; Beechmont Range,
Binna Burra, cool temperate rainforest with Nothofagus moorei, 900 m,
23°13540, 153°11’ E, 17. VIII. 1988, leg. K. & A. Kalb (21942). New South
Wales: Blue Mountains National Park: Mount Wilson, Chimney Cottage, in
a moist cool temperate rainforest, 1000 m, 33°30’ S, 150°23’ E, 31. VII. 1988,
leg. K. & A. Kalb (20481); New England National Park; Radar Station Site,
1.5 km NW of Point Look Out, in a Nothofagus-forest along a rivulet,
1500 m, 30°29’ S, 152°25’ E, 10. VIII. 1988, leg. K. Kalb & J. Williams (hb.
Kalb 21220); Styx River State Forest, ca. 68 km E of Armidale, cool temper-
ate rainforest along a rivulet, 800 m, 30°34’ S, 152°13’ E, 11. VIII. 1988, leg.
K. Kalb & J. Williams (hb. Kalb 19200, mixed with T. acutispora).
This species differs from T. acutispora by shorter but broader asco-
spores with less septa and obtuse ends.
Chemistry: no substances detectable with TLC and HPTLC.
“
\v
Wi
a
\
I}
‘
-
i
?
T. corticola,
(holotype)
bar = 1 mm.
oh:
ig.
F
ascospore
?
type)
iso
habitus
T. vezdae
>
ascospore (
3
T. vezdae
?
a
Fig
4:
icol
Fig
is MUSC
(holotype)
Lops
= 30 ym
Topel
ascospore
bar
i
.
Fig
325
Remarks: As already indicated by KANTVILAS & VEZDA (2000), the
genus as defined by them is heterogenous. After a careful study of all
species, assigned to Topeliopsis by these authors, we can confirm this
statement and would like to leave only the type species, T. muscicola
(= T. muscigena), in the genus. The other species differ in spore type
and excipulum structure and probably belong to another undescribed
genus.
Key to the known species of Topeliopsis
1 Ascospores muriform 2
1* Ascospores transversely septate 3
2 Ascospores single in the ascus, 100-200 x 24-52 um
T. muscigena (Stiz.) Kalb
2* Ascospores eight in the ascus, 50-60 x 13-18 um T. corticola Kalb
3 Ascospores 90-130 x 8-12 pm, 25-35-septate, ends acute
T. acutispora Kalb
3* Ascospores 55-100 x 10-16 pm, 14-24-septate, ends obtuse
T. vezdae Kalb
Remarks on Australian Thelotremataceae
Reimnitzia Kalb gen. nov.
Genus novum ad familiam Thelotremataceae pertinet. Imprimis epi-
thecio concreto (= paraphysibus in partes superioris dense ramosis et
intricatis) definatur. Ab Thelotrema sensu str. excipulo libero et pe-
riphysibus instructo deficiente differt, ab Leptotrema sensu str. (= My-
riotrema) disco late aperto et margine apotheciorum recurvo differt et
ab Ocellularia sensu str. excipulo non carbonisato et columella defi-
ciente differt.
Typus generis: Reimnitzia santensis (Tuck.) Kalb comb. nov.
Bas.: Thelotrema santense Tuck., Proc. Amer. Acad. Arts and Sci. 5: 406
(1862) — Type: U.S.A. South Carolina, Santee Canal. (Woodbine Spring,
1859), on Ulmus americana, leg.: Ravenel (BM, lectotype!, selected by
SALISBURY 1971, FH-Tuck, isolectotype!).
Syn.: Leptotrema santense (Tuck.) Zahlbr., Cat. lich. univers. 2: 635 (1923). —
Thelotrema heterosporum C. Knight in Bailey, Synops. Queensl. Flora,
Suppl. 1: 72 (1886) — Type: Australia; Queensland, on mosses, C. Knight
(fide SALISBURY 1971). — Leptotrema heterosporum (C. Knight) Zahlbr., Cat.
lich. univers. 2: 635 (1923). — Leptotrema mastoideum Mill. Arg., Flora 70:
400 (1887), nom. superfl. pro T. heterosporum C. Knight.
The new genus is dedicated to our Australian friends Michael and
Christine Reimnitz who have helped us so much during all our excur-
sions in Australia, and especially in 1988 when they saved our lichen
collections by carefully drying the water saturated specimens.
The type species is unique within the Thelotremataceae and so far the
only species that can be assigned to the new genus Reimnitzia. The
main feature separating it from other Thelotremataceae is the distinct
epithecium, which is formed by densely interwoven, branched upper
parts of the paraphyses. - Reimnitzia santensis was placed in Lep-
326
totrema by ZAHLBRUCKNER (1923), but the type species of the genus
is Leptotrema zollingeri Mont. & v.d. Bosch, and a careful examination
of this species shows it to be conspecific with Myriotrema wightii (Tay-
lor) Hale. Therefore, Leptotrema Mont. & v.d. Bosch (1855) becomes a
later synonym of Myriotrema Fée (1824). - From Myriotrema sens. str.
with immersed apothecia opening by a tiny pore, Reimnitzia is sepa-
rated especially by chroodiscoid apothecia with recurved thalline
walls, but the thick walled brown ascospores are much different from
the thin walled and colourless ones in Chroodiscus (Mill. Arg.) Mill.
Arg. - From Thelotrema Ach., which is typified by T. lepadinum (Ach.)
Ach., Reimnitzia differs by the lack of a free excipulum and the lack of
distinct periphyses. - Ocellularia G. Meyer, with Thelotrema obtura-
tum Ach = Ocellularia cavata (Ach.) Mill. Arg. as type species, is
separated by a carbonized excipulum. - Molecular genetic studies may
show a closer relationship of Reimnitzia with Diploschistes Norman,
but the latter genus lacks vegetative propagules (isidia) and has a
carbonized excipulum similar to that in Ocellularia. Furthermore, the
only facultatively corticolous Diploschistes species, D. muscorum
(Scop.) R. Sant., produces several lichen substances (lecanoric and dip-
loschistesic acids), whereas there are no lichen substances present in
Reimnitzia. — Pycnidia cylindrical, immersed in the thallus or more
often in the tips of the isidia, visible only as blackish dots. Conodio-
phores of type II (VOBIS 1980), conidia formed acrogenously, bacilli-
form to bifusiform, 4-8 x 1.5-2 ym.
Fig. 5: Reimnitzia santensis, thallus with very sparse isidia and many
apothecia; Fig. 6: Reimnitzia santensis, thallus with a few apothecia
and many isidia; bar = 2 mm
B27
Reimnitzia santensis is distributed pantropically with scattered locali-
ties outside the tropics. We have seen collections from North America
(South Carolina, Florida), Central and South America (Guatemala,
Venezuela, Brazil, Paraguay), Africa (Mozambique) and Australia
(Queensland, Northern Territory). Our collection from Northern Terri-
tory: Kakadu National Park, ,Gungarre Monsoon Forest“, near South
Aligator, 75 m, 12°41’S, 132°29°E, 17. VIII. 1995, leg. K. & A. Kalb
(Kalb 30585, dupl. in CANB) is the second report for this species in
Australia and a new state report.
Additions to the Australian lichen flora
Thelotrema nostalgicum G. Salisbury
Lichenologist 5: 266 (1972). Type: Sri Lanka. Pidurutalagala, on bark, 1879,
leg.: Almquist s.n. (H-Nyl, holotype; S, isotype).
SALISBURY (1972) described his new species from Sri Lanka and
HALE (1981) reported on the unusual chemistry, fumarprotocetraric
(major) and protocetraric (minor — trace) acids. The cooccurrence of
these two substances and the large (120-215 x 20-33 um) transversely
septate, colourless ascospores with 24-34 septa make the identification
easy.
This species has not yet been reported from outside Sri Lanka. The
two collections cited below represent a large range extension and are
new reports for the Australian lichen flora.
AUSTRALIA. Queensland: Lamington National Park, near O’Reillys
guesthouse, in a subtropical rainforest 1000 m, 28°15’S, 152°05’E, 16. VIII.
1988, leg.: K. & A. Kalb (Kalb 21538); dto. McPherson Range, Duck Creek
road, in a subtropical rainforest, 900 m, 24°14’S, 153°07E, 18. VIII. 1992,
leg.: K. & A. Kalb (Kalb 25792, dupl. CANB).
Thelotrema vernicosum A. Zahlbr.
Ann. mycol. 10: 370 (1912). Type: Hawaii; Oahu, Koolau Mountains, leg::
Rock 101 (W, lectotype; FH, isolectotype, selected by HALE 1981).
Syn.: Thelotrema pachystomum Nyl. ssp. piluliferum Tuck., Proc. Amer.
Acad. Arts Sci. 7: 227 (1866). Type: Hawaii; Oahu, Waialua Mountains, leg::
Mann s.n. (FH-Tuck, lectotype; G, W, isolectotypes; selected by HALE 1981).
— Thelotrema gibbosum Magn., Ark. Bot. 31A(1): 53 (1944). Type: Hawaii;
Maui, Haelaau, 1 Aug. 1938, leg.: Selling 5836 (UPS, lectotype; S, isolecto-
type, selected by HALE 1981).
This species has been usually cited as Thelotrema piluliferum Tuck. (e.
g. ZAHLBRUCKNER 1923, HALE 1981), but TUCKERMAN (1866)
clearly described it as a subspecies of Thelotrema pachystomum Ny]l.
“It appears therefore likely, the general agreement between these
plants being undeniable that they express only conditions of the same
species” (TUCKERMAN 1966: 228). Although Thelotrema pachysto-
mum and T. pachystomum subsp. piluliferum share the same chemis-
try, psoromic acid, they differ considerably in spore septation (three-
septate versus muriform) and carbonization of the excipulum (carbon-
ized versus non-carbonized). Therefore the two lichens have to be
328
treated as two distinct species and the oldest names on this level have
to be used. TUCKERMAN (1866) reported this species from Hawaii,
and HALE (1981) published further collections from Sri Lanka and
Sabah. Its generic position is not yet clear, and the differences in the
ascocarp structures compared to T. lepadinum are summarized by
HALE (1981). Also the chemistry, psoromic acid, is not common in
Thelotrema sensu str. The collections cited below represent range ex-
tensions and are new reports for the lichen flora of Australia and the
Mascarene Islands.
AUSTRALIA. New South Wales: Styx River State forest E of Armidale;
Beech Look Out, in a cool temperate rainforest, 1350 m, 30°29’S, 152°23’E,
10. VIII. 1988, leg. K. Kalb & J. Williams (Kalb 21401, dupl. CANB). —
MASCARENE ISLANDS. Réunion: Cirque de Cilaos, trail from Thermales
to Roche Mervilleussmall e, in remnants of primary rain forest, 1400 m,
21°07’S, 55°28730”E, 20. VIII. 1991, leg. K. & A. Kalb (Kalb 25491).
Acknowledgements
We thank the curators of the herbaria mentioned, especially Dr. A. Vézda,
who has sent much material of Topeliopsis and related species on loan. Dipl.
Biol. A. Frisch has critically reviewed this paper and Dr. B. Coppins cor-
rected the English. )
Literature
CULBERSON, C. F. 1972. Improved conditions and new data for the identifi-
cation of lichen products by a standardized thin-layer chromatographic
method. — J. Chromat. 72: 113-125.
CULBERSON, C. F. & JOHNSON, A. 1982. Substitution of methyl tert.-butyl
ether for diethyl ether in the standardized thin-layer chromatographic
method for lichen products. — J. Chromat. 238: 483-487.
CULBERSON, C. F. & KRISTINSSON, H. 1970. A standardized method for the
identification of lichen products. — J. Chromat. 46: 85-93.
DEGELIUS, G. 1974. The lichen genus Collema with special reference to the
extra-European species. — Symb. Bot. Upsal. 20 (2): 1-215.
HAFELLNER, J. 1981 Monographie der Flechtengattung Letrouitia (Le-
canorales, Teloschistineae). — Nova Hedwigia 35: 645-729.
HALE, M. E. 1981. A revision of the lichen family Thelotremataceae in Sri
Lanka. — Bull. Brit. Mus. (Natural History) Bot. Ser. 8: 227-332.
KANTVILAS, G. & VEZDA, A. 2000. Studies in the lichen family Thelotre-
mataceae in Tasmania. The genus Chroodiscus and its relatives. —
Lichenologist 32: 325-357.
SALISBURY, G. 1972. Thelotrema Ach. sect. Thelotrema. 1. The T. lepadinum
group. — Lichenologist 5: 262-274.
SCHMITHUSEN, J. 1961. Allgemeine Vegetationsgeographie. W. de Gruyter
& Co., Berlin: 262 pp.
STIZENBERGER, E. 1890. Lichenaea Africana. — Jahresber. St. Gall. nat.wiss.
Ges. 1888/89: 105-248.
TUCKERMAN, E. 1862. Observations on North American and other lichenes —
Proc. Amer. Acad. Arts and Sci. 5: 383-422.
TUCKERMAN, E. 1866. Lichens. In: MANN, H. Enumeration of Hawaiian
plants. — Proc. Amer. Acad. Arts and Sci. 7: 223-234.
VoOBIS, G. 1980. Bau und Entwicklung der Flechten-Pycnidien und ihrer
Conidien. - Bibl. Lichenol. 14: 1-141.
ZAHLBRUCKNER, A. 1923. Thelotremaceae [sic!]. - Catalogus lichenum uni-
versalis 2: 580-640.
MYCOTAXON
Volume LXXIX, pp. 329-336 July-September 2001
DISCOMYCETES OF THE SARCOSCYPHACEAE IN TAIWAN
Yei-Zeng Wang
National Museum of Natural Science,
1, Kuan-Chien Rd. Taichung 404, Taiwan
ABSTRACT: Five species of the Sacoscyphaceae, Cookeina insititia, C. sinensis,
Microstoma floccosum, Phillipsia domingensis, and Sarcoscypha humberiana, collected
from Taiwan are described and illustrated. Ascospores were observed under scanning
electron microscopy. Except for P. domingensis, the ascospores of the other four species
have generally been considered as smooth, whereas the SEM studies show that they
have various delicate ornamentations. Cookeina sinensis and Phillipsia domingensis are
recorded for the first time from Taiwan.
KEYWORDS: Cookeina, Microstoma, Phillipsia, Sarcoscypha, Pezizales.
Cookeina insititia (Berk. and M.A. Curtis) Kuntze, Rev. Gen. pl. 2: 849, 1891.
Fig. 3A.
Apothecia gregarious, cupulate, disc white to pale pinkish yellow, 0.5-1.0 cm wide,
receptacle white to pale brown, stalk 0.1-2 cm high, hairs growing out from outer layer,
white, like petals surrounding margins. Ectal-excipulum two layered, outer layer of a
textura globulosa, cells 10-20 um wide, layer 20-55 ym thick, inner layer gelatinous,
with intricate hyphae 2-5 1m wide, medullary excipulum of a ¢extura intricata, layer
50-88 jm thick. Asci 8-spored, suboperculate, clavate, 410-475 x 15-20 um.
Ascospores fusoid, smooth under light microscopy, verrucose under SEM, hyaline, with
many small oil drops, 40-55 x 10-11 um. Paraphyses branched, connected like a net,
hyphae 3-5 um wide.
Colonies on CMA medium spreading slowly. Mycelium velvety, pinkish white,
reaching 4.8-5.6 cm diam. in 14 days at room temperature; conidia not seen.
Specimens examined: Taiwan. Chiayi: Alishan-Fengshan; alt. 1800 m, on rotten
wood, L.¥. Liao, Sep. 13, 1993 (TNM F1167). Kaohsiung: Maolin, on rotten wood, W.N.
Chou; 911024, Jan. 24, 1991 (TNM F1114); Liukuei, Shanping, alt. 750 m, on rotten
330
wood, S.Z. Chen, 9312206, 93122208, Dec. 22, 1993 (TNM F1452, F1454). Miaoli:
Tahu, Shuiliutung, on rotten wood, S.Z. Chen, WAN 079, Sep. 25, 1994 (TNM F2494);
Cholan, on rotten wood, C.C. Wen, WAN 621, Nov. 22, 1998 (TNM F8926);
Shihshuikeng, on rotten wood, C.C. Wen, WAN 631, Nov. 30, 1998 (TNM F8936).
Pingtung: Nanjenshan, alt. 250 m, on dead wood, C.C. Wen, WAN 349, Nov. 9, 1996
(TNM F5296); C.C. Wen, WAN 607, Aug. 7, 1998 (TNM F8915). Taitung: Orchid
Island; alt. 50 m, on dead twigs, S.Z. Chen, WAN 415; C.C. Wen, WAN 416, Apr. 23,
1997 (TNM F5693, F5694); Orchid Island, alt. 100 m, on rotten wood, J.¥ Tseng and
S.H. Wu 9704-146, Apr. 29, 1997 (TNM F7979).
This species was previously reported by Lion and Chen (1977) under the genus
Boedijnopeziza. It is very common within broadleaf forests below 1000 m in elevation
in southern Taiwan. The morphology of the apothecia is variable, the length of the stalk
may be from 0.1 to 2 cm, and the color of the receptacle varies from white to pale
brown.
Cookeina sinensis Z. Wang, Mycotaxon 62: 293, 1997.
Figs. 1, 3C, 3D.
Apothecia scattered, discoid, stipitate, disc deeply concave, pinkish orange, 1.5-4.5
cm wide, stalk 1.5-4 cm long; receptacle pale pinkish, covered with long, white to
brownish hairs composed of bundles of hyphae arising from the medullary tissue, 3-5
mm long. Ectal-excipulum of a textura globulosa to angularis, cells 10-40 um in diam.,
layer 150-175 um thick, medullary excipulum of a textura porrecta, hyphae septate,
7.5-10 um wide, hymenium layer pinkish, 500-525 jm thick, easily separated from
excipular layer. Asci 8-spored, cylindrical, 325-387 x 17.5-20 um, thick walled, 2-3 ym
thick, base contracted into a narrow short stalk. Ascospores subfusoid, pointed at both
ends, 27-37.5 x 13-15 um, with fine and irregular wrinkles barely visible under oil
immersion lens, containing two large oil drops and many small ones, pale yellow when
mature. Paraphyses threadlike, branched, and connected with each other, 2.5-4 um
wide.
Colonies on CMA medium spreading slowly. Mycelium velvety, white, reaching
6.9-8 cm diam. in 14 days at room temperatures; conidia not seen.
Specimens examined: China. Yunnan, Xishuangbanna, on twig, ¥ Li 372, Jun. 8,
1986 (holotype, HMAS 70088); Menlen, on rotten wood, M. Zang 10398, Aug. 15,
1985 (paratype HMAS 70310). Taiwan. Miaoli : Tahu, Shuiliutung, on dead wood, S.Z.
Chen, WAN 074, Sep. 4, 1994 (TNM F2490); Shitan, on rotten wood, W.N. Chou, WAN
785, July 7, 2000. Nantou: Hsitou, on rotten wood, Sep. 9 1992, C.M. Chen, (TNM
F0781). Taitung: Orchid Island, Hungtoushan, alt. 350 m, on dead twigs, S.Z. Chen and
331
_C.C. Wen, WAN 426, Apr. 24, 1997 (TNM F570); Tienchih, on rotten wood, S.Z. Chen
930, Oct. 24, 1999. Taoyuan: Changhsing, alt. 350 m, on dead twigs, CLV. Chen, WAN
697, July 14, 1999 (TNM F9857).
This species is similar to C. tricholoma in gross morphology, but the latter has
longitudinal ridges on the ascospores. The ascospores of the Chinese and Taiwanese
collections were examined under SEM and the results show that both have the same
pattern of ornamentation (Fig. 3C, D). All Taiwanese collections were found within
broadleaf forests below 1000 m in elevation. Five species of Cookeina have been
reported from China (Wang 1997), but only two species have been collected in Taiwan.
CPG D
ee!
NE ae
aan ae
DE DR,
:
é
Fig. 1. Cookeina sinensis (TNM F0781) A. an apothecium. B. paraphysis tips. C. a part
_ of the excipulum. D. ascospores. E. hair tips. F. bases of asci. G. an ascus. Bars = 1 cm
for A; 10 um for B and D; 25 um for C and E; and 24 um for F and G.
Bo2
Microstoma floccosum (Schwein.) Raitv., Eesti NSV Tead. Akad. Toim., Biol. Ser. 14:
529571965.
Fig. 3B.
Apothecia scattered to gregarious, stipitate, cupulate, disc orange red, 0.4-0.9 x
0.3-0.5 cm, receptacle paler, covered with white hairs, 125-1000 pm long, stalk 0.5-1.5
cm long, base with dark brown hyphal mat. Ectal-excipulum of a textura angularis,
cells 7.5-15 um diam., layer 25-50 um thick, medullary excipulum of textura porrecta,
hyphae regularly arranged, 5-7.5 um wide, layer 225-250 um thick, subhymenium 75-
125 um thick, hymenium 250-270 um thick. Asci 8-spored, suboperculate, clavate, 205-
311 x 12-18 um. Ascospores ellipsoid, smooth under light microscopy, verrucose under
SEM, 23-29 x 10-13 um, with many small oil drops at both ends. Paraphyses branched,
connected as a net, with many orange granules, 2-3 um wide.
Specimens examined: Taiwan. Miaoli: Kuanwu-Hsuehchieh, alt. 1900 m, on dead
twigs, C.A. Chiu, CCA 17, Sep. 2, 1995 (TNM F3684). Nantou: Hoshe, alt. 780 m, on
dead twigs, S.Z. Chen, WAN 024, May 2, 1994 (TNM F1912); YZ. Wang, WAN 278, Apr.
10, 1996 (TNM 4565); W.N. Chou, WAN 284, Apr. 25, 1996 (TNM 4571); Tungpu, on
branches of broadleaf trees, S.Z. Chen, WAN 389, Feb. 18, 1997 (TNM F5671).
This species is easily recognized by the orange, stipitate, hairy apothecia. The
brown subiculum on the substrate is a unique characteristic within this family.
Phillipsia domingensis (Berk.) Berk., J. Linn. Soc. London Bot. 18: 388, 1881.
Figs. 4, 6E.
Apothecia scattered, discoid, 0.8-2.5 cm diam., with a short stalk, disc dark red,
brown when dry, receptacle yellowish white. Excipulum with textura intricata, hyphae
2.5-3 um, light yellow, 20-50 um thick, medullary excipulum with hyphae losely
arranged; hymenium 750-875 um thick. Asci 8-spored, suboperculate, cylindrical, 350-
375 x 15-17 um. Ascospores ellipsoid, hyaline, 23-27.5 x 12.5-15 um, containing 1-2
oil drops, surface with 3-6 straight lines. Paraphyses simple, filled with reddish pigment,
tips 4-5 pm.
‘Colonies spreading rapidly on PDA medium. Mycelium initially white then turning
brownish, reaching 9.0 cm diam. on CMA within 14 days at room temperature, hyphae
2-3 um wide. Anamorph: Molliardiomyces domingensis, conidia numerous, hyaline,
ellipsoid, 8-12 x 6-7 um.
Specimens examined: Taiwan. Nantou: Tungpu, on rotten wood, S.H. Wu 9285,
Aug. 22, 1992 (TNM F0674); Wushe, Pihu, alt. 870 m, on dead wood, W.N. Chou, WAN
308, July 4, 1996 (TNM F5133). Pingtung: Nanjenshan, alt. 250 m, on dead twigs, W.N.
Chou, WAN 331, Sep. 6, 1996 (TNM F5156); on rotten wood, C.C. Wen, WAN 502, Oct.
333
8, 1997 (TNM F7686); Chufengshan, alt. 300 m, on rotten wood, C.C. Wen, WAN 496,
Sep. 18, 1997 (TNM F7681). Taitung: Orchid Island, Chungai Bridge, on rotten wood,
JY. Tseng and S.H. Wu 9704-84, Apr. 30, 1997 (TNM F7415); Hsiaotienchih, alt. 100 m,
on rotten wood, S.Z. Chen 977, Oct. 25, 1999 (TNM F10183).
This species is usually collected in forests below 1000 m in elevation in middle
and southern Taiwan. Paden (1984) reported Molliardiomyces domingensis as the
anamorph of this species. It is new to Taiwan.
Recntid
iE
Et I ES Word hoe IaH
Fig. 2. Phillipsia domingensis (INM F7681) A. an ascus. B. a part of the medullary
excipulum. C. a part of the ectal-excipulum. D. ascospores. E. an apothecium. F.
paraphyses tips. G. conidiophore and conidia. Bars = 25 um for A, B, and C; 10 pm for
D, F, G; and 1 cm for E.
334
Sarcoscypha humberiana F.A. Harr., Harvard Papers Bot. 10: 56, 1997.
Fig. 3F.
Apothecia scattered, discoid, with a short stalk, disc brightly red, 1-3 cm diam.,
stalk 0.3-1.8 cm high, receptacle white, tomentose. Ectal-excipulum of textura intricata
to prismatica, layer 50-75 jm thick, hyphae 2-3 um wide, medullary excipulum of
textura intricata, hyphae 3-5 um wide, layer 800-1000 um thick, subhymenium with
compact hyphae, containing red pigment, layer 200-250 um thick, hymenium layer 250-
300 um thick. Asci 8-spored, cylindrical, 287-416 x 9-12 tum. Ascospores ellipsoid, 19-
32 x 8.5-12 um, smooth under light microscopy, with irregular ridges under SEM,
hyaline with 2 large oil drop when fresh, then degenerating into one central guttule,
some spores truncate and concave at both ends. Paraphyses filled with red granules, tips
2-4 um wide.
Colonies on CMA medium spreading very slowly. Mycelium pinkish white,
margin smooth, reaching 2.8-2.9 cm diam. in 14 days at 20 °C, conidia not seen.
Specimens examined: Taiwan. Miaoli: Kuanwu-Hsuehchieh, alt. 1900 m, on dead
twigs, C.A. Chiu; CCA 23, Sep. 2, 1995 (TNM F3688). Nantou: Meifeng, alt. 2150 m,
on dead branches, C. P. Hsiao, WAN 010, Mar. 25, 1994 (paratype, TNM F2108); WN.
Chou, WAN 012, Apr. 7, 1994 (TNM F 2109); C.C. Wen, WAN 372, Dec. 19, 1996
(TNM F5395); ¥ Z. Wang, WAN 559, WAN 560, Mar. 10, 1998 (TNM F8292, F8293);
S.Z. Chen, WAN 642, Dec. 3, 1998 (TNM F9952); Tatacha, alt. 3000 m, on dead
branches, J. M. Chen, Apr. 29, 1993, May 19, 1993 (TNM F754, TNM F993); Tungpu,
on dead branches, W. N. Chou, WAN 189, Aug. 10, 1995 (TNM F3460); Wushe, alt. 870
m, on dead branches, W.N. Chou, WAN 309, July 4, 1996 (TNM F 5134).
Harrington (1997) published this species based on a duplicate of WAN 010 (TNM
F2108). It has been treated as S. occidentalis (Schwein.) Sacc. (Liou and Chen 1977) in
Taiwan. This species differs from S. occidentalis mainly by the large and tomentose
apothecia (Harrington 1990, 1997). Paden (1984) described Molliardiomyces
occidentalis and M. coccinea as anamorphs of S. occidentalis and S. coccinea
respectively, but I have not found conidia in culture of this species. Zhuang (2000)
recently published a new speceis, S. Shennongjiana from China.
DISCUSSION
The ascospore ornamentation of Microstoma floccosum is very delicate and
compact, and those of Cookeina insititia, C. sinensis, and Sarcoscypha humberiana are
very shallow and irregular, hence all are difficult to detect under light microscopy. The
finding of ascospore ornamentation by SEM within the Sarcoscyphaceae is not unusual.
Moravec (1997) reported that the ascospores of Cookeina colensoi, which have
335
commonly been considered as smooth, show very fine amoeboid-verrucose
ornamentation under SEM. Zhuang (1993) reported that the ornamented ascospores of
Sarcoscypha occidentalis forma occidentalis and S. vassiljevae are revealed by SEM. In
future studies, more smooth-spored species of Sarcoscyphaceae will be proved to have
ornamented ascospores by SEM.
336
ACKNOWLEDGMENT
The author thanks Dr. W.-y. Zhuang for reviewing the manuscript, arranging loans
of type specimens from HMAS and providing related literature; Mr. Z. Wang for
loaning the paratype of Cookeina sinensis; Mr. C.C. Wen, W.N. Chou, C.M. Chen, and
Ms. S.Z. Chen for providing specimens used in this study, Ms. S.K. Hu for taking SEM
photos, and Mr. D. Chamberlin for checking the English writing. This study is partly
supported by the Council of Agriculture 89-AST-1.5-FOD-05(5).
REFERENCES
Harrington, F. A. 1990. Sarcoscypha in North America (Pezizales, Sarcoscyphaceae).
Mycotaxon 38: 417-458.
Harrington, F. A. 1997. New species of Sarcoscypha. Harvard Papers in Botany 10: 53-
64.
Liou, S. C. and Z. C. Chen. 1977. Notes on Taiwan discomyctes I. (Pezizales and
Helotiales). Taiwania 22: 29-43.
Moravec, J. 1997. Discomycetes of Madagascar - I. Phillipsia ranomafanensis sp. nov.
and ascospores sculpture of Cookeina colensoi proved by SEM (Discomycetes,
Pezizales, Sarcoscyphacea). Czech Mycol. 50: 21-33.
Paden, J. W. 1984. A new genus of Hyphomycetes with telemorphs in the
Sarcscyphaceae (Pezizales, Sarcoscyphineae). Can. J. Bot. 62: 211-218.
Wang, Z. 1997. Taxonomy of Cookeina in China. Mycotaxon 62: 289-298.
Zhuang, W.-y. 1993. The genus Sarcoscypha in Jiaohe, Jilin province, with notes on
surface morphology of ascospores. Mycosystema 5: 65-72. |
Zhuang, W.-y. 2000. Additional notes on Sarcoscypha in China. Mycotaxon 76: 1-8.
Fig. 3. SEM photographs of ascospores A. Cookeina insititia (TNM F5296). B.
Microstoma floccosum (TNM F4565). C. Cookeina sinensis (holotype, HMAS 70088).
D. Cookeina sinensis (TNM F0781). E. Phillipsia domingensis (TNM F10183). F.
Sarcoscypha humberiana (TNM F8292). Bars = 5 um.
MYCOTAXON
Volume LXXIX, pp. 337-360 July-September 2001
SOME SPECIES OF XYLARIA (HYMENOASCOMYCETES, XYLARIACEAE)
ASSOCIATED WITH OAKS IN MEXICO
Felipe San Martin and Pablo Lavin
Instituto Tecnolégico de Ciudad Victoria
Ap. postal 175 Cd. Victoria, Tam. 87010, MEXICO
E-mail: biota@tamnet.com.mx
and
Jack D. Rogers
Department of Plant Pathology
Washington State University
Pullman, WA 99164-6430, USA
E-mail: rogers@wsu.edu
ABSTRACT
Fifteen taxa of the genus Xylaria growing on wood, fruit remains or leaves of
Quercus spp., are reported from México. Xylaria albisquamula, X. duranii, X.
michoacana, X. quercinophila, X. subcoccophora, and X. tumulosa are described as
new. A dichotomous key for the considered taxa is provided.
KEY WORDS: Systematics, Quercus, cloud forest, anamorph, Mexico.
RESUMEN
Se reportan 15 taxa del género Xylaria que crecen en México sobre madera, restos
de frutos u hojas de Quercus spp. Se describen las nuevas especies Xylaria
albisquamula, X, duranii, X. michoacana, X. quercinophila, X. subcoccophora y X.
tumulosa. Para los taxa considerados se provee una clave dicotémica.
INTRODUCTION
The Mexican flora is one of the most diverse on earth because practically every
biome so far described is present in the country (San Martin, 1992). The main types of
vegetation of México, recognized by Rzedowski (1978), are: the Evergreen Tropical
Forest, the Deciduous Tropical Forest, the Spiny Forest, the Xerophytic Scrub, the
Grassland, the Quercus Forest, the Conifer Forest, the Cloud Forest, and the Subaquatic
and Aquatic Vegetation.
The abundance in México of species of Pinus and Quercus is remarkable. For
example, according to Critchfield and Little (1966), there are 35 species of Pinus
representing 39% of the total species for this genus in the world. Also between 100 and
125 species of Quercus are concentrated in Central and Southern México.
338
According to Zavala (1990), this large concentration of species is the greatest in the
American Continent and perhaps in the entire world. It is not surprising, then, to find a
great diversity of fungi associated with Quercus spp. in México.
The aim of this study was to contribute to the knowledge of the Xylaria species
associated with oaks from various Mexican states. Collection, preservation, and
identification methods of taxa follow San Martin and Rogers (1995). Cultures and
anamorphic information were obtained as given in San Martin and Rogers (1993).
Herbarium acronyms are largely based on Holmgren et al. (1990).
]
eet
Pe wWwWhd
KEY TO XYLARIA SPECIES ASSOCIATED WITH QUERCUS OF MEXICO
. Stromata clavate to short clavate, with immersed perithecia and an acute sterile apex
sometimes thread-like, the stipes short to long, tomentose to villose, 1-5 cm high x 1-
3.5 mm broad, shiny-black, the white, brown or dark-brown outer layer peeling, with
finely papillate to papillate-hemispherical ostioles. Ascospores brown to dark-brown,
ellipsoid-inequilateral to navicular with narrowly rounded ends, sometimes bearing a
hyaline appendage at one end, (14-) 15-17 (-18) x (4.5-) 5-5.5 um, the germ slits
straight, oblique or sigmoid, slightly less than spore-length on concave side. On dead
wood or fruit remains of Quercus aff. germana .....Xylaria juniperus var. asperula
“Combination of Teatures different... cece-n eee cr ocr tee ee irs ccteae te lee eee tere Eads
. Stromata filiform with crowded, almost free perithecia, with acute sterile apex, and
more or less long, villose stipes, 1-2 cm total length x 1-1.5 mm broad, black with
concolorous outer layer, and slightly papillate to papillate-hemispherical ostioles.
Ascospores light-brown to brown, translucent, 12-14.5 (-16) x 4-4.5 (-5) ym, the
germ slits straight or sigmoid, spore-length on concave side. On fruit remains and
dried leaves of Q. polymorpha..................cccceeseceeeeseeeeeneeees Xylaria duranii sp. nov.
. Combination of features different. Stromata growing on dead WOOG .............eseeeeeeeseees 3
. Ascospores with sigmoid or spiralling germ Slits ............... sc eesesessoessseeeseessnesereesesesenes +
, ASCOSDOTES) With Strate ht: Sern Sits). osteer tes, re ndag, Pere enemies eens etn nae 6
Stromata subsessile, attached to substrate by a narrow connective, peltate to
subglobose, 1-1.5 cm long x 7-8 mm wide x 4-9 mm high, surface white, finely
cracked. Ascospores dark-brown to almost black, subglobose with abruptly pinched
ends; (20.5-) 21.5-24:5 (-25) x (13.5-}E4-16 (18.5) Pim. oie eecgestce wane faded oases
i Aired Me wins ty bibs pi okeral Pies sei labewee ba mb ality st dedi ate Xylaria michoacana sp. nov.
. Stromata stipitate. Combination of features differing from above ..............:cescceeseeees ,
. Fertile part conical to irregular, terete, with rounded fertile apex, on short to long
stipe, 2-7 cm total length x 0.5-3 cm diam, surface white to yellowish, finely cracked.
Ascospores dark-brown, ellipsoid-inequilateral with broadly or narrowly rounded
ends, (19-) 20-23 (-25) x 8-9.5 (-10) um... Xylaria quercinophila sp. nov.
. Fertile part cylindrical, clavate to irregular, terete to compressed, with sterile acute
apices, on short to long stipes, 4-9 cm total length x 2-5 mm diam, surface blackish
with brown outer layer. Ascospores brown to dark-brown, ellipsoid-inequilateral to
navicular with narrow to acute ends, (15.5-) 16-18 (-20) x 6-7 (-7.5) um...............4.
h eua POW EG Alera tirstis DA MAD tog igh iN ipetunib rt gy Sergi ody ore oy ya Xylaria cf. scruposa.
. Fertile part cylindrical, the uppermost portions often flattened, unbranched or
branched, on short to long stipe, 7-10 cm long x 3-12 mm broad, surface reddish-
brown to dull black, ornamented by reticulate cracks, the small papillae often
surrounded by sunken discs. Ascospores brown, ellipsoid-inequilateral, the ends
broadly or narrowly rounded, (9.5-) 10.5-13 (-14) x 4-5 (-5.5) wm.......... 2. eee eee eee
339
Bete sh eratit tebips appre tin sient ih opie shies Mi witateed may eh Mubeakn aNe ae N Ariane MK eee ook Xylaria adscendens
. Sunken discs around papillae absent. Combination of features differing from above...7
7. Stromata cylindrical to irregular, unbranched or branched, terete to compressed, on ill-
or well defined tomentose stipes, the acute apices sterile, 3.5-4 cm high x 2 mm
broad; surface blackish, with white to brown outer peeling layer. Ostioles slightly
papillate to conical. Ascospores brown to dark-brown, ellipsoid-inequilateral to
navicular with narrow to narrowly rounded ends, (9-) 9.5-11 (-12) x 4.5-5 pm..........
SRR MES setae AM Ghd esha ried os tvle vans ek Goccar ges otslon cart caobacd tire learn bee Xylaria sp. aff. hypoxylon
an.
noe ombmation of teatunes differentie 0 52, ager aciso hse est srclse ree kien reed csczans 8
Sprerule. part pwith, prominent perithecial Combours) 0). Besides die vecesee seal tees eventual tes: 9
8. Fertile part with inconspicuous perithecial CONtOUTS.............ccccccceesesesseescesseessessesseeees 10
9. Stromata unbranched or branched consisting of a smooth, long rachis that extends
upward as sterile apex and downward as stipe, 6-16 cm total length x 1.5-2 mm
broad. Surface black. Ascospores brown, ellipsoid-inequilateral to navicular with
narrowly rounded ends, (16.5-) 17-20 (-22) x (6-) 7-8 um... : 2
Rae seaasutndees Le UMS odakws o000 Suk Ade BC ga toen pny oe Ata Nplaria ari an nov.
9. Stromata cylindrical, branched or unbranched, with long or short acute sterile apices,
on short glabrous stipes, 1.5-3 cm total length x 2 mm broad, surface blackish with
white peeling outer layer. Ostioles slightly papillate. Ascospores brown to dark-
brown, ellipsoid-inequilateral to navicular with narrowly rounded ends, (9-) 10-11
FL Wo) Fess T LLL 01 Ewe ct BEN oR PERE i ey ae Xylaria subcoccophora sp. nov.
10. Stromata unbranched or branched, with acute sterile apices, on ill-defined stipes, up
to 7 cm long x 2-4 mm diam, surface dark-brownish to blackish, tomentose.
Ascospores yellowish, ellipsoid-inequilateral to fusoid or crescentic, 10-13 (-14) x
(2.5-)/3-44imsthe'getrm slits obscure. a seceteecee eete tis Xylaria cf. magnoliae
10. Ascospore germ slits evident. Combination of features differing from above .........11
ie INO Mata ON OR, SreAalCi al CAM). As gO each acs east ercates s cceouy thevahlsew vege ease os cankas 12
Aa eOIata tess. tatyS/TNh 1M GIA acta etcetera neh: 5.0 tay A sade arch tac aels 13
12. Stromata clavate, unbranched, 1.5- 3.5 cm high x 7-9 mm broad, with inconspicuous,
white to brownish scales, the smooth, black stipes discoid at the base, dark-brown.
Ostioles obscure to slightly raised. Ascospores brown to dark-brown, navicular to
somewhat crescentic, with narrow to more or less acute ends, 10-13 (-14) x 4-5 um
...Xylaria albisquamula sp. nov.
12. Spach SRP) “paRearaieal 4 or f Nertares at Ske with rounded fertile apices, on
short or long fluted stipes arising from a pannose base, 1.5-2.5 cm long x 4-6 mm
diam. Surface copper-colored, becoming blackish and hollow. Ostioles finely
papillate. Ascospores brown, ellipsoid-inequilateral with broadly or narrowly-
rounded ends, (8.5-) 9-11 (-12) x 4-5 pm...................Xylaria sp. cubensis complex
ESS ASCOSPOLES ID 10 abe UI) LON Pas.csct iencee 4 odd ain odes amare ety on nt ta as Guana ne cates 14
IS aASCocpares more dhan 12s gm longs Aes | ceases ee reauegt ot tett weaaes etre eh Gasoevss tes 15
14. Stromata cylindrical, branched or unbranched, with long or short, acute sterile apices,
on short, glabrous stipes, 1.5-3 cm long x 2 mm broad, surface blackish with white
peeling outer layer. Ostioles slightly papillate. Ascospores brown to dark-brown,
ellipsoid-inequilateral to navicular, the ends narrowly rounded, (9-) 10-11 (-11.5) x
Pel ees Api ane oe OXON fee sane year eee eee Ah) A 8 Xylaria subcoccophora sp. nov.
14. Stromata cylindrical, unbranched or branched, cespitose, on ill-defined stipes, with
acute sterile apex, 2-6 cm total length x 2-4 mm diam. Ostioles umbilicate to
somewhat papillate. Ascospores brown to dark-brown, ellipsoid-inequilateral with
broadly or narrowly rounded ends, (9-) 9.5-12 x 4-5.5 um ...........e Xylaria longiana
340
15. Stromata clavate to somewhat cylindrical, unbranched or branched, the apex rounded
to blunt, sterile or fertile, terete to flattened, on ill- or well defined stipes, tomentose
at the bases, the white outer peeling layer splitting in strips, 1-3 cm long x 1-2.5 mm
broad. Ostioles finely to prominently conic-papillate. Ascospores brown to dark-
brown, ellipsoid-inequilateral to navicular with narrow ends, (12-) 13-14.5 (-15) x 5-
1 ipa ofc int beets errr rates ven pi erbee HN Mie her aad thier Xylaria sp. aff. longiana
15. Stromata subglobose to short-cylindrical, branched or unbranched, the acute apices
sterile, the villose stipes short or long, with brown to dark-brown outer layer, 0.7-6.5
cm long x 2-4 mm broad. Ostioles obscure to finely papillate conical. Ascospores
brown, ellipsoid-inequilateral to navicular with narrow to narrowly rounded ends,
(20=)'20:5=25° G26) X(6:9-) FAS E9) LI eee eetetaccsedercesstecrastea ss Xylaria apiculata
DESCRIPTIONS
Xylaria adscendens (Fr.) Fr., Nova Acta Regiae Soc. Sci. Upsal. (ser. 3) 1, p. 128.
1851.
The teleomorph is as described by Dennis (1961), Rogers (1984), and San Martin
and Rogers (1989). The anamorph was as described by Callan and Rogers (1990).
SPECIMEN EXAMINED: Tamaulipas, Gomez Farias municipality, El Cielo
Biosphere Reserve, San Martin 203, on cortex of living Quercus aff. germana Cham.
& Schl. in cloud forest ITCV, JDR).
NOTES: After study of the anamorph, collections reported as Xylaria sp. (SM 39 &
306) in San Martin and Rogers (1989), turned out to be small, tropical forms of X.
adscendens.
The colony of X. adscendens, except for the yellow-greenish radial sectors and the
shape and length of its conidia, was reminiscent of X. multiplex (Kunze) Fr. (see cultural
descriptions of X. multiplex and X. adscendens in San Martin, 1992 and in Callan and
Rogers, 1990, respectively, and notes on Xylaria cf. scopiformis [Mont. ex Joly] T.
Schumacher, in San Martin, 1992).
Xylaria albisquamula San Martin, J. D. Rogers et Lavin sp. nov. Figs. 1, 2, 3, 4
Stromata non ramosa, clavata, 1.5-3.5 cm longitudine tota x 7-9 mm crassa, stipitibus
nigellis, laevia, basi discoidea, extus primus lutea pruinosa obtecta, denique fusca, cum
squamis inconspicuis albis vel brunneolis, intus alba vel lutea, cava. Textura dura sed
fragilis. Superficies laevis cum subtili reticulationes. Perithecia 0.4-0.7 mm diametro.
Ostiola inconspicuis vel parum conspicuis. Asci cylindrici, octospori, ordinate uniseriati
vel parte biseriati, longissimo stipitate, 172-224 jm longitudine tota x 6-7 (-7.5) um
crassi, partibus sporiferis 62-79 um, annulo apicali in liquore Melzeri cyanescente,
urniforme, 3 pm alto x 2-3 um crasso. Ascosporae brunneae vel fuscae, naviculares vel
aliquantum lunatae, extremis angustis vel acutatis, 10-13 (-14) x 4-5 wm, rima
germinativa recta abbreviata in latere concavo praeditae.
Status anamorphosis ignotus.
Stromata unbranched, clavate, 1.5-3.5 cm long x 7-9 mm broad, the stipes black,
smooth, with a discoid base; externally at first covered with a yellow, pruinose outer
layer, becoming dark-brown, with conspicuous, white to brownish scales, internally
white to yellowish, becoming hollow. Texture hard but fragile. Surface smooth except
for very fine reticulations. Perithecia 0.4-0.7 mm diam. Ostioles obscure to slightly
raised. Asci cylindrical, eight-spored with uniseriate to partly biseriate spore
arrangement, very long-stipitate, 172-224 pm total length x 6-7 (-7.5) um broad, the
341
spore-bearing part 62-79 ym, with apical ring bluing in Melzer's iodine reagent, urn-
shaped, 3 um high x 2-3 um broad. Ascospores brown to dark-brown, navicular to
somewhat crescentic, with narrow to more or less acute ends, 10-13 (-14) x 4-5 um, the
straight germ slits less than spore-length on concave side.
Anamorphic state unknown.
The specific epithet alludes to the superficial, white, stromatal scales.
SPECIMENS EXAMINED: Chiapas, Jaltenango municipality, Santa Rita Colony-El
Triunfo Hill hike trail, 7.VI.88, San Martin 657, on wood of a riparian element along
river shore in a cloud forest (ITCV, JDR). Tamaulipas, Gomez Farias municipality, San
José, 1470 m, 20.XI.1996, San Martin 5239T, on wood of Quercus germana Cham. &
Schl. in cloud forest (ITCV: HOLOTYPE).
ADDITIONAL SPECIMENS EXAMINED: Xylaria tuberoides Rehm, México,
Oaxaca, 12.VII.1959, Heim s/n, on wood in tropical forest (MEXU-9720). Puerto Rico,
Canovana municipality, Barrio Cubun, El Yunque, 11.VI.1998, San Martin 9008PR, on
wood in median subdeciduous tropical forest (FSM).
NOTES: This member of X. cubensis complex appears restricted to cloud forests. In
general it fits description of Cooke (1883) for X. australis, but the latter was collected
at Endeavour River in Australia and has ascospores 15 um long with narrow ends.
The Mexican fungus has the surface close to that of Xylaria tuberoides Rehm, but
the latter grows in tropical rain forests, lacks conspicuous white scales, its scarce
entostroma is pinkish when mature, the apical ring is bigger i. e. 5-.5 um high x 3-4 um
broad, and its ascospores are consideably larger i. e. 25-28 x 5.5-6.5 (-7) um (see Rehm,
1901 for description of X. tuberoides).
Xylaria albisquamula also recalls X. pallida Berk. & Cooke from which it differs in
having the outer layer split in white scales and larger ascospores (see San Martin and
Rogers, 1989 for description of X. pallida).
Figs. 1-4. Xylaria albisquamula. 1: Stroma, 1 cm = 5 mm. 2: Detail of the stromatal
surface showing punctate ostioles, | cm = 3.5 mm. 3: Ascus apical ring, Imm = 0.5 um.
4: Ascospores, | cm = 2.2 um.
342
Xylaria apiculata Cooke, Grevillea 8: 66. 1879.
The teleomorph is as described by Rogers and Samuels (1986).
Colonies covering Petri dish in 5 wk, at first white with plumose margins, strongly
zonate, felty to appressed, becoming dark-grey. Reverse uncolored to brownish.
Stromata produced at the center or at the edges of the colony, acuminate to clavate,
darkish with white-yellowish tips, branched to unbranched, with felty surface. ©
Anamorphic structures not produced.
SPECIMENS EXAMINED: Chiapas, Jaltenango municipality, El Triunfo Hill,
8.VI.88, San Martin 696, on dicot wood in cloud forest (ITCV, JDR). Tamaulipas,
Hidalgo municipality, ejido Conrado Castillo, VII.88, Lucrecia Garcia 113A
(CULTURED) & 116, on Quercus sp. wood in cloud forest (ITCV, JDR).
NOTES: Mexican material assignable to Xylaria apiculata Cooke, apparently is
rare and largely confined to temperate places. Rogers and Samuels (1986) described and
depicted a somewhat similar culture of X. arbuscula (see their Fig. 9E). Their fungus
did not form stromata in culture.
Xylaria duranii San Martin et Vanoye sp. nov. Figs. 5, 6, 7, 8
Stromata non ramosa, filiformes, aggregatis peritheciis fere liber, in stipitibus
villosus. Apicibus sterilibus, acutatis, brevis, 1-2 cm longitudine tota x 1-1.5 mm crassi,
extus nigella cum externo strato concoloro, intus alba. Textura potius mollis. Superficies
laevis vel nodosus. Perithecia 0.3-0.4 mm diam. Ostiola aliquantum papillata vel
hemispherica. Asci cylindrici, octospori, ordinate in parte biseriate, 96-118 pm
longitudine tota x 5-7.5 tm crassi, partibus sporiferis 60-88 um, annulo apicali in liquore
Melzeri cyanescente, rectangulare, 2.5 wm alto x 1.5-2 wm crasso. Ascosporae
palliduseae brunneae vel brunneae, translucidae, ellipsoideo inequilaterales vel leniter
lunatae cum extremis angustus vel late rotundatis, nonnulla extremum abrupte constrictis,
12-14.5 (-16) x 4-4.5 (-5) um, rima germinativa recta vel sigmoidea, longa praeditae.
Status anamorphosis ignotus.
Stromata unbranched, filiform, on villose stipes, with short, acute sterile apices,
bearing crowded, almost free perithecia, 1-2 cm total length x 1-1.5 mm broad;
externally black with a concolorous outer layer, internally white. Texture rather soft.
Surface smooth to nodulose due perithecial contours. Perithecia 0.3-0.4 mm diam.
Ostioles slightly papillate to papillate hemispherical. Asci cylindrical, eight-spored, with
partly biseriate spore-arrangement, 96-118 pm total length x 5-7.5 um broad, the spore-
bearing part 60-88 um, with apical ring bluing in Melzer's iodine reagent, rectangular,
2.5 um high x 1.5-2.0 um broad. Ascospores brown to light-brown, translucid, ellipsoid-
inequilateral to somewhat crescentic, wirh narrowly rounded to narrow ends, sometimes
with one end pinched, 12-14.5 (-16) x 4-4.5 (-5) um, with germ slit straight to sigmoid
full spore-length on concave side.
Anamorph unknown.
Xylaria duranii is named after the eminent mycologist and human rights advocate,
our friend Rubén Duran.
SPECIMEN EXAMINED: Tamaulipas, Ciudad Victoria municipality, Cafién del
Novillo, Los Indios ranch, 535 m, 9.X1.1998, Vanoye 165, on leaves and fruit remains of
Quercus polymorpha Schl. et Cham. in an oak forest (ITCV: HOLOTYPE).
NOTES: Kar and Gupta (1978) reported as X. trichopoda Penzig & Sacc. a taxon
growing on decaying fruits of Quercus sp. in India, describing ascospores as light-
brown, 14-17.5 x 3.5-7 um. That collection seems close to the fungus described herein.
343
The original description of Xylaria trichopoda states that it grows on corticated wood
not on leaves (for description of X. trichopoda see Penzig and Saccardo, 1904).
Figs. 5-8. Xylaria duranii. 5: Stroma, | cm = 3 mm. 6: Stroma detail showing crowded,
almost free perithecia, 1 cm = 1.7 mm. 7: Ascus apical ring, 1 mm = 0.3 pm. 8:
Ascospores with sigmoid or straight germ slits, 1 cm = 5.5 um.
344
Xylaria juniperus Starb. var. asperula Starb., Ascom. d. Regn. Exp. II, Bihang t. k.
Svenska Vet. Akad. Handlinglar (Stockholm). 27: 20. 1901. Figs. 910, 11, 12
Stromata unbranched, with short-clavate to clavate fertile part, 0.5-1.7 cm high x 1-
3.5 mm broad, with acute, sometimes thread-like, sterile apices, on short to long,
tomentose to villose stipes, 0.5-3 cm high; externally dull to shiny-black with white or
brown to dark-brown peeling outer layer organized in longitudinal strips or patches,
internally white. Texture hard, carbonous. Surface roughened by the outer layer, ostiola,
and tomentum-like outgrowths when young. Perithecia 0.5-0.8 mm diam. Ostioles finely
papillate to papillate-hemispherical. Asci cylindrical, eight-spored, uniseriate to partly
biseriate, long-stipitate, 157-203 um total length x 6.5-9 um broad, the spore-bearing
part 87-98 um, the apical ring bluing in Melzer's iodine reagent, rectangular, 4 um high x
2-3 um broad. Ascospores brown to dark-brown, ellipsoid-inequilateral to navicular with
narrowly rounded ends, sometimes bearing a hyaline appendage at one end, (14-) 15-17
(-18) x (4.5-) 5-5.5 pum, the germ slits straight, oblique to sigmoid, slightly less than
spore-length on concave side.
Colonies covering Petri dish in 2-3 wk, at first white, with light-yellow or white entire
margins, zonate or azonate, cottony, becoming brown with white sectors or turning black
from the center outward, appressed, soon overlain by white, floccose mycelium. Reverse
with dark-brown and unchanged areas. Stromata scarce to numerous, produced in
localized sectors of the colony or over-all in concentric rings, acicular to clavate, with
white, pointed tips, 0.4-1 cm high x 0.7-0.9 mm broad, branched to unbranched.
Conidium-bearing regions produced on upper surfaces of stromata or on superficial tufts.
Conidiogenous cells terminal, cylindric, hyaline, 6-19 x 2-3.5 um, bearing terminal and
lateral denticular secession scars. Conidia produced holoblastically in sympodial
sequence. Conidia hyaline (white in mass), smooth, cylindroid to somewhat fusiform,
(4.5-) 5-7 (-8) x 1.5-2.5 um, the flattened bases indicating former points of attachment to
conidiogenous cells.
SPECIMENS EXAMINED: Morelos, Cuernavaca municipality, La Pera curve, 2045
m, 18.1X.1998, San Martin 4122M, on Quercus wood in an oak forest (FSM);
Cuernavaca municipality, La Pera curve, alt. 2230 m, 18.1X.1998, San Martin 4137M,
on Quercus wood in an oak forest (FSM). Nuevo Leén, Guadalupe municipality, La
Pastora forest, 15.X.88, Mario Angel Ibarra 1, on Quercus sp. wood in an oak forest
(ITCV). Tamaulipas, no date, San Martin 6017T, on Quercus sp. wood (FSM); Gémez
Farias municipality, Rancho El Cielo, 9.X.86, Jesus Garcia 5337, on fallen fruit of
Quercus sp. (ITCV); Gomez Farias municipality, E] Malacate, 13. VIII.1988, S. Chacon-
Jiménez 456 (CULTURED) on Quercus sp. wood in cloud forest (ITCV).
ADDITIONAL SPECIMEN EXAMINED: Xylaria juniperus Starb. var. asperula
Starb., Paraguay, Mbopy, 9.1I.1893. Malme s. n. (S: SYNTYPE).
NOTES: Collection Jess Garcia 5337 fits syntype of Xylaria juniperus Starb. var.
asperula Starb. The rest show a white outer peeling layer, but have in common with
typical X. juniperus var. asperula the ascospore shape and size, and a long, straight to
sigmoid germ slit running almost the full length of the ascospore.
Xylaria juruensis Hennings described by San Martin and Rogers (1989) and X.
arbuscula Sacc. var. plenofissura Ju & Tzean as described by Ju and Tzean (1985), fit
the concept of X. juniperus var. asperula.
A member of the arbuscula complex reported by Candoussau (1983), collected in
the Pyrenees on Quercus sp. wood, seems conspecific with the Mexican material (see
fig. 3 in Candoussau, 1983).
345
_Xylaria juniperus var. asperula is close to Xylaria apiculata Cooke. The latter
taxon is treated here as material with stromatal features much like those of X. arbuscula,
and with ascospores 20 um or larger. Xylaria juniperus var. asperula is a member of
the vast Xylaria arbuscula complex.
om eh
Rr Bo ee
A ed ge
oe
me
*.
bea
>
*
6
were
pat
RS
mn
* 2,
4? Fe.
NS as a KS
a eat XC REE
Rear ator
12
Rees Sa aKe
PES
Figs. 9-12. Xylaria juniperus var. asperula. 9: Stroma, 1 cm = 2 mm. 10: Stroma detail
showing discrete perithecial contours and finely papillate to papillate-hemispherical
ostioles, 1 cm = 1 mm. 11: Rectangular ascus apical ring, 1 mm = | um. 12: Ascospores
with straight, oblique to sigmoid germ slits, 1 cm = 8 pm.
346
Xylaria longiana Rehm, Ann. Mycol. 2: 175. 1904.
Stromata are much like as described by San Martin and Rogers (1989) as Xylaria cf.
longiana. Stromata on ill or well-defined stipes, with blunt or acute sterile apices,
bearing conspicuous or immersed perithecial contours. Surface with remnants of a white
to brown peeling outer layer split in longitudinal strips or remaining as minute patches.
Ostioles umbilicate to papillate-hemispherical. Ascospores (9-) 9.5-12 x 4-5.5 um.
Colonies covering Petri dish in 3-4 wk, at first white with lobate to wavy margins,
appressed, then with orange-buff, more or less cottony areas corresponding to primordia
of stromata. Reverse brownish. Stromata densely arranged in concentric rings, cylindric,
unbranched to branched at points of contact with Petri dish lid, terete, tomentose, black
with palmate or more or less acute pinkish tips, 1-3.5 cm high x 2-2.5 mm broad.
Conidium-bearing regions on upper surfaces of stromata. Conidiophores in upright
palisades, irregularly branched, hyaline, smooth. Conidiogenous cells terminal,
cylindrical, 16-28 x 3-5.5 um, hyaline, bearing terminal and lateral denticulate conidial
secession scars. Conidia produced holoblastically in sympodial sequence. Conidia
hyaline (white collectively), smooth, fusiform, 6-7 (-8) x 2.5 um, with flattened bases
indicating former points of attachment to conidiogenous cell. Conidia germinating in
water.
SPECIMENS EXAMINED: Jalisco, Tequila municipality, Km 20 Tequila-Cerro
de Tequila country road, 1800 m, 29.VIII.85, Guzman-Davalos 2558, on wood in oak
forest (IBUG). Morelos, west side of La Pera curve, México-Cuernavaca freeway, 2300
m., 21.1X.69, Guzman 7715, on wood in mixed forest of Quercus spp. with tropical
elements (XAL); Tepoztlan municipality, La Pera curve, 8 km from Tepoztlan, 2100 m,
23.VI1.1998, San Martin 4039M, on Quercus sp. wood in an oak forest (FSM);
Cuernavaca municipality, 2260 m, 18.1X.1998, San Martin 4113M & 4133M on
Quercus sp. wood in an oak forest (FSM). Nuevo Leon, Iturbide municipality, ejido La
Purisima, El] Charco, 1700 m., 21.VIII.86, Fortunato Garza 725, on Quercus sp. wood
in oak-pine forest (CFNL); Santiago municipality, 3 Km before Corral de Piedra, 3.X.85,
Fortunato Garza 588, on dead log of Quercus ryzophylla Weath. in oak-pine forest
(CFNL); Santiago municipality, El Cercado, 26.VI.88, Moreno 220, on Quercus sp.
wood in submontane scrub with Quercus spp. (ITCV, JDR); Santiago municipality, El
Cercado, 23.X.88, San Martin 1149 (CULTURED), on Quercus sp. wood in
submontane scrub with Quercus spp. (ITCV, JDR); Garza Garcia municipality,
Chipinque, 1.X1I.80, Mario Olguin 1, on wood in oak-pine forest (ITCV). State of
México, Santa Maria Mazatla, 17.XII.88, Barbosa 40B, on wood in Quercus spp. forest
(XAL). Tamaulipas: Gomez Farias municipality, ejido Julilo, 13.VII.88, S. Chacon 460,
on wood in cloud forest (ITCV); Hidalgo municipality, ejido Conrado Castillo, VII.87,
San Martin 451, on wood in cloud forest (ITCV, JDR); Hidalgo municipality, ejido
Conrado Castillo 2.V.88, Lucrecia Garcia 103, 109 & 111, on wood in oak-pine forest
(ITCV, JDR); Ciudad Victoria municipality, 5.[X.88, San Martin 1010 (CULTURED),
on dead leaves of Agave furcroides Lem. "henequén" in an abandoned Agave
furcroides plantation (ITCV, JDR); Ciudad Victoria municipality, El] Madrofio, 1450 m,
12.X.1995, San Martin 5193T, on Quercus wood in oak forest (ITCV); Ciudad Victoria
municipality, Cafidn del Novillo, Las Minas, 640 m, 1.X.1996, San Martin 5258T, on
Quercus sp. wood in pine-oak forest (ITCV).
Collection San Martin 1010 on Agave furcroides yielded a somewhat different
culture compared to cultures obtained from specimens growing on Quercus wood:
347
_ Colonies covering Petri dish in 2-4 wk, at first white, with entire margins, floccose,
becoming pinkish in some areas. Reverse uncolored. Stromata produced over all the
colony without any organized pattern, at first acicular then somewhat lanceolate, 3-4 cm
high x 1-1.5 mm broad, branched to unbranched, at first white, becoming blackish from
bases upward, with sparse tomentum. Conidium-bearing regions on the surface of
stromata. Conidiophores in upright palisades, unbranched to sparingly branched, hyaline.
Conidiogenous cells terminal, cylindrical, hyaline, 23-26 um long x 2-3 um broad,
bearing terminal denticulate conidial secession scars. Conidia produced holoblastically in
sympodial sequence. Conidia hyaline (white in mass), smooth, fusiform, (4-) 5-6 (-7) x
(1.5-) 2 um, with flattened bases indicating former points of attachment to conidiogenous
cell. Conidia on stromata from nature hyaline, fusiform, 4.5-5 x 1.5 (-2) um, with
flattened bases.
NOTES: It is clear that X. longiana has a distribution almost restricted to areas
where oaks are present. The type was collected in Texas, USA, on Quercus wood
(Rehm, 1904). Collection San Martin 1010, found on Agave furcroides leaves, has
stromata that are smaller than material collected from Quercus wood, and produces
floccose colonies, but is hardly separable from typical X. longiana on ascospore and
conidial features.
The Mexican material is slightly variable in teleomorphic characters, but shows
marked cultural differences perhaps as a reflection of host specialization. The fusiform
shape that characterizes the conidia of X. longiama (and perhaps the whole X.
hypoxylon complex), was reported by Chacko and Rogers (1981) from an Oklahoma
collection designated X. hypoxylon (L.: Hook.) Grev. "small-spored collection". That
fungus is referable to X. longiana.
Xylaria cf. magnoliae J. D. Rogers, Can. J. Bot. 57: 941. 1979. Figs. 13, 14, 15, 16
Stromata unbranched or branched, cylindrical, terete or compressed, tomentose,
bearing perithecia with more or less evident contours, apices acute sterile, on ill-defined,
conspicously tomentose stipes, up to 7 cm total length x 2-4 mm broad; externally dark-
brownish to blackish, internally white. Texture soft to somewhat woody. Surface
roughened by perithecial contours, wrinkles, and the tomentum. Perithecia 0.3-0.7 mm
diam. Ostioles finely papillate. Asci eight-spored, with uniseriate to partly biseriate spore
arrangement, cylindrical, long-stipitate, 112-150 tm total length x 4-6.5 um broad, the
spore-bearing part 59-75 um, the apical ring bluing in Melzer’s iodine reagent,
rectangular, 2-3 um high x 1.5-2 um broad. Ascospores yellowish, unicellular, ellipsoid-
inequilateral to fusoid or crescentic, smooth, 10-13 (-14) x (2.5-) 3-4 um, the germ slits
obscure.
Anamorph unknown.
SPECIMEN EXAMINED: Nuevo Leon, Zaragoza municipality, La Encantada, 2500
m., Garza-Ocafias 608, on Quercus sp. wood in oak-pine forest (TCV, CFNL).
NOTES: This fungus has stromatal surface characteristics, and ascospore shape and
color similar to X. magnoliae, but grows on Quercus wood and has less pronounced
perithecial contours and slightly smaller ascospores. It might represent a new variety of
X. magnoliae but unfortunately cultures were not obtain.
348
Xylaria michoacana San Martin, J. D. Rogers et Lavin sp. nov. Figs17,.18; 19) 20
Stromata peltata vel subglobosa, subsessile, substratum affixis ad angustus
connexum, 1-1.5 cm longa x 7-8 mm crassi x 4-9 mm alta, extus nigella cum externo
strato albo, intus albida sordida. Textura potius dura. Superficies laevis cum ostiolis et
fissuris. Perithecia 0.4-0.9 mm diam. Ostiola papillata, haemisphaerica. Asci cylindrici,
octospori, ordinate uniseriate vel in parte biseriate, cum longissimo stipite, 234-309 um
longitudine tota x 19-22 ym crassi, partibus sporiferis 140-164 wm, annulo apicali in
Sales vials ryan i 100 aed Vell es Sida nadine Re ols aN eet ee eS Se
Figs. 13-16. Xylaria cf. magnoliae. 13: Stroma branched, compressed, and tomentose, |
cm = 8 mm. 14: Stroma detail with tomentum and perithecial contours, 1 cm = 1 mm. 15:
Rectangular ascus apical ring, 1 mm = lum. 16: Ascospores fusoid or crescentic with
inconspicuous or absent germ slit, 1 cm = 4.7
349
liquore Melzeri cyanescente, discoideo vel leniter rectangulare, 1.5-2 um alto x 4-6 um
crasso. Ascosporae fuscae vel quasi nigra, subglobosa omni extremo abrupte constrictis,
(20.5-) 21.5-24.5 (-25) x (13.5-) 14-16 (-18.5) um, rima germinativa sigmoidea vel
spirali, longa praeditae.
Stromata peltate to subglobose, subsessile, attached to substrate by a narrow
connective, 1-1.5 cm long x 7-8 mm wide x 4-9 mm high; externally blackish with white
outer crust, internally dirty white. Texture rather hard. Surface smooth with ostioles and
cracking. Perithecia 0.4-0.9 mm diam. Ostioles papillate-hemispherical. Asci cylindrical,
eight-spored, with uniseriate to partly biseriate spore arrangement, long-stipitate, 234-
309 um total length x 19-22 um, the spore-bearing part 140-164 um, the apical ring
bluing in Melzer's iodine reagent, discoid to somewhat rectangular, 1.5-2 um high x 4-6
um broad. Ascospores dark-brown to almost black, subglobose with abruptly pinched
ends, (20.5-) 21.5-24.5 (-25) x (13.5-) 14-16 (-18.5) um, with sigmoid to spiral germ
slits.
This fungus is named after the Mexican state of Michoacan.
Colonies covering Petri dish in 3-4 weeks, at first white, with somewhat entire
margins, azonate, floccose, becoming dark-green to black from center outwards.
Stromata arising over the entire colony in more or less concentric fashion, at first dark-
green finally black, tomentose all-over, clavate, prostrate to upright, 0.5-0.8 mm high.
No anamorphic structures produced.
SPECIMEN EXAMINED: Michoacan, Patzcuaro municipality, Km 6 Patzcuaro-
Santa Clara del Cobre road, V.III.88, Jesus Garcia 6005, on Quercus sp. wood in cloud
forest (ITCV: HOLOTYPE; JDR: ISOTYPE).
NOTES: This highly distinctive penzigioid fungus is a Xylaria based upon cultural
features. Its stromatal shape and type of ostioles are close to those of Penzigia
macrospora Penzig & Sacc. as described by Rogers et al. (1987), but the latter has
ellipsoid to navicular ascospores, 29.4-35.3 x (11.8-) 17.6-20.6 um, straight germ slits,
and cultures did not form stromata. Apparently the above-described material is a taxon
rarely collected in México and perhaps restricted to species of Quercus of the cloud
forest of western Michoacan.
Xylaria quercinophila San Martin, J.D. Rogers et Lavin sp. nov. Figs. 21, 22, 23, 24
Stromata non ramosa, conica vel irregularia, tumulis peritheciorum inconspicuis,
apicibus rotundatis fertilibus, stipitibus longis vel brevis, robustis rufobrunneis, fundis
pannosis et spongiosis praedita, 2-7 cm longitudine tota x 0.5-3 cm crassa, extus alba vel
luteola cum ostioliis nigellis et fissuris tenuibus; intus albida subinde peritheciis intus
endostromata. Textura valde dura. Superficies laevis praeter rugae et inflexae. Perithecia
0.5-1 mm diam. Ostiola parce papillata. Asci cylindrici, octospori, stipitati, 232-276 um
longitudine tota x 8.5-12 um crassi, partibus sporiferis 156-170 ym, annulo apicali in
liquore Melzeri cyanescente, quadrato vel aliquantum cuneato, 3.5-4 um alto x 2.5-3.5
um crasso. Ascosporae fuscae, ellipsoideo inequilaterales cum extremis rotundatis vel
late rotundatis, laeves, (19-) 20-23 (-25) x 8-9.5 (-10) um, rima germinativa spirali longa
praeditae.
Status anamorphosis ignotus.
Stromata unbranched, conical to irregular with rounded fertile apices, on short to long,
stout, reddish-brown, pannose and spongy stipes, 2-7 cm total length x 0.5-3 cm broad,
externally white to yellowish with black ostioles and fine cracks, internally whitish,
350
sometimes with perithecia deep within the flesh. Texture very hard. Surface smooth
except for wrinkling and infolding. Perithecia 0.5-1 mm diam. Ostioles slightly raised.
Asci cylindrical, eight-spored, stipitate, 232-276 jm total length x 8.5-12 wm broad, the
spore-bearing part 156-170 ym, the apical ring bluing in Melzer’s iodine reagent,
quadrate to slightly cuneate, 3.5-4 um high x 2.5-3.5 ym broad. Ascospores dark-brown,
ellipsoid-inequilateral with broadly or narrowly rounded ends, smooth, (19-) 20-23 (-25)
x 8-9.5 (-10) um, with spiralling germ slits.
Figs. 17-20. Xylaria michoacana. 17: Stroma peltate, 1 cm = 3.5 mm. 18: Stroma detail
showing papillate-hemispherical ostioles, 1 cm = 4 mm. 19: Discoid to somewhat
rectangular ascus apical ring, 1 mm = | pm. 20: Subglobose ascospores with abruptly
pinched ends, 1 cm = 7.5 um.
351
Anamorphic state unknown.
The specific name refers to the preference of this taxon for Quercus spp. wood.
Figs. 21-24. Xylaria quercinophila. 21: Stroma, 1 cm = 8.5 mm. 22: Stromatal surface
detail, 1 cm = 2.7 mm. 23: Ascus apical ring, 1 mm = 1 pm. 24: Ascospores with
spiralling germ slits, 1 cm = 7.5 pm.
352
SPECIMENS EXAMINED: Jalisco, Autlan municipality, Manantlan Biosphere
Reserve, Las Joyas, 1900 m, IX.85, Fanti 505, on wood in cloud forest (IBUG);
Cucutitlan municipality, Mesa de San Miguel, 2400 m., 14.1X.82, Nieves-Vazquez 93,
(IBUG); Gomez Farias municipality, La Calavera, 15.VIII.81, Trujillo-Flores 262, in
forest of Pinus-Quercus (XAL). Nuevo Leon, Villa de Juarez municipality, Rincon de la
Sierra, Jesus Garcia 7, on wood in Quercus spp. forest with Sargentia sp. (ITCV).
Querétaro, Jalpa municipality, 6 km after La Yerbabuena, 17.VIJI.1996, Jesus Garcia
9848, on Quercus sp. wood in cloud forest (ITCV). Tamaulipas, Hidalgo municipality,
ejido Conrado Castillo, VII.87, Avalos 25 (ITCV: HOLOTYPE; JDR: ISOTYPE);
Gomez Farias municipality, El Cielo Biosphere Reserve, 1100 m., 8. VII.84, Martinez 26,
on wood in cloud forest (ITCV, JDR): Gémez Farias municipality, El] Cielo Biosphere
Reserve, 1100 m, 22.VII.88, S. Chacén 370, on wood in cloud forest (ITCV, JDR);
Gomez Farias municipality, El Cielo Biosphere Reserve, San José, 4.X.1992, San Martin
1550T, on Quercus sp. wood in cloud forest TCV); Tula municipality, Tula-Ocampo
road, 8.X.90, Moreno 401C, on wood in Quercus spp. forest (ITCV). Veracruz, Atoyac,
9.VII.83, A. Ruiz, on humus (sic) (XAL).
NOTE: The gross stromatal morphology of this fungus is reminiscent of X.
platypoda (Lév.) Fr. but the latter has a somewhat farinose outer crust, more or less
prominent perithecial contours, and larger ascospores (see Dennis, 1956 for desciption of
X. platypoda). Xylaria quercinophila apparently occurs only in México and is
restricted to species of Quercus.
Xylaria cf. scruposa (Fr.) Fr., Nova Acta Regiae Soc. Sci. Upsal. (ser. 3) 1, p. 127.
1851.
Teleomorphic stromata is as described by San Martin and Rogers (1989) as X. cf.
corniculata.
Anamorph unknown.
SPECIMENS EXAMINED: Chiapas, Jaltenango municipality, El Triunfo Hill,
8.VI.88, San Martin 633, 660 & 694; 9.VI.88, San Martin 736, on wood in cloud forest
with Quercus skinneri Benth. (ITCV). Hidalgo, between Huautla de Hidalgo and
Huejutla de Reyes, XII.1969, Diaz-Moreno, on wood of ?Taxodium sp. "ahiiehiiete" in
cloud forest (ENCB). Jalisco, Autlan municipality, Manantlan Biosphere Reserve, Las
Joyas, 1900 m, 14.X.85, Guzman-Davalos 2888, (IBUG); Autlan municipality,
Manantlan Biosphere Reserve, Las Joyas, 1900 m, 15.X.85, Guzman-Davalos 2984, on
wood in cloud forest (IBUG). Tamaulipas, Gomez Farias municipality, El Cielo
Biosphere Reserve, 1100 m, 12. VIII.88, S. Chacén 444, on wood in cloud forest (ITCV);
ejido Julilo, 1.X1.87, S. Chacén 49, on wood in cloud forest (ITCV); Gomez Farias
municipality, San José, 3.X.1992, San Martin 1507, on wood of Quercus sp. “encino
roble” in cloud forest (ITCV); Gomez Farias municipality, San José, 4.X.1992, San
Martin 1503, on Quercus sp. wood in cloud forest (ITCV); Gomez Farias municipality,
San José, 6.X.1994, San Martin 1519T and 6018T, on Quercus sp. wood (ITCV).
NOTES: Collections listed above are forms of the tropicals X. scruposa (Lloyd,
1923) or X. moelleroclavus (Rogers, et al., 1997), that have evolved in cloud forests
associated with oak wood. In San Martin and Rogers (1989) these taxa were called X.
cf. corniculata following Saccardo (1906), because of the abscence of a verrucose
surface and presence of sigmoid to spiral germ slits running the full-length of the
ascospores.
353
Xylaria sp. cubensis complex.
Stromata clavate, branched or unbranched at base, with rounded fertile apices, on
short or long fluted stipes arising from a pannose base, 1.5-2.5 cm total length x 4-6 mm
broad, externally copper-colored, blackish in age; internally white, becoming hollow.
Texture hard. Surface smooth except for fine wrinkles and ostioles. Perithecia 0.3-0.5
mm diam. Ostioles finely papillate. Asci eight-spored, cylindrical, long-stipitated, 105-
195 um total length x 5-6 um broad, the spore-bearing part 50-69 um long, the apical
ring bluing in Melzer’s iodine reagent, quadrate to rectangular, 2-3 um high x 2 um
broad. Ascospores brown, ellipsoid-inequilateral with broadly or narrowly rounded ends,
(8.5-) 9-11 (-12) x 4-5 um, the germ slits straight, spore-length.
Anamorph unknown.
SPECIMENS EXAMINED: Guanajuato, km 82 Guanajuato-Dolores Hidalgo road,
29.X1.1994, San Martin 5199G, on Quercus wood in oak forest (ITCV). Jalisco: Autlan
municipality, Cacoma Mountains near Agua Blanca, alt. 2297 m, 7.III.82, Nieves
Hernandez 56, on wood of ?Abies sp. (IBUG); Mazamitla municipality, Km 5 from
Manzanilla de la Paz to Mazamitla, 6.X.84, Guzman-Davalos 1729, on wood in pine-oak
forest (IBUG). Morelos, Cuernavaca municipality, La Pera curve, alt. 2255 m,
18.1X.1998, San Martin 4131M, 4141M & 5219M, on Quercus wood in oak forest
(FSM). Tamaulipas, Hidalgo municipality, ejido Conrado Castillo, 2.V.88, Lucrecia
Garcia 102, on Quercus sp. wood in a transitional area from pine to cloud forest (ITCV,
JDR); Llera municipality, ejido Loma Bonita, XI.87, S. Chacon 111, on Quercus sp.
wood in pine-oak forest (TCV, JDR). Veracruz, Banderilla municipality, La Martinica
ranch, alt. 1340 m, 7.1X.84, Guzman-Davalos 1421, on wood (IBUG).
ADDITIONAL SPECIMEN EXAMINED: Xylaria laevis Lloyd. Solomon Islands:
Russell Island, E. Cheel, Cat. # 12465 (BPI: TYPE).
NOTES: This taxon belongs to Xylaria cubensis complex. It differs from typical
X. cubensis in the slightly longer (average) ascospores with conspicuous germ slits, and
in being restricted to Quercus spp. wood.
The Mexican fungus was considered to be possibly X. laevis Lloyd by San Martin
and Rogers (1989), due the great resemblance of its hollow stromata with X. nigrescens
(Sacc.) Lloyd. Lloyd (1918) considered X. laevis a small-spored form of X. nigrescens.
Examination of type material, however, shows X. laevis to have ascospores with acute
ends, 7-8.5 (-9) um long which invariably bear a cellular appendage on one end, thus
differing from those described by San Martin and Rogers (1989).
Xylaria sp. aff. hypoxylon Bigs) Se 2602 iS
Stromata unbranched or branched, cylindric to irregular, terete to compressed, on ill-
or well-defined, tomentose stipes, with acute sterile apices, bearing conspicuous or
inconspicuous perithecial contours, 3.5-4 cm high x 2 mm broad; externally blackish
with white to brown peeling outer layer organized in longitudinal strips, internally white.
Texture hard. Surface roughened by the outer layer and ostioles. Perithecia 0.35-0.5 mm
diam. Ostioles slightly papillate to conical. Asci cylindrical, eight-spored, uniseriate to
obliquely uniseriate, 113-140 ym total length x 5.5-7 um broad, the spore-bearing part
65-75 um, the apical ring bluing in Melzer's iodine reagent, cubic, 2-2.5 um high x 2 um
broad. Ascospores brown to dark-brown, ellipsoid-inequilateral to navicular with narrow
to narrowly rounded ends, (9-) 9.5-11 (-12) x 4.5-5 um, the germ slits straight full spore-
length.
354
Colonies covering Petri dish in 4 wk, at first grayish-white, then gray and white with
ray-like growths and concentric rings, appressed. Reverse yellowish, the agar furrowed.
Stromatal primordia produced as hump-like growths in a concentric pattern, never
upright. Anamorphic structures not produced.
Figs. 25-28. Xylaria sp. aff. hypoxylon. 25: Stroma, | cm = 5S mm. 26: Stroma detail, |
cm = 5 mm. 27: Ascus apical ring, 1 mm = 0.3 ym. 28: Ascospores with straight germ
slits, 1 cm = 5.5 um.
355
SPECIMENS EXAMINED: Tamaulipas: Hidalgo municipality, ejido Conrado
Castillo, VII.88, Lucrecia Garcia 113 (CULTURED), on Quercus sp. wood in cloud
forest (ITCV); same data as above, Lucrecia Garcia 114, 115 & 120, on Quercus sp.
wood in cloud forest (ITCV).
NOTE: Mexican material has smaller ascospores than those of X. hypoxylon, i.e.
(9-) 9.5-11 (-12) x 4.5-5 um vs 12-16 x 5-6.5 um (teste Rogers, 1986) and cultures were
as those of Xylaria hypoxylon collected in the Pacific Northwest of United States of
America (Y.-M. Ju, unpublished data).
It is interesting to note that both stromata with conspicuous and inconspicuous
perithecial contours, can be found in the same collection.
Xylaria sp. aff. longiana Rehm, Ann. Mycol. 2: 175. 1904. Figs. 29, 30, 31, 32
The teleomorph is much like that described by San Martin and Rogers (1989) for
Xylaria cf. longiana Rehm. Stromata terete to flattened with white outer peeling layer
split in strips. Perithecia 0.2-0.3 mm diam. Asci 159-174 um total length x 6-7 um
broad, the spore-bearing part 82-89 um, the apical ring bluing in Melzer's iodine
reagent, quadrate to urn-shaped, 2-3 (-3.5) um high x 2-2.5 um broad. Ascospores
ellipsoid-inequilateral to navicular with narrow ends, (12-) 13-14.5 (-15) x 5-5.5um, the
germ slits straight spore-length or nearly so on concave side.
Anamorph unknown.
SPECIMEN EXAMINED: Jalisco, Tequila municipality, Km 20 Tequila-Cerro de
Tequila country road, 2800 m, 29.VIII.85, Guzman-Davalos 2561, on Quercus wood in
oak forest (IBUG).
NOTE: This fungus shares with X. longiana a habitat where oaks are a common
component of the flora and the same type of stromatal surface and ostioles, but differs in
its larger ascospores i. e. (12-) 13-14.5 (-15) um vs (9-) 9.5-12 um. It might be a new
taxon but unfortunately its anamorph is unknown.
Xylaria subcoccophora San Martin et Lavin sp. nov. Figs. 33, 34, 35, 36
Stromata cylindrici, tumulis peritheciorum inconspicuis vel conspicuis, apicibus
sterilibus longis vel brevis, stipites glabro, curtum, 1.5-3 cm longitudine tota x 2 mm
crassi, extus nigella cum externo strato albo delapso, intus albida. Textura satis dura.
Superficies laevis excipere tumulis peritheciorum et strato externo. Perithecia 0.3-0.6
mm diametro. Ostiola leniter papillata. Asci cylindrici, octospori, longi-stipitati, 127-178
um longitudine tota x 5-6 um crassi, partibus sporiferis 44-60 zm, annulo apicali in
liquore Melzeri cyanescente, quadrato, 2 x 2 wm. Ascosporae brunneae vel fuscae,
unicellulares, ellipsoideo inequilaterales vel naviculares cum extremum late rotundatis,
(9-) 10-11 (-11.5) x 4-5 um, rima germinativa recta leniter minus longitudinem sporae, in
latus concavus.
Status anamorphosis ignotus.
Stromata cylindrical bearing inconspicuous to conspicuous perithecial mounds, with
long or short acute sterile apices, on short, glabrous stipes, 1.5-3 cm total length x 2 mm
broad; externally blackish with a white peeling outer layer; internally white. Texture
fairly hard. Surface smooth except for perithecial contours and peeling layer. Perithecia
0.3-0.6 mm diam. Ostioles slightly papillate. Asci cylindrical, eight-spored, long-stipitate
127-178 um total length x 5-6 um broad, the spore-bearing part 44-60 pm, with apical
ring bluing in Melzer’s iodine reagent, quadrate, 2 x 2 um. Ascospores brown to dark-
356
brown, unicellular, ellipsoid-inequilateral to navicular with narrowly rounded ends, (9-)
10-11 (-11.5) x 4-5 pm, the straight germ slits less to nearly full spore-length, on
concave side.
Figs. 29-32. Xylaria sp. aff. longiana. 29: Stroma, 1 cm = 6 mm. 30: Stroma detail
showing the surface with remnants of a white outer layer, 1 cm = | mm. 31: Quadrate
apical ring, 1 mm = 0.5 um. 32: Ascospores with straight germ slits, 1 cm = 5.3 wm.
oot,
Anamorphic state unknown.
The specific uninomial of this taxon relates its less prominent perithecial mounds as
compared with typical X. coccophora Mont.
SPECIMENS EXAMINED: Tamaulipas: Gomez Farias municipality, 1.X1.1987,
ejido Alta Cima, S. Chacon-Jiménez 40, 42, 43, 44 &192, on Quercus sp. wood in cloud
forest (ITCV, FSM, JDR); Gémez Farias municipality, ejido Julilo, 13.VIII.1988, S.
Chacon-Jiménez 461, on Quercus wood in cloud forest (ITCV); G6mez Farias
municipality, 4.X.1992, San Martin 1506T, on Quercus sp. wood in cloud forest (FSM:
HOLOTYPE); Gomez Farias municipality, El Malacate, 13.VIII.1988, S. Chacon-
Jiménez 451, 458, 459 & 462 (ITCV); Gomez Farias municipality, El Cielo Biosphere
Reserve, 1100 m, S. Chacén-Jiménez 372, on Quercus sp. wood in cloud forest (ITCV,
JDR); Gomez Farias municipality, El Cielo Biosphere Reserve, 1065 m, S. Chacon-
Jiménez 450 & 453, on Quercus sp. wood in cloud forest (ITCV).
36
Figs. 33-36. Xylaria subcoccophora. 33: Stroma, 1 cm = 4 mm. 34: Stroma detail
showing conspicuous perithecial mounds, 1 cm = 0.7 mm. 35: Ascus apical ring, 1 mm =
0.35 um. 36: Ascospores, | cm = 0.8 pm.
358
NOTES: This species is reminiscent of X. coccophora Mont., but the latter has stromata
with conspicuous to almost free perithecial contours, a brown to yellow outer peeling
layer, ascospores brown to light-brown, ellipsoid to somewhat allantoid with rounded to
narrowly rounded ends, 10-11 (-13) x (3.5-) 4 (-4.5) um, and thrives in tropical rain
forests. The ascospore morphology of X. subcoccophora is like that of X. arbuscula
Sacc., but stromatal features of the latter are quite different (for discussion on Xylaria
arbuscula-apiculata complex see Candoussau, 1983 and San Martin, 1992).
Xylaria tumulosa San Martin, J. D. Rogers et Lavin sp. nov. Figs. 37, 38, 39, 40
Stromata non ramosa vel ramosa, cum rachidibus longa, laevi, peritheciis conspicuis
praedita, rachidibus extenda sursum et deorsum peritheciis, 6-16 cm longitudine tota x
1.5-2 mm crassa, extus nigella cum strato residuum brunneo; intus albida. Textura dura.
Superficies laevis vel aliquantum verrucosa cum tumulis peritheciorum et strata externa.
Perithecia 0.8-1 mm diam. Ostiola inconspicua vel leniter papillata. Asci cylindrici,
octospori, plumerumque uniseriate, stipitati, 116-212 um longitudine tota x 7-9 um
crassi, partibus sporiferis 112-136 um, annulo apicali in liquore Melzeri cyanescente,
rectangulari, 4.5-5.5 um alto x 2.5-3 um crasso. Ascosporae brunneae, ellipsoideo
inequilaterales vel naviculares apicibus angustatis (16.5-) 17-20 (-22) x (6-) 7-8 um, rima
germinativa abbreviata, in latere concavo praeditae.
Status anamorphosis ignotus.
Figs. 37-40. Xylaria tumulosa. 37: Stroma, 1 cm = 1.4 cm. 38: Stroma detail showing
almost naked perithecia, | cm = 0.8 mm. 39: Ascus apical ring, 1 mm = 1 pum. 40:
Ascospores, | cm = 7.5 um.
359
Stromata unbranched or branched above stipes, with smooth, long rachis that extends
upward as sterile apex and downward as stipe, bearing almost naked perithecia, 6-16 cm
total length x 1.5-2 mm broad; externally black with remnants of dark-brown outer layer,
internally white. Texture hard. Surface smooth to somewhat verrucose with perithecial
contours, papillae, and remnants of outer layer. Perithecia 0.8-1 mm diam. Ostioles
inconspicuous to slightly papillate. Asci cylindrical, eight-spored, with uniseriate spore
arrangement, stipitate, 166-211m total length x 7-9 um _ broad, the spore-bearing part
112-136 pm with apical ring bluing in Melzer's iodine reagent, rectangular, 4.5-5.5 wm
high x 2.5-3 ym broad. Ascospores brown, ellipsoid-inequilateral to navicular with
narrowly rounded ends, (16.5-) 17-20 (-22) x (6-) 7-8 ym, with straight germ slit slightly
less than spore-length, on concave side.
Anamorphic state unknown.
The specific name of the Mexican taxon alludes its prominent, almost free,
perithecial contours.
SPECIMENS EXAMINED: Chiapas, Jaltenango municipality, El Triunfo Hill,
8.VI.88, San Martin 630, 639, 646 & 666, on dicot wood in cloud forest with Quercus
skinneri Benth. (ITCV, JDR); Jaltenango municipality, El Triunfo Hill, 11.V1.88, San
Martin 821, on dicot wood in cloud forest with Quercus skinneri Benth. (ITCV:
HOLOTYPE; JDR: ISOTYPE); 891 on dicot wood in cloud forest with Quercus
skinneri Benth. (ITCV, JDR).
ADDITIONAL SPECIMEN EXAMINED: Xylaria chordaeformis Lloyd, Brazil,
Bahia, C. Torrend, Cat. # 10382 (BPI: TYPE).
NOTES: The gross morphology of Xylaria tumulosa is much like the type of X.
chordaeformis. The Mexican collection differs from X. chordaeformis in its smaller
ascospores, i.e. (16.5-) 17-20 (-22) x (6-) 7-8 wm vs (20-) 22-26.5 x (5-) 5.5-7 um, and
the straight ascospore germ slits instead sigmoid to spiral ones [see also description of X.
luxurians (Rehm) Lloyd in Dennis, 1956 and San Martin, 1992].
AKNOWLEDGEMENTS
San Martin and Lavin are very grateful to the Sistema Nacional de Investigadores de
México for providing stipends for conducting field and laboratory studies of Mexican
Ascomycetes. We thank Dr. John Krug, Dr. Rubén Duran and Dr. Anthony Whalley, for
reading the manuscript and reviewing the Latin diagnoses.
. LITERATURE CITED
Callan, B. E. and J. D. Rogers. 1990. Teleomorph-anamorph connections and
correlations in some Xylaria species. Mycotaxon 36: 343-369.
Candoussau, F. 1983. Récoltes de Xylaria du groupe arbuscula-apiculata dans le Sud
de la France et le Pays Basque espagnol. Cryptog. Mycol. 4: 173-178.
Chacko, R. J. and J. D. Rogers. 1981. Cultural characteristics of some species of
Xylaria. Mycologia 73: 415-428.
Cooke, M. C. 1883. On Xylaria and its allies. Grevillea 11: 81-94.
Critchfield, W. B. and E. L. Little. 1966. Geographic distribution of the pines of the
world. U. S. Dept. Agr. Forest Service. Misc. Publ. 991. Washington D. C. 97 p.
Dennis, R. W. G. 1956. Some xylarias of tropical America. Kew Bull. 1956: 401-444.
Dennis, R. W. G. 1961. Xylarioideae and Thamnomycetoideae of Congo. Bull. Jard.
Bot. Etat. 34: 231-241.
360
Holmgren, P. K., N. H. Holmgren and L. C. Barnett. 1990. Index herbariorum. Part I:
The herbaria of the world. The New York Botanical Garden. New York. 693 p.
Ju, Y.-M. and S.-S. Tzean. 1985. Investigation of Xylariaceae in Taiwan II. The
teleomorph of Xylaria. Trans. Mycol. Soc. Republ. China. 1: 103-128.
Kar, A. K. and S. K. Gupta. 1978. Xylariaceae of West Bengal I. Indian Phytopathol.31:
36-41.
Lloyd, C. G. 1918. Xylaria notes No. 1. Mycol. Writings 5: 1-16.
Lloyd, C. G. 1923. Mycological Notes No. 68. Mycol. Writings 7:1169-1184.
Penzig, O. and P. A. Saccardo. 1904. Icones fungorum javanicorum. E. J. Brill. Leiden.
124 p.
Rehm, H. 1901. Beitrage zur Pilzflora von Siidamerika. Hedwigia 40: 141-170.
Rehm, H. 1904. Ascomycetes americae borealis. Ann. Mycol. 9: 363-371.
Rogers, J. D. 1984. Xylaria acuta, Xylaria cornu-damae, and Xylaria mali in
continental United States. Mycologia 76:23-33.
Rogers, J. D. 1986. Provisional keys to Xylaria species in continental United States.
Mycotaxon 26: 85-97.
Rogers, J. D. and G. J. Samuels. 1986. Ascomycetes of New Zealand 8. Xylaria. New
Zealand J. Bot. 24: 615-650.
Rogers, J. D., B. E. Callan and G. J. Samuels. 1987. The Xylariaceae of the rain forest of
North Sulawesi. Mycotaxon 29: 113-172.
Rogers, J. D., Y.-M. Ju and D. E. Hemmes. 1997. Xylaria moelleroclavus sp. nov. and
its Moelleroclavus anamorphic state. Mycol. Res. 101: 345-348.
Rzedowski, J. 1978. La vegetacién de México. Ed. LIMUSA. México. 431 p.
Saccardo, P. A. 1906. Mycetes aliquot congoensis novi. Ann. Mycol. 4: 72-77.
San Martin, F. 1992. A mycofloristic and cultural study of the Xylariaceae of México.
Ph. D Thesis. Washington State University, Pullman, WA. USA.
San Martin, F. and J. D. Rogers. 1989. A preliminary account of Xylaria of México.
Mycotaxon 34: 283-373.
San Martin, F. and J. D. Rogers. 1993. Biscogniauxia and Camillea in México.
Mycotaxon 47: 229-258.
San Martin, F. and J. D. Rogers. 1995. Notas sobre la historia, relaciones de hospedante
y distribucién del género Xylaria (Pyrenomycetes, Sphaeriales) en México. Acta
Bot. Mex. 30: 21-40.
Zavala, F. 1990. Los encinos mexicanos: un recurso desaprovechado. Ciencia y
Desarrollo 16: 43-51.
MY COTAXON
Volume LXXIX, pp. 361-373 July-September 2001
NOTES ON HYPHOMYCETES. LXXXIV.
PSEUDOTRICHOCONIS AND RHEXODENTICULA, TWO NEW
MONOTYPIC GENERA WITH RHEXOLYTICALLY
DISARTICULATING CONIDIAL SEPARATING CELLS
WILLIAM A. BAKER, E. CHRISTOPHER PARTRIDGE
AND GARETH MORGAN-JONES
Department of Entomology and Plant Pathology, College of Agriculture,
Auburn University, Alabama 36849
ABSTRACT
Two new genera, Pseudotrichoconis and Rhexodenticula, are
established for the anamorphs previously classified as Trichoconis
echinophila and Nakataea cylindrospora, respectively. Both are redescribed
and illustrated, the latter from a recent collection made in Alabama. Generic
concepts are discussed with particular reference to peculiarities of denticulate
conidiophores and the precise nature of conidial detachment. Comparison is
made between these taxa and morphologically similar entities.
KEYWORDS: Dactylaria, Nakataea, Ochroconis, Scolecobasidium, generic
concepts.
INTRODUCTION
An unusual dematiaceous anamorph having rhexolytically
disarticulating conidial separating cells, collected recently on dead leaves of
water oak (Quercus nigra L.) in Chewacla State Park, Alabama, has been
identified as Nakataea cylindrospora Castafieda, Saikawa & Hennebert,
although it differs slightly in degree of conidium pigmentation from the type
description of that taxon (Castafieda et al., 1996). In the process of
determining its identity some question has arisen as to appropriate generic
circumscription and placement. In particular, the suitability of Nakataea Hara,
as typified by N. sigmoidea (Cav.) Hara, the anamorph of Leptosphaeria
362
salvinii Catt., for N. cylindrospora and somewhat similar entities has had to
be considered. This genus is characterized by possession of distinctly sigmoid
conidia and its type species is the causal organism of a serious stem rot
disease of rice (Oryza sativa L.). Since its inception, five additional species,
namely N. curvularioides G. Arnold, N. cylindrospora, N. fusispora
(Matsushima) Matsushima, N. rarissima Castafieda & Kendrick, and N.
serpens Shearer & Crane, have been added to Nakataea, but some reasonable
doubt can be raised concerning the appropriateness of the current
classification of several of these. Interestingly, in the description of WN.
rarissima (Castaneda and Kendrick, 1990), no mention is made of the
presence of a separating cell and the conidia, which are straight and narrowly
obclavate in shape, sometimes produce a secondary, downwardly-growing
conidium arising singly at an obtuse angle proximal to their denticulate base.
It seems unlikely that this taxon properly belongs in Nakataea. In the case of
N. cylindrospora also, as the specific epithet indicates, the conidia are
differently shaped from those typical of the genus and, moreover, are
verruculose. As in N. rarissima, the existence of a separating cell is not
mentioned in the original description of N. cylindrospora (Castafieda et al.,
loc. cit.), although it is apparent that one is present. All things being
considered, including the above-mentioned features and certain others, it
seems necessary to accommodate this species elsewhere. Accordingly, a new
generic name is established for it herein and it is redescribed and illustrated.
Further consideration of the status of N. rarissima must await critical
examination of its type.
During the course of reviewing alternative classification options for N.
cylindrospora, a somewhat similar anamorph, currently known as Trichoconis
echinophila (Massal.) de Hoog & van Oorschot, came to our attention. This
taxon, which has previously been variously classified in both Dactylaria
Sacc. and Scolecobasidium. E.V. Abbott, was placed in Trichoconis Clem.
because its rhexolytic method of conidial secession was said to strongly
suggest a relationship with the latter genus (de Hoog and van Oorschot,
1985). This entity, however, unlike species of Trichoconis which typically
overgrow other fungi biotrophic on leaves in the tropics, particularly
members of the orders Dothidiales and Meliolales, is known mainly from
decayed cupular spines of species of Castanea Mill. in Europe. In addition to
the ecological niche which it occupies 7. echinophila has certain other
peculiarities which lead us to believe that it remains unsatisfactorily
classified. An additional novel genus is therefore proposed in which to
accommodate it.
363
TAXONOMIC PART
Rhexodenticula W.A. Baker et Morgan-Jones gen. nov.
Coloniae effusae, pilosae, brunneae. Mycelium partim in substrato
immersum et partim superficiale, ex hyphis ramosis, septatis, pallide brunneis
vel brunneis, laevibus compositum. Conidiophora macronemata,
mononemata, singula vel caespitosa, simplicia, erecta, cylindrica, recta vel
flexuosa, sympodialia, septata, laevia, brunnea, apicem versus pallidiora, ex
cellulis globosis, atrobrunneis oriunda. Cellulae conidiogenae in
conidiophoris incorporatae, terminales vel raro intercalares, polyblasticae,
denticulatae. Cellula separans frangens, pars in conidiophoro persistens.
Conidia solitaria, sicca, acropleurogena, cylindrica, septata, verruculosa,
pallide brunnea, cellula media fuscata, ad apicem obtusa, ad basim fimbriata.
Species typica Rhexodenticula cylindrospora (R.F. Castafieda, Saikawa &
Hennebert) W.A. Baker & Morgan-Jones
Rhexodenticula W.A. Baker & Morgan-Jones gen. nov.
Colonies effuse, hairy, brown. Mycelium partly immersed in the
substrate, partly superficial, composed of branched, septate, pale brown to
brown, smooth hyphae. Conidiophores macronematous, mononematous,
solitary or caespitose, simple, erect, cylindrical, straight or somewhat
flexuous, sympodial, septate, smooth, brown, paler toward the apex, arising
from a small cluster of dark-brown, globose cells. Conidiogenous cells
integrated, terminal or rarely intercalary, polyblastic, denticulate. Separating
cell fracturing and remaining as a persistent peg-like extension. Conidia
solitary, dry, acropleurogenous, cylindrical, septate, verruculose, pale brown,
middle cells slightly darker, obtuse at the apex, with a narrow basal marginal
frill.
Etymology: Gr. rhexi, a break, rupture; et L. denticulatus, denticulate.
Rhexodenticula cylindrospora (R.F. Castafieda, Saikawa & Hennebert)
W.A. Baker & Morgan-Jones comb. nov. (Figure 1).
= Nakataea cylindrospora R.F. Castafieda, Saikawa &
Hennebert, Mycotaxon 59: 457, 1996.
Colonies effuse but mostly limited to the costal regions of the decaying
leaf, hypophyllous, hairy, olivaceous brown to dark brown or eventually
blackish, generally somewhat thin. Mycelium partly immersed in the
substrate, partly superficial, composed of branched, septate, pale brown to
364
brown, smooth, 1-2um hyphae. Conidiophores macronematous,
mononematous, solitary or gregarious in caespitose clusters of two or three,
simple, erect, cylindrical, occasionally with a nodose swelling toward the
middle, straight or somewhat flexuous, sympodial, with the distal portion
sometimes becoming very slightly geniculate, septate, smooth, brown,
somewhat paler toward the extreme apex, up to 110um long, 3.5-5.5.m wide,
moderately bulbous and 8-1 1m wide at the base, arising from a small cluster
of tightly-packed, more or less globose, 8-14zm wide cells. Conidiogenous
cells integrated, terminal, or rarely with the intercalary, immediately
subterminal cell bearing one or two conidiogenous loci, polyblastic,
denticulate; each denticle cylindrical, 1-2:zm long, comparatively thin-walled,
and cut off by a septum to form a separating cell which fractures at its middle
in a circumsissile fashion and remains as a persistent, peg-like extension.
Conidia solitary, dry, acropleurogenous, cylindrical, three-septate, rarely one-
or two-septate, with the septa more or less evenly placed, verruculose, pale
brown, with the two middle cells very slightly darker, obtuse at the apex,
bearing a narrow, basal, vestigial, marginal frill derived from the upper
portion of the rhexolytically split separating cell, 13-21 x 4-5um in size.
On decaying leaves of Nectandra antillana C.F.W. Meissn., and
Quercus nigra L.; Cuba and North America.
Collection examined: on Q. nigra, Chewacla State Park, Lee Co.,
Alabama, U.S.A., 13 September 2000, W.A. Baker, AUA.
In all essential characteristics the Alabama specimen of this species
matches the type description. However, judging from the original account of
its characteristics, some small differences apparently exist between it and the
type material collected in Cuba. These include having narrower, more slender
conidiophores, which generally bear fewer conidiogenous loci, arising from
globose cells which are appreciably smaller than those present in the Cuban
material. The conidial dimensions and coloration of the respective specimens
also differ somewhat. The extent of the contrast between the two central cells
and the end cells, in terms of degree of pigmentation, is less pronounced in
the collection reported upon herein. In the type description the central cells
are described as being brown and the end cells subhyaline or pale brown
whereas in our material the conidia are almost uniformly pale brown with the
central cells becoming only barely darker upon maturation. We have little
doubt, however, that the Alabama material represents the second collection
ever made of this anamorph.
365
#2
a,
14)
;
Pietra’
‘ro a
Sate
oy
*
eh rien
* «
att
FIGURE 1. Rhexodenticula cylindrospora. Conidiophores and conidia.
366
A number of unrelated Hyphomycete genera, including such entities as
Brachysporium Sacc., Camposporium Harkness, Nakataea, Pyricularia Sacc.,
and Trichoconis, all share the common feature of having conidial separating
cells. In reaching the decision to establish a new genus in which to
accommodate N. cylindrospora consideration has been given to a number of
significant differences between it and N. sigmoidea, the type species. These
are of a comparable dimension to those which separate Nakataea from
Pyricularia. Although broadly similar in morphology, the conidiophores of
N. sigmoidea have a different look in being somewhat more flexuous and in
having widely scattered conidiogenous loci along a greater length, including
a number in intercalary positions, usually on several subtending conidiophore
cells. Moreover, each conidiophore bears comparatively few such loci, as
compared to the condition seen in N. cylindrospora, where loci are numerous,
crowded, and located mostly on the terminal cell. Added to this is the
considerable difference in the shape of the conidia and, in the case of N.
sigmoidea, lack of any surface ornamentation. The plant-pathogenic nature
of N. sigmoidea and the fact that it produces moderately-sized sclerotia are
additional points of distinction.
As alluded to above, it is of some interest that the presence of
separating cells were not mentioned in several type descriptions of Nakataea
species. These are, admittedly, not always easily discernible. In particular, the
narrow septum which delimits the separating cell from the remainder of the
conidiophore is often difficult to observe, especially when it is displaced
laterally. Where terminal at the extreme conidiogenous cell apex, with the
conidium remaining attached, this septum is much more readily apparent.
Matsushima (1975) named and described Scolecobasidium
longiphorum Matsushima, an anamorph isolated from insect frass on dead
leaves of Quercus sp. in Japan which appears to be close, if not identical to,
N. cylindrospora. Since the type description was based on the morphological
expression extant in axenic in vitro culture it is difficult, however, to
determine if this is indeed the same fungus. The conidial shape, pigmentation,
although with all cells evenly-colored, septation, surface ornamentation, and
size are comparable. Moreover, the conidia are similarly fimbriate at the base
and from the illustration provided there is indication of the presence of a
separating cell, although this is not mentioned in the species diagnosis. The
conidiophores, in contrast to those of N. cylindrospora, are extremely long
and narrow with conidiogenous loci spread along almost their entire length
and occurring on numerous intercalary cells. It is uncertain if these
conidiophore characteristics are merely a cultural, phenotypic expression. The
identity of this taxon must, for the time being at least, remain in doubt. Since
367
it appears to have conidial separating cells, it clearly does not belong in
Scolecobasidium nor, for that matter, in the segregate genus Ochroconis De
Hoog & Arx. Whether or not it is the same anamorph as that described herein
or is, perhaps, a second species of Rhexodenticula must await further
consideration.
Pseudotrichoconis W.A. Baker et Morgan-Jones gen. nov.
Coloniae effusae, densae, pulveraceae, albidae vel roseae. Mycelium
plerumque superficiale vel partim immersum, ex hyphis ramosis, septatis,
subhyalinis vel pallide brunneis, laevibus compositum. Hyphae capitatae,
erectae, septatae, praeditum, ex lateribus et terminalibus hypharum oriunda.
Conidiophora macronemata, mononemata, singula, simplicia, erecta,
cylindrica, ad apicem attenuata, recta vel flexuosa, sympodiala, septata,
laevia, parietibus tenuibus, subhyalina vel pallide brunnea. Cellulae
conidiogenae in conidiophoris incorporatae, terminales vel intercalares,
polyblasticae, denticulatae. Cellula separans fragens, pars in conidiophoro
persistens. Conidia solitaria, sicca, acropleurogena, cylindrica, septata,
verruculosa, subhyalina, ad apicem obtusa, ad basim attenuata, fimbriata.
Species typica Pseudotrichoconis echinophila (C. Massal.) W.A. Baker &
Morgan-Jones
Pseudotrichoconis W.A. Baker & Morgan-Jones gen. nov.
Colonies effuse, dense, powdery, white to pinkish-white. Mycelium
mostly superficial, often partly immersed, composed of branched, septate,
hyaline to pale brown, smooth hyphae. Prostrate hyphae occasionally
interweaving and somewhat rope-like. Sterile capitate hyphae present,
originating laterally or terminally from repent hyphae, ascending, erect, more
or less straight, septate, cylindrical, clavate, subglobose, or ellipsoid at the
apex. Conidiophores macronematous, mononematous, single, occasionally
arising in close proximity to one another and loosely intertwined, simple,
erect, cylindrical, attenuated slightly toward the apex, erect, straight to
slightly flexuous, sympodial, septate, smooth, thin-walled, subhyaline to pale
brown. Conidiogenous cells integrated, terminal or intercalary, polyblastic,
denticulate. Separating cell fracturing and remaining as a persistent peg-like
extension. Conidia solitary, dry, acropleurogenous, cylindrical to narrowly
clavate, septate, minutely verruculose, subhyaline to very pale brown when
mature, obtuse at the apex, attenuated at the base with a narrow marginal frill.
Etymology: Gr. pseudo, false; et Trichoconis.
368
Pseudotrichoconis echinophila (C. Massal.) W.A. Baker & Morgan-
Jones comb. nov. (Figure 2).
= Dactylaria echinophila C. Massal., Atti R. Ist. Ven. Sci.,
Lett., Arti 59:685, 1900.
= Scolecobasidium echinophilum (C. Massal.) B. Sutton, Trans.
Brit. myco. Soc. 61:424, 1973.
= Trichoconis echinophila (C. Massal.) de Hoog & Oorschot,
Stud. Mycol. 26:107, 1985.
Colonies effuse, spreading widely over the substrate, generally
somewhat dense, powdery, white to pinkish-white. Mycelium mostly
superficial or, less often, partly immersed in the substratum, composed of
irregularly branched, septate, hyaline to subhyaline to pale brown, smooth,
cylindrical, 2.5-4um wide hyphae. Prostrate hyphae occasionally
interweaving and somewhat rope-like. Sterile capitate hyphae present
originating laterally or terminally from repent hyphae, ascending, erect, more
or less straight, septate, cylindrical, clavate, subglobose, or ellipsoid at the
apex, sometimes slightly bulbous at the base, up to 5Oum long, 3-4.5um wide
at the inflated, clavate, subglobose, or ellipsoid apex. Conidiophores
macronematous, mononematous, single, occasionally arising in close
proximity to one another and loosely intertwined, sometimes alternating with
capitate hyphae as lateral extensions of the prostrate hyphae, simple, erect,
cylindrical, attenuated slightly toward the apex, straight to slightly flexuous,
sympodial, septate, smooth, thin-walled, subhyaline to pale brown, up to
60um long, 3.5-5um wide, up to 64m wide at the base. Conidiogenous cells
integrated, terminal or intercalary, polyblastic, denticulate; each denticle
cylindrical, thin-walled, and cut off by a septum to form a separating cell
which fractures at its middle in a circumsissile fashion and remains as a
persistent, peg-like extension. Conidia solitary, dry, acropleurogenous,
cylindrical to narrowly clavate, septate, minutely verruculose, subhyaline to
very pale brown, obtuse at the apex, attenuated at the base with a narrow
marginal frill derived from the upper portion of the rhexolytically split
separating cell, 9-32 x 3.5-Sum in size.
On decaying seeds, cupules, and cupular spines of Castanea sativa
Mill. and twigs of Quercus robur L.; Europe.
Collections examined: on C. sativa, Esher Common, Surrey, U.K., 17
September 1972, B.C. Sutton (IMI 168988); on C. sativa, Oxshott Heath,
369
. Te orgs ‘ Cues ) a
FIGURE aL ATE echinophila. Conidiophores and conidia.
370
Surrey, U.K., 8 October, 1972, B.C. Sutton (IMI 169715); on C. sativa,
Underriver, Kent, U.K., 20 November 1972, B.C. Sutton (IMI 170818); on C.
sativa, Maresfield, Ashdown Forest, Sussex, U.K., 20 November 1972, B.C.
Sutton (IMI 170859); on C. sativa, Wimbledon Common, London, U.K., 3
December 1972, B.C. Sutton (IMI 171186). |
A number of factors have, apparently, contributed to some
misunderstanding about the true identity and distinctiveness of this anamorph.
Von Arx (1970) illustrated what appears to be this species under the name
Dactylaria purpurella (Sacc.) Sacc. and some confusion between the two
evidently continued (Matsushima, 1975; 1983) for some time thereafter.
Perhaps the ambivalence existing in the literature concerning the Dactylaria
Sacc. generic concept and lack of adequate documentation of the essential
characteristics of its type species, D. purpurella, was, in part at least,
responsible for this. As Bhatt and Kendrick (1968) noted, the understanding
of Dactylaria depended upon interpretation of the inadequate holotype
material of D. purpurella [= Acrothecium purpurella Sacc.|. Sutton (1973)
provided what can be considered the first definitive account of Dactylaria
echinophila based on a number of collections made by him in England [see
above].
This taxon had originally been described from material occurring on
Castanea sativa [as Castanea vesca Gaertn.] in Italy (Massalongo, 1900).
Although the type material appears to be lost, since none is extant in the
herbarium at Istituto Orto Botanico dell’Universita, Padova [PAD], the
original description provided was considered by Sutton (loc. cit.) to be
sufficiently adequate for purposes of establishing the identity of his
specimens. In spite of being brief, Massalongo’s account of this entity
included mention of such hallmark features as the white, powdery colonies,
the presence of repent, sterile, interwoven hyphae, and possession of simple,
septate conidiophores and cylindrical-fusoid, hyaline conidia formed from
denticles. The dimensions of these structures noted in the type description
more or less matched those in the English collections. In the absence of a type
specimen, Sutton (loc. cit.) expressed the view that the name Dactylaria
echinophila should, ideally, be neotypified by collection of material from the
same substrate and locality but this has not, to our knowledge, been
accomplished.
In the process of determining whether or not this anamorph was
satisfactorily classified in Dactylaria, Sutton (loc. cit.) examined a type slide
of D. purpurella and concluded that conidia of that species possess a basal
scar but no frill. Bhatt and Kendrick (loc. cit.) had earlier made a similar
371
observation, following examination of the same slide, that the conidia taper
toward a narrow flat basal scar and that the conidiophores bear conspicuous,
flat-topped denticles clustered closely in the apical region. Photographic
illustration by the latter authors clearly indicate these characteristics.
Interestingly, Saccardo’s original illustration (Saccardo, 1877) shows the
same features. Based on the concept of Dactylaria clarified by Bhatt and
Kendrick (loc. cit.), Sutton (loc. cit.) reached the decision that D. echinophila
could not be included in that genus and, accordingly, transferred this species
to Scolecobasidium. In so doing, particular attention was paid to the fact that
conidia of the latter genus are detached by a break in the wall of the denticles
upon which they are born, leaving a part attached to the conidium as a basal
frill and part to the conidiogenous cell (Barron and Busch, 1962; Ellis, 1971).
The determination that D. echinophila was better placed in Scolecobasidium
was, however, qualified with an opinion to the effect that it might be
necessary in the future to classify it into a separate genus because of the
presence of sterile capitate hyphae, lack of pigmentation and the wide
variation in conidial shape and ornamentation among species of
Scolecobasidium as circumscribed by Ellis (loc. cit.).
This anamorph cannot, however, be satisfactorily classified in
Scolecobasidium because of the absence of a conidial separating cell in that
genus. The disparity in conidium shape within it was recognized by de Hoog
and von Arx (1973), who established the segregate genus Ochroconis for
those species with ellipsoid, clavate, or fusiform conidia, while use of the
older generic name was restricted to species with trilobate conidia. Although
some species of Ochroconis are broadly similar to Pseudotrichoconis
echinophila they all differ by lacking conidial separating cells. It should be
added, incidentally, that some doubt must be raised as to the homogeneity of
Ochroconis as originally conceived since the conidia of its type species, O.
constricta (Abbott) de Hoog & Arx, bear a basal frill, indicating rhexolytic
detachment, whereas other species accommodated within it lack such a
feature, which may indicate a Dactylaria-like schizolytic mode of
detachment. In light of this, a review of the genus is surely needed.
Matsushima (1975) described and illustrated what appears to be
Pseudotrichoconis echinophila {as Dactylaria echinophila], based on a
collection made on decaying bark of Acer sp. in Japan. No capitate hyphae
were observed, however. He was, presumably, unaware of Sutton’s
contribution to our knowledge of this anamorph. Curiously, both Sutton (loc.
cit.) and Matsushima (1975) illustrate the conidiophore-borne denticles as
separating cells (a septum is shown delimiting the denticle remnant from the
conidiophore venter following conidial secession) but make no mention of
3/2
such in their respective descriptions of this entity. Matsushima (1983)
continued to use the name Dactylaria echinophila and applied it to three
further collections isolated from diverse substrates and localities (rotten cacao
fruits, Ponape; dead leaves of Taxus canadensis Marsh., and-basidiocarp of
Ganoderma tsugae Murrill, Canada). From his description and illustrations —
it seems unlikely, however, that these were correctly identified. In each case,
conidiophore denticles are shown with the closed, flat-topped extremity
typical of Dactylaria. In a note following the species description the author
stated that it is close to D. purpurella and added that a difficulty lies in the
presence of what were referred to as intermediate strains between these two
entities. It is evident that these two taxa were being confused and that the
collections reported in Matsushima’s 1983 publication were not P.
echinophila but rather D. purpurella. The smooth conidium walls and the
absence of a separating cell, as evidenced by lack of a basal frill on the
conidia, should have indicated the true identity of the Ponape and Canada
collections.
De Hoog and van Oorschot (loc. cit.) briefly described and illustrated
P. echinophila in their check-list of epithets in the Dactylaria and
Arthrobotrys Corda complexes. Specimens examined included in vivo and in
vitro material from Quercus robur L. twig and Picea A. Dietr. needle [both
without collection origin details] and a collection on Castanea sativa nut
housed at IMI [without collection particulars, but not one cited by Sutton].
The authors noted that conidium secession in this species is clearly rhexolytic
and this, as alluded to in the introduction above, led to a decision to reclassify
it in Trichoconis. In their protolog it is mentioned that the illustration
purported to be of D. purpurella published by von Arx (loc. cit.), and that of
D. purpurella published by Ellis (loc. cit.), fit that given by Matsushima
(1983) for D. echinophila. The present authors agree with this opinion, again
indicating that Matsushima had D. purpurella and not D. echinophila, unlike
the situation previously (Matsushima, 1975) where he apparently had the
latter. It should be added that the von Arx illustration, which is believed to
be of D. echinophila rather than D. purpurella, failed to depict the true nature
of the denticles.
The rationale for reclassifying D. echinophila in Trichoconis (de Hoog
and van Oorschot, loc. cit.) can be understood but it is highly doubtful that
this entity belongs in that genus. Although sharing the common characteristic
of having conidial separating cells there are some significant differences that
should be considered. The conidia of the type and other species of
Trichoconis are fusiform to obclavate in shape and smooth-walled. Moreover,
the separating cells of most species are long cylindric and the conidia entirely
373
hyaline. An additional difference is the presence of sterile, capitate hyphae
in P. echinophila, a feature not noted by de Hoog and van Oorschot (loc. cit.).
As mentioned by Sutton (loc. cit.) possession of such structures has
traditionally been considered to be of some taxonomic significance, as is the
case, for example, in typifying such Hyphomycete genera as
Cylindrocladiella Boesew. and Cylindrocladium Morgan. The fact that
almost all true species of Trichoconis occur as foliicolous hyperparasites on
such Ascomycete genera as Asterina Lév., Balladyna Racib., Irenopsis F.
Stevens, Meliola Fr., and Schiffnerula Hohn., is an additional point of
distinction. The type species, 7. caudata (Appel & Strunk) Clements, is an
exception, overgrowing as it does Lasiodiplodia theobromae (Pat.) Griff. &
Maubl. on diseased pods of Theobroma cacao L. For all these reasons, there
can be little doubt that P. echinophila needs to be segregated in a genus of its
own.
ACKNOWLEDGMENTS
We are most grateful to Dr. John C. David, IMI Herbarium, CABI
Bioscience UK Centre, Egham, United Kingdom, for making available on
loan some of the specimens on which this study was based. Dr. J. Leland
Crane, Illinois Natural History Survey, Champaign, Illinois, is thanked for
providing a pre-publication review of the manuscript.
LITERATURE CITED
BARRON, G.L. and L.V. BUSCH. 1962. Studies on the soil Hyphomycete Scolecobasidium. Can.
J. Bot. 40:77-84.
BHATT, G.C. and W. B. KENDRICK. 1968. The generic concepts of Diplorhinotrichum and
Dactylaria, and a new species of Dactylaria from soil. Can. J. Bot. 46:1253-1257.
CASTANEDA RUIZ, R.F., M. SAIKAWA and G.L. HENNEBERT. 1996. Some new conidial
fungi from Cuba. Mycotaxon 59:453-460.
CASTANEDA RUIZ, R.F. and B. KENDRICK. 1990. Conidial fungi form Cuba:II. Univ.
Waterloo Biol. Ser. 33:1-61.
DE HOOG, G.S. and C.A.N. VAN OORSCHOT. 1985. Taxonomy of the Dactylaria complex,
VI. Key to the genera and check-list of epithets. Stud. Mycol. 26:97-121.
ELLIS, M.B. 1971. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute. 608pp.
MASSALONGO, C. 1900. De nonnullis speciebus novis Micromycetum agri veronensis. A/ti R.
Ist. Veneto Sci., Lett. Arti. 59:683-690.
MATSUSHIMA, T. 1983. Matsushima Mycological Memoirs No. 3: 1-89.
MATSUSHIMA, T. 1975. Icones microfungorum a Matsushima lectorum. Published by the
author. Kobe. 209pp.
SACCARDO, P.A. 1877. Fungi Italici autographice delineati. Michelia 1:73-100.
SUTTON, B.C. 1973. Some Hyphomycetes with holoblastic sympodial conidiogenous cells.
Trans. Br. mycol. Soc. 61:417-429.
VON ARX, J.A. 1970. The genera of fungi sporulating in pure culture 1 Ed., J. Cramer, Lehre.
288pp.
"
A)
| 4 '
< On
i ibs Y
t J
pst 14 Lab ann,
* 4 sfPas
lg, ' »
. af | Was
at
arg ay,
{ Bad! fi
& °
’ er is
ae ; i
Ped, iva D : P Mm! Fa ”
zh ATLAS , ; epg OO Oa aks. Be:
hy Ge ed j an Pe ea Viet ak) ratios + Cp omiale 4 ar Pere
Wee y ; r 7 7" i a)
T/ ee - an : Prerey oy
Ay } ee . uf 4 day
i) ’ ne that | / eifba ¢ f
“hi Tt we eA) : uy fe i
in im i
, AY nr i 4)
3) CR a 7
Hee te Ne en | een es) VST
fe) eet f ‘ 4 7 ‘
“ga ae sstannaetatie
To
RL ae | wAegatelhiy | ere ms
eee: ees ays te RRR,
oN ae hak: agent LR ANMIOAL, Ree ns ee ety ye
Ki Ry he ier a ALA tadeantra Reames ACsephugr ena ena oth Shes: es
| civpdioanmangr acetal i, AU Saad postr StI; ads aasteiieeet Meas
snag vi snes oma apae ein se ey SALES
‘ae pare athe Nea VAR valet ot anh 4 i eth men ¢ “it iM .
A
y Date \ eit he Re baer, M i Ast ig 4 rs Ae
eae RG a whe Us Vk tad cat ie ener trial ocd ay ‘ete Tae Pete cit chin ce ey
~ bs : V . : ptt
DD er Mae see au pay, yi BANE ng i Tdi shea Ame sis oe 13 co |
4 ‘ i oe he it ot 1 {\ ; ; é eh Pi Vy 4
ys } th ¥ i
rey A i sche ae K ake Moot t ‘ ni ie it ay ecg a
yal ean aera: ui Onl! call Lahtpectty ah ea ey be ait
wan pall Wiles Ol Ns oe vats wy ite pie) f justi ee a My eu HOO, aot ty pit a ‘an wie x
ahi beat i gia TE alts Sean NN maith ea bale arian th Pages ilk ant Te 7
. Hy bacanieh wey l devine a sine ane we oe is eat onepaeshes bad tid eer NA
ener tie rr Cueto ray ine ART y Suen io
MU Ch wert” a at i forest Bebe has epg AAR
ry AN Arce int (5 | ; wy F ins he alt wins bi Drea ets FOR Fi Bs duaieit +h Pe Tha’ rN
ea hip ithe wna bela Kt iia au igh ® Ay jf ie Ai Li, 3a ih pee sae
4
a -
f
Wig
LLVs te ay ae
an ny
tJ P
ud
was
a=
Meg
COAT AS
t,o. are
; Het: A ee ee Le ue) penn ve - ath Hay a Aa ‘ ahve worettts fe a we hiv
} ri i vy Kis Ge Mi ha Pet! Nee AYE Ava pall bats? ner rear! erty
aie i Bi so he 5 HGH MP. Se he Wb iebids ae of t as tit
\ ie , y ]
dues ele pies sibkcin t why Pee kay ; ‘
_ HRA Ra OES the OURS ae aia
a ae oa mh aay: Wit vie tue: vale Re ek wale ment
ee Mm led Cehpte ; Ai ve
‘ hd " Bit r pe ie / it
yom ht
AUPAS
; OK rf
ey,
- } } ven vt mR wi my a : mA) per nm - any ; 4
Raa pete i a BAR nite decentiva nnn ie Slashes ee ana abAE. 1
RR laa nA URI a ew ’ es: ce
1 hat a) Ve ke b, .
aart a eee al vi : ore ‘SL f PAE ol
VJ , . an i
4 pW 7 ‘o ane :
MYCOTAXON
Volume LXXIX, pp. 375-381 July-September 2001
A LIST OF DISCOMYCETES IN CHINA. SUPPLEMENT I °
CF RS Be aS, BE—)
WEN-YING ZHUANG
Systematic Mycology and Lichenology Laboratory
Institute of Microbiology, Chinese Academy of Sciences, Beijing 100080, China
Abstract: This is the continuation of “A list of discomycetes in China” published in 1998. Cup-
fungi recorded from China afterwards are added. Corrections and errata for names in the previous
list are provided.
Key words: Addition, name change, errata.
This is a supplementary list to the previous records of Chinese discomycetes
(Zhuang, 1998a). Scientific name, Chinese name, and the related reference(s) are
provided for each newly added taxon. Changes for several names in the previous list
are made according to current taxonomic treatments. Mistakes in spellings are
corrected in errata.
SUPPLEMENTARY LIST — I
Acervus cf. flavidus (Berk. & M.A. Curtis in Berk.) Pfister (@FR) #/) 7H
(Zhuang & Wang 1998)
Acervus xishuangbannicus W.Y. Zhuang & Z. Wang }KAN/) fast (Zhuang &
Wang 1998)
Albotricha cf. albotestacea (Desm.) Raitv. (G8) AstA BH (Zhuang 1998b)
Albotricha changbaiensis W.Y. Zhuang & Z.H. Yu KA AEH (Yu et al. 2000)
Albotricha guangxiensis W.Y. Zhuang J 4 A3#t (Zhuang 1998b)
Albotricha kurilensis Raitv. #51 A674 (Zhuang 2000b)
Albotricha minuta Raitv. ’)\ HE (Yu et al. 2000)
Arachnopeziza aurata Fuckel 4:4 tt (Zhuang 1998b)
Ascobolus amoenus Oudem. =-2&8%t 1 (Wang 1999)
Ascobolus fushanus Y.Z. Wang #8 \l|2#i fi (Wang & Brummelen 1997)
Aurophora dochmia (Berk. & M.A. Curtis) Rifai H-#$ fj (Zhuang & Wang 1998)
Bifusella camelliae C.L. Hou #7) URE (Hou, 1999)
* Supported by the National Natural Science Foundation of China and Foundation of the Knowledge Innovation
Program of the Chinese Academy of Sciences.
376
Cheilymenia elaphorum (Rehm) W.Y. Zhuang & Z. Wang REA RIF (Zhuang &
Wang 1998)
Cistella geelmuydenii Nannf. 7& Fe’) 324i (Yu et al. 2000)
Coccomyces circinatus Y.R. Lin & C.T. Xiang 42210142 (Lin et al. 2000)
Coccomyces crateriformis Y.R. Lin & Z.Z. Li MAKI A (Lin et al. 2000)
Coccomyces cyclobalanopsis R.R. Lin & Z.Z. Li 77 38 (Lin et al. 2000a)
Coccomyces dimorphus X.W. Liang, X.Y. Tang & Y.R. Lin HEAR (Liang et al.
2000)
Coccomyces fujianensis R.R. Lin & C.T. Xiang #4214348 fe] (Lin et al. 2000a)
Coccomyces huangshanensis Y.R. Lin & Z.Z. Li Se LUA el (Lin et al. 2000b)
Coccomyces leptideus (Fr. : Fr.) Erikss. 7)i28 4 (Lin et al. 2000b)
Coccomyces limitatus (Berk. & M.A. Curtis) Sacc. Ai (Lin et al. 2000b)
Coccomyces magnus Y.R. Lin & Z.Z. Li KitiZ fs (Lin et al. 2000b)
Coccomyces multangularis Y.R. Lin & Z.Z. Li & AAA i (Lin et al. 2001)
Coccomyces radiatus Sherw. #854 (Ki 38 fA (Lin et al. 2001)
Coccomyces sinensis Y.R. Lin & Z.Z. Li PEA be (Lin et al. 2001)
Coccomyces symploci Y.R. Lin & Z.Z. Li Wis be (Lin et al. 2001)
Coprotus lacteus (Cooke & W. Phillips) Kimbr., Luck-Allen & Cain $L28@R#t HH
(Zhuang & Wang 1998)
Dasyscyphella dryina (P. Karst.) Raitv. #/))\E4] fe (Yu et al. 2000)
Dicephalospora damingshanica W.Y. Zhuang *KA8 Wj — kf et ks (Zhuang 1999b)
Dicephalospora pinglongshanica W.Y. Zhuang *77¢,1l) —*4 fet (Zhuang 1999b)
Encoelia dalongshanica W.Y. Zhuang KVL AAA (Zhuang 1999a)
Encoelia taxonomic sp. (Zhuang 1999a)
Hamatocanthoscypha uncipila Huhtinen £4=E£4 %l| G4 fi) (Yu et al. 2000)
Holwaya mucida (Schulzer) Korf & Abawi subsp. nipponica Korf & Abawi ##K
ft bal A ASAP (Yu et al. 2000)
Hydnotrya cubispora (E.A. Bessey & B.E. Thompson) Gilkey Af (Xu
2000b)
Hymenoscyphus lutescens (Hedw.: Fr.) W. Phillips = FR#t EA (Yu et al. 2000)
Hymenoscyphus taxonomic sp. #1 (Yu et al. 2000)
Hymenoscyphus taxonomic sp. #2 (Yu et al. 2000)
Lachnum albidulum (Penz. & Sacc.) M.P. Sharma HELE Fi Re (Wu 1998)
Lachnum cf. apalum var. beatonii Spooner (#4 FR) AEH EE RGAE FH (Zhuang
1998b)
Lachnum cf. brevipilosum Baral & Krieglst. #224124 (Baral & Krieglsteiner
1985; Zhuang & Wang 1998 as Lachnum legalii, superfluous)
Lachnum carneolum (Sacc.) Rehm Af *i-EEt I (Zhuang & Hyde 2001b)
Lachnum cylindricum W.Y. Zhuang & K.D. Hyde *Ef HIBS (Zhuang & Hyde
2001b)
Lachnum granulatum W.Y. Zhuang, Yanna & K.D. Hyde #122 Ki-E 4 (Zhuang &
Hyde 2001b)
Sd,
Lachnum cf. euterpes Cantrell & JH. Haines (828) SRATALEEL ER (Zhuang &
Wang 1998)
Lachnum lunatum W.Y. Zhuang & Spooner #f H ALEE EA (Zhuang 2000b)
Lachnum cf. nudipes (Fuckel) Sacc. var. minor Spooner (288) #UNLFE HE ra)
#4 (HMAS specimen)
Lachnum oncospermatum (Berk. & Broome) M.L. Wu & J.H. Haines #4K HL 4 A
(Wu et al. 1998)
Lachnum palmae (Kanouse) Spooner *x HAE HAE HE (Frohlich 1997)
Lachnum cf. pteridophyllum (Rodway) Spooner fix} ft Al (Wu et al. 1998,
Zhuang & Wang 1998)
Lachnum cf. salicariae (Rehm) Raitv. (28) - HRSeAIFEHE A (Yu et al. 2000)
Lachnum subpygmaem W.Y. Zhuang WAR HAGEL (Zhuang 1998b)
Lachnum taiwanense J.H. Haines, M.L. Wu & Y.Z. Wang GYSAiSEGtE (Wu et al.
1998)
Lachnum willisii (G.W. Beaton) Spooner RK FGHiAE ti (Zhuang 1998b)
Lachnum taxonomic sp. #1 (Zhuang 1998b)
Lachnum taxonomic sp. #2 (Zhuang 1998b)
Lambertella caudatoides W.Y. Zhuang 2 f={H Fit (Zhuang 1999b)
Lanzia guangxiensis W.Y. Zhuang ) fa} fife (Zhuang 1999a)
Lanzia sinensis W.Y. Zhuang [l= rake (Zhuang 1999a)
Lasiobelonium guangxiense W.Y. Zhuang | PUth=24i I (Zhuang 1998b)
Lasiobelonium ningxiaense W.Y. Zhuang & Spooner 724i (Zhuang 2000b)
Lophodermium dicranopteris Y.R. Lin, Y.H. Liu & Z. Li TeHEALHESE (Liu et al.
1995)
Microglossum viride (Pers.: Fr.) Gill. 2¢/)\#f fl CHMAS specimen)
Neococcomyces R.Y. Lin, C.T. Xiang & Z.Z. Li #138 fel) (Lin et al. 1999)
Neococcomyces rhododendri R.Y. Lin, C.T. Xiang & Z.Z. Li #4 (Lin et al.
1999)
Octospora yunnanica W.Y. Zhuang & Z. Wang zMH/\fatt (Zhuang & Wang
1998)
Orbilia delicatula (P. Karst.) P. Karst. “A al tt fe (Wu 1998)
Orbilia sarraziniana Henn. (fi \E) Ft (Zhuang & Hyde 2001a)
Pachyella babingtonii (Berk. & Broome) Boud. ELEG)/# ait (Zhuang & Wang
1998)
Parachnopeziza bambusae Arendholz & R. Sharma {JiUTVRE fA (Zhuang 1999a)
Parachnopeziza guangxiensis W.Y. Zhuang & Korf ) Paitweat i (Zhuang 1998b)
Parachnopeziza variabilis W.Y. Zhuang & K.D. Hyde 47 iT WKF fl (Zhuang &
Hyde 2001a)
Parachnopeziza sinensis W.Y. Zhuang & Korf ‘PETE EA (Zhuang 1998b)
Perrotia hongkongensis W.Y. Zhuang & K.D. Hyde i FUR Gi (Zhuang &
Hyde 2001b)
Perrotia nanjenshana Y.Z. Wang & J.H. Haines Fava LPR aA (Wang & Haines
1999)
378
Perrotia pilifera W.Y. Zhuang & Z.H. Yu ©22 #37 (Zhuang & Yu 2001)
Perrotia yunnanensis W.Y. Zhuang & Z.H. Yu 7A SEH A (Zhuang & Yu 2001)
Pezicula cinnamomea (DC.) Sacc. Fe 7chA#t | (Zhuang 1999a)
Pezicula cf. rubi (Libert) Niessl] (BFR) *449-F CHG (Zhuang & Wang 1998)
Peziza guizhouensis M.H. Liu wa ANA (Liu 1998)
Peziza shearii (Gilkey) Korf #4 G#i fi (Liu 1998)
Peziza sp. (Zhuang & Hyde 2001a)
Peziza urinophila Y.Z. Wang & Sagara "@/R#i ft (Wang & Sagara 1997)
Pezoloma ciliifera (P. Karst.) Korf 2/844 fel (HMAS specimen)
Phaeohelotium cf. subcarneum (Schumach. ex Sacc.) Dennis (4/8) WA He AHR
fal (Zhuang & Wang 1998)
Phillipsia hartmannii (W. Phillips) Rifai "647 27E 24 ti (Zhuang & Wang 1998)
Phillipsia umbilicata (Penz. & Sacc.) Boedijn htKZEE Ee (Zhuang & Wang 1998)
Phialina damingshanica W.Y. Zhuang KAA Wha 7) Ff fe (Zhuang 1999a)
Pithyella cf. erythrostigma (Berk. & Broome) Boud. (#8) 2° Aaa (Zhuang
& Hyde 2001a)
Plectania rhytidia (Berk.) Nannf. & Korf 4K2ChS2t be) ~(Xu 2000a)
Plectania nannfeldtii Korf 4 #27 FFG Ft FA ~(Xu 2000a)
Polydesmia pteridoicola W.Y. Zhuang JK" 2 224i (Zhuang 1999a)
Polydesmia recta W.Y. Zhuang H #2243) (Zhuang 2000b)
Proliferodiscus inspersus (Berk. & M.A. Curtis) J.H. Haines & Dumont var.
inspersus f= 4 Fi fal RAS FH (Zhuang 1998b)
Sarcoscypha mesocyatha F.A. Harr. *-#i A A (Zhuang 2000c)
Sarcoscypha shennongjiana W.Y. Zhuang *# RAEA M4 el (Zhuang 2000c)
Scutellinia cejpii (Velen.) Svrcek # FJ #i ER (Wang 1998)
Scutellinia jilinensis Z.H. Yu & W.Y. Zhuang FAKE FE (Yu et al. 2000)
(mis-identified as Scutellinia chiangmaiensis T. Schumach., Zhuang 1994)
Scutellinia jungneri (P. Henn.) Clem. $x ASE FE (Wang 1998)
Scutellinia phymatodeus S.C. Kaushal & R. Kaushal ff /&#i te (Wang 1998)
Scutellinia sinosetosa W.Y. Zhuang & Z. Wang 4¢HIE/G Fi (Zhuang & Wang
1998)
Scutellinia superba (Velen.) Le Gal faE/E #2 (Zhuang & Wang 1998)
Soleella chinensis Y.R. Lin, Z. Li & S.M. Wu #467) #44428 fal (Lin et al. 1995)
Stictis stellata Wally. HK Afi (Zhuang & Wang 1998)
Strossmayeria bakeriana (Henn.) Iturriaga Yl 54 2 Tk el (Zhuang 1999a)
Torrendiella guangxiensis W.Y. Zhuang J fa’) FER (Zhuang 1999a)
Trichophaea pseudogregaria (Rick) Boud. {fe 3¢4- 44% | (HMAS specimen)
Tuber liui A. S. Xu Xi) ERE (Ku 1999)
Tuber oligospermum (Tul. & C. Tul.) Trappe Hf Ey (Xu 1999)
Tuber xizangense A.S. Xu PajkR ER (Xu 1999)
Unguiculariopsis changbaiensis W.Y. Zhuang KAW et (Zhuang 2000a)
Unguiculariopsis damingshanica W.Y. Zhuang KAR WF EE A (Zhuang 2000a)
379
Urceolella crispula (P. Karst.) Boud. %££741 (Zhuang 2000b) |
Velutarina rufo-olivacea (Alb. & Schwein.) Korf 223k#4 fi (Zhuang 1999a)
CHANGES FOR NAMES IN PREVIOUS LIST
Albotricha acutipila (P. Karst.) Raitv. RAE for Dasyscyphus acutipilus (P.
Karst.) Sacc. (Raitviir 1970)
Lachnellula agassizii (Berk. & M.A. Curt.) Dennis Bi KF for Dasyscyphus
agassizii (Berk. & M.A. Curt.) Sacc. (Dharne 1965)
Lachnum apalum (Berk. & M.A. Curt.) Nannf. #4525 for Dasyscyphus apalus
(Berk. & Broome) Dennis (Spooner, 1987)
Lachnum bicolor (Bull.) P. Karst. X(€4#i-62t | for Dasyscyphus bicolor (Bull.)
Fuckel (Karsten 1871)
Lachnellula calyciformis (Willd.) Dharne 452.2% for Dasyscyphus calyciformis
(Willd.) Rehm (Dharne 1965)
Lachnum foliicola Keissl. "+42 #i76%% for Dasyscyphus foliicola (Keissl.) F.L.
Tai
Lachnellula fuckelii (Bres.) Dharne & SU#i=6%% I for Dasyscyphus fuckelii (Bres.)
Velen. (Dharne 1965)
Dasyscyphella nivea (Hedw.) Raitv. 23 H/)=6£) 4 for Dasyscyphus niveus (Hedw.)
Sacc. (Raitviir 1970)
Lachnum sclerotii (A.L. Sm.) J.H. Haines & Dumont for Dasyscyphus subcorticalis
(Pat.) Dennis var. wulaiensis S.C. Liou & Z.C. Chen (Haines & Dumont 1984)
ERRATA (Mycotaxon 67: 365-390, 1998)
Page 367, line 5 for Bisporella clavoflava read Bisporella claroflava
Page 367, line 37 for E.K.E.K. Cash read_ E.K. Cash
Page 368, lines 31-37 for Cookeiana read Cookeina
Page 368, line 40 for E.K.E.K. Cash read E.K. Cash
Page 369, line 1 for Coprotus maginatus read Coprotus marginatus
Page 369, line 17 for (Berk & M. A. Curt.) read (Berk. & Broome)
Page 373, line 11 for (Bull.) W. Phillips read (Bull.: Fr.) Gray
Page 373, line 41-42 for (Haines & Dumont 1984) read (WW&Z 1996)
ACKNOWLEDGEMENTS
The author would like to thank Prof. R. P. Korf of Cornell University, USA for
serving as pre-submission reviewer and consultation. Help from my students, Mr. Z.H.
Yu and Ms. Y.H. Zhang, to make corrections in the previous list is also appreciated.
REFERENCES
Baral, H.-O. & G. J. Krieglsteiner (1985) Bausteine zu einer Askomyzeten-Flora der
Bundesrepublik Deutschland: In Sueddeutschland gefundene Inoperkulate
380
Diskomyzeten — mit taxonomischen, oekologischen, chorologischen Hinweisen
und einer Farbtafel. Z. Mykol., Beih. 6: 1-160.
Dharme, C. G. (1965) Taxonomic investigations on the discomycetous genus
Lachnellula Karst. Phytopathol. Z. 53: 104-144.
Frohlich, J. (1997) Biodiversity of Microfungi Associated With Palms in the Tropics.
Ph. D. Thesis. The University of Hong Kong. Hong Kong.
Haines, J. H. & K. P. Dumont (1984) Studies in the Hyaloscyphaceae III: the long-
spored lignicolous species of Lachnum. Mycotaxon 19: 1-39.
Hou, C.-l. (2000) A new species of Bifusella on Camellia sinensis. Mycosystema 19:
7-9.
Liang, S.-w, J.-r. Wang, X.-y. Tang & Y.-r. Lin (2000) A new species of Coccomyces
with dimorphic asci. Mycosystema 19: 3-6. (in Chinese)
Lin, Y.-r., H.-y Liu, Z. Li, S.-w. Liang, S.-m. Yu & L.-s. Wang (1995) A new species
of Soleella on Pinus taiwanensis. Forest Res. 8: 422-425. (in Chinese)
Lin, Y.-R., Z.-Z. Li, H.-Y. Liu, C.-T. Xiang, S.-W. Liang & S.-M. Yu (2000) Studies
on the genus Coccomyces from China I. Mycosystema 19: 157-160. (in Chinese)
Lin, Y.-R., Z.-Z. Li, C.-L. Huang & C.-T. Xiang (2000a) Studies on the genus
Coccomyces from China II. Mycosystema 19: 297-301. (in Chinese)
Lin, Y.-r., Z.-z. Li, C.-t. Xiang, S.-w. Liang & S.-m. Yu (1999) A new genus of
Discomycetes, Neococcomyces gen. nov. Mycosystema 18: 357-360. (in Chinese)
Lin) YiuR3 2.02. Lis Y. S.eXie G&S) Wa Liang, (20006) 2Studies on “the; genus
Coccomyces from China III. Mycosystema 19: 449-453. (in Chinese)
Lin, Y.-R., Z.-Z. Li, Z.-S. Xu, J.-R. Wang & S.-M. Yu (2001) Studies on the genus
Coccomyces from China IV. Mycosystema 20: 1-7. (in Chinese)
Liu, H.-y., Y.-r. Lin, Z. Li, S.-w. Liang & W.-j. Wu (1995) A new species of
Rhytismatales, Lophodermium dicranopteris sp. nov. J. Anhui Agric. Univ. 22:
230-232. (in Chinese)
Liu, M.-h. (1998) A new species and a new record of Peziza from China.
Mycosystema 17: 218-222.
Raitviir, A. (1970) Synopsis of the Hyaloscyphaceae. Scripta Mycol. 1: 1-115.
Spooner, B. M. (1987) Helotiales of Australasia: Geoglossaceae, Orbiliaceae, Sclerotini-
aceae, Hyaloscyphaceae. Bibl. Mycol. 116: 1-711.
Wang, Y. Z. (1998) The genera Scutellinia and Geneosperma (Discomycetes, Pezizales)
in Taiwan. Bull. Natl. Mus. Nat. Sci. 11: 119-128.
Wang, Y. Z. (1999) The coprophilous discomycetes of Taiwan. Bull. Natl. Mus. Nat. Sci.
12: 49-74.
Wang, Y. Z. & J. van Brummelen (1997) A new species of Ascobolus from Taiwan.
Mycotaxon 65: 443-446.
Wang, Y. Z. & J. H. Haines (1999) A new species of Perrotia from Taiwan.
Mycotaxon 72: 461-464.
Wang, Y. Z. & N. Sagara (1997) Peziza urinophila, anew ammonophilic discomycete.
Mycotaxon 65: 447-452.
Wu, M. L. (1998) Two inoperculate discomycetes with white hairs from Taiwan.
Fung. Sci. 13: 93-99.
Wu, M. L. (1998) Some Orbilia species new to Taiwan. Fung. Sci. 13: 17-22.
Wu, M. L., J. H. Haines & Y. Z. Wang (1998) New species and records of Lachnum
381
from Taiwan. Mycotaxon 67: 341-354.
Xu, A.-s. (1999) A taxonomic study of the genus Juber in Xizang. Mycosystema 18:
361-365. (in Chinese)
Xu, A.-s. (2000a) Notes on Plectania in Xizang. Mycosystema 19: 200-204. (in
Chinese)
Xu, A.-s. (2000b) Two species of Hydnotrya in Xizang. Mycosystema 19: 568-569.
(in Chinese)
Yu Z.-h., W.-y. Zhuang, S.-l. Chen & C. Decock (2000) Preliminary survey of
discomycetes from the Changbai Mountains, China. Mycotaxon 75: 395-408.
Zhuang, W.-y. (1994) Current understanding of the genus Scutellinia (Pezizales,
Otideaceae) in China. Mycosystema 6: 13-24 (1993).
Zhuang, W.-y. (1998a) A list of discomycetes in China. Mycotaxon 67: 365-390.
Zhuang, W.-y. (1998b) Discomycetes of tropical China. III. Hyaloscyphaceous fungi
from tropical Guangxi. Mycotaxon 69: 359-376.
Zhuang, W.-y. (1999a) Fungal flora of tropical Guangxi, China: Discomycetes of
tropical China. IV. More fungi from Guangxi. Mycotaxon 72: 325-337.
Zhuang, W.-y. (1999b) Discomycetes of tropical China. VI. Additional species of
Guangxi. Fung. Divers. 3: 187-196.
Zhuang, W.-y. (2000a) Two new species of Unguiculariopsis (Helotiaceae,
Encoelioideae) from China. Mycol. Res. 104: 507-509.
Zhuang, W.-y. (2000b) Hyaloscyphaceous discomycetes from Ningxia Province,
China. Mycologia 92: 593-597.
Zhuang, W.-y. (2000c) Additional notes on Sarcoscypha in China. Mycotaxon 76: 1-7.
Zhuang, W.-y. & K. D. Hyde (2001a) Discomycetes of tropical China. V. Species new
to Hong Kong. Fung. Divers. 6: 181-188.
Zhuang, W.-y. & K. D. Hyde (2001b) New species of Lachnum and Perrotia from
Hong Kong, China. Mycologia 93: 606-611.
Zhuang, W.-y. & Z. Wang (1998) Discomycetes of tropical China. II. Collections
from Yunnan. Mycotaxon 69: 339-358.
Zhuang, W.-Y. & Z.-H. Yu (2001) Two new species of Perrotia (Helotiales,
Hyaloscyphaceae) from tropical China and a key to the known species of the
genus. Nova Hedw. 58: (accepted).
te
< (j
} 2)
rt Z
»
: * :
~
1
—_
eo I 1
r= 1,
;
i
" |
;
‘
=1
a
ace '
7
ri ‘
MYCOTAXON
Volume LXXIX, pp. 383-396 July-September 2001
PHYSIOLOGICAL AND MORPHOLOGICAL VARIATION IN OIDIODENDRON
MAIUS
ADRIANNE V. RICE and RANDOLPH S. CURRAH
Department of Biological Sciences,
University of Alberta
Edmonton, Alberta, Canada
T6G 2E9
E-mail: r.currah@ualberta.ca
Abstract: A collection of 22 isolates of the hyphomycete Oidiodendron maius from soil,
peat, wood, and ericoid mycorrhizas in northern Europe and North America was
examined using 16 simple physiological tests, SEM, and light microscopy. Twenty-one
of the isolates were similar in gross cultural morphology, in being uniformly
acidophilous, in their intolerance to high salt concentrations, and in having temperature
optima around 20-25 °C. SEM examination of conidia showed that although shape
could vary substantially within a single chain, surface ornamentation was uniform
among the isolates and because of fine asperulations on a perispore membrane.
Conidiophore length, traditionally relied upon for species determinations in the genus,
was too variable among the isolates to be a definitive character. The morphological,
physiological, and ecological features examined did not indicate that subspecific taxa
occur within O. maius. An isolate that had been included due to a previous
misidentification, showed substantial physiological differences from the other 21 O.
maius isolates. In addition to fine differences in culture, this isolate also had a unique
conidial perispore confirming its lack of taxonomic relationship to the other isolates.
Keywords: acidophilous fungi, ericoid mycorrhiza, Hyphomycetes, Myxotrichaceae,
taxonomy
INTRODUCTION
Oidiodendron maius Barron is a widely distributed hyphomycete with affinities to the
ascomycete genus Myxotrichum (Hambleton, Egger & Currah 1998). Morphological
characters, such as conidiophore length, critical for identification are variable and have
lead to problems in identification (Hambleton & Currah 1997). Strains identified as O.
maius have been isolated from peat, soil, humus, decaying wood, and the roots of
vascular plants (Hambleton & Currah 1997, Hambleton et al. 1998). Oidiodendron
maius is particularly significant because it forms endomycorrhizas with some Ericaceae
(Douglas, Heslin & Reid 1989, Hambleton & Currah 1997, Currah, Niemi & Huhtinen
1999), ostensibly enabling host plants to thrive in soils that are low in nutrients and pH
(Read 1983, Douglas et al. 1989, Currah, Tsuneda & Murakami 1993, Currah et al.
1999, Hambleton & Currah 2000). The diverse habitats occupied by O. maius,
384
combined with wide intraspecific variation and overlap in morphological characters
among other species of Oidiodendron, especially O. griseum and O. tenuissimum
(Hambleton et al. 1998), have confounded attempts to make conclusions regarding its
distribution and ecological roles.
Physiological tests have been used to help answer both taxonomic and ecological
questions in other groups of fungi (e.g. Hutchison 1990, Untereiner & Malloch 1999)
but have not been applied in a systematic way to isolates of Oidiodendron maius.
The availability of 22 isolates of O. maius from a variety of provenances
motivated us to ask the following questions: (1) Do physiological characteristics of O.
maius vary to the same extent as morphological features? (2) Can morphological
variations within O. maius be correlated with growth responses to a suite of simple
physiological tests? and (3) Do correlations reflect substrate, host, or site of origin? To
answer these questions, all 22 isolates were grown under standard conditions to obtain
unique sets of cultural and morphological criteria. At the same time, isolates were
grown on a variety of media with variations in pH, osmotic potential, temperature, light,
and substrate. Scanning electron microscopy (SEM) was used to provide additional data
concerning conidium morphology and ornamentation. The resulting data were searched
for correlations using several clustering algorithms.
METHODS
Isolates (Table 1) are deposited as live cultures in the University of Alberta Microfungus
Collection and Herbarium (UAMH) or maintained by the authors at the Department of
Biological Sciences at the University of Alberta. Stocks were kept on corn meal agar
(CMA; 17 g corn meal agar, 1 L distilled water; Difco-Bacto, Detroit, MI) at room
temperature (~20 °C) in the dark.
Morphology
Three replicates of each isolate were grown as single-point-inoculated cultures on plates
of CMA kept at room temperature in the dark. Colour, amount of sporulation, and
topographical features (e.g. concentric rings, thickness of the mycelium, texture etc.)
were noted. Mean culture diameter was calculated for each isolate after 10 days using at
least two measurements from each replicate.
Slide cultures (Sigler 1993) of each isolate were mounted after nine days to
allow conidiophores to develop. Mean conidiophore lengths and conidial dimensions
were calculated for each isolate using at least 10 randomly chosen conidiophores and
conidia. The entire procedure was repeated, months later, to determine the reliability of
the conidiophore length measurements.
To prepare SEM images of conidia, mycelial plugs (2 mm x 2 mm) from three-
week old cultures on CMA were viewed on a cryo-stage in a JEOL #JSM6301FXV
SEM.
Growth Rates
Isolates were grown on CMA under a variety of light, temperature, pH, and osmotic
treatments. Unless otherwise stated, isolates were grown at room temperature in the
dark and measurements were based on three replicates of each treatment. Growth rates
were calculated from the mean (of two measurements on each of three replicates)
culture radius (mm) after 7, 10, 14, 17, 21, 24, 27, and 31 days.
385
Table 1: Isolate number, collector, and collection information (host plant, habitat,
location) of 22 isolates of O. maius.
Isolate
F-01
F-02
F-03
H682
BS-DCMP
S1-P3-C-1
S1-P6-C-1
S2-P3-C-1
S2-P6-P-9
S3-P6-M-1
S4-P3-P-4
S4-P4-C-1
S4-P6-C-1
UAMH 1540
UAMH 6514
UAMH 7022
UAMH 8442
UAMH 8529
UAMH 8920
UAMH 8921
UAMH 8922
UAMH 8933
Collectors
Currah
Currah
Currah
Lumley
Thormann
Hill-Rackette
Hill-Rackette
Hill-Rackette
Hill-Rackette
Hill-Rackette
Hill-Rackette
Hill-Rackette
Hill-Rackette
Barron (1962)
Stoyke & Currah (1991)
Xiao & Berch (1992)
Douglas et al. (1989)
Couture, Fortin & Dalpé
(1983)
Hambleton & Currah (1997)
Hambleton & Currah (1997)
Hambleton & Currah (1997)
Hambleton
Collection Information
Empetrum nigrum, birch-dominated
fjell, Kevo Research Station, Finland
Vaccinium myrtillus, birch-dominated
fjell, Kevo Research Station, Finland
V. vitis-idaea, birch-dominated fijell,
Kevo Research Station, Finland
Decomposing Picea sp., 15 km north of
Slave Lake, Alberta
Decaying Sphagnum fuscum, black
spruce bog, Perryvale, Alberta
V. myrtilloides, jack pine-aspen forest,
50 km south of Fort McMurray, Alberta
V. myrtilloides, jack pine-aspen forest,
50 km south of Fort McMurray, Alberta
V. myrtilloides, jack pine-black spruce
forest, Fort McKay, Alberta
V. myrtilloides, jack pine-black spruce
forest, Fort McKay, Alberta
V. myrtilloides, jack pine-blueberry-
lichen hilltop, Fort McKay, Alberta
V. myrtilloides, mechanically disturbed
sand hill with blueberry and grasses,
Fort McKay, Aberta
V. myrtilloides, mechanically disturbed
sand hill with blueberry and grasses,
Fort McKay, Alberta
V. myrtilloides, mechanically disturbed
sand hill with blueberry and grasses,
Fort McKay, Alberta
Soil, cedar bog, Guelph, Ontario (ex-
type)
Loiseleuria procumbens, dry alpine
ridge, Jasper National Park, Alberta
Gaultheria shallon, 3 yr. old western
hemlock site, coastal British Columbia
Rhododendron sp., heath meadow,
Ireland
V. corymbosum, Quebec
Oxycoccus quadripetalus, black spruce
bog, Alberta
V. myrtilloides, sand dune, Alberta
V. vitis-idaea, sand dune, Alberta
Phyllodoce empetriformis, alpine
meadow, Alberta
386
Isolates were grown under diffuse daylight (“natural light”), and a black light
(Philips F20T12-BL, 20 W) — “grolight” (Sylvania F20T12, 20 W) regime (referred to
as “black light” treatment) (Hambleton & Currah 1997). Isolates were grown at six
temperatures (5, 10, 15, 20, 25, and 30 °C). Temperatures were kept constant and were
accurate within + 1.5 °C. Isolates were grown on CMA at pH 3, 5, 7, 9, and 11. The pH
was altered by the addition of 3 N hydrochloric acid (HCI) and 10 % potassium
hydroxide (KOH) solutions.
Osmotic potential of the medium was altered using sodium chloride (NaCl) or
glycerin and measured using a thermocouple psychrometer (DECAGON Thermocouple
Psychrometer; model SC-10A sample changer and NT-3 nanovolt thermometer) and a
series of NaCl standards of known water potentials. Isolates were grown on osmotically
altered CMA including 50 % glycerin (by volume; water potential ~ 0.21 MPa), 25 %
glycerin (by volume; ~ 0.13 MPa), unaltered CMA (isoosmotic; ~ - 0.42 MPa), 10 g
NaCl (per 500 ml; ~ -1.46 MPa), and 20 g NaCl (per 500 ml; ~ -2.82 MPa).
Enzymatic Tests
Isolates were grown on media containing tannic acid, cellulose azure, chitin azure,
potato starch, pectin, gelatin and TWEEN 20. The ability to alter these substrates was
compared among the isolates and to negative controls (uninoculated media) based on
observations of three replicates. Unless otherwise stated, inoculation was at room
temperature in the dark. Except for tannic acid medium (TAM), media were prepared
following Hutchison (1990).
Isolates were grown for one month under diffuse daylight on TAM prepared
using a solution of 5 g tannic acid in 200 ml distilled water and a solution of 15 g malt
extract and 20 g Difco agar in 800 ml distilled water. The two solutions were
autoclaved separately, cooled, and combined before pouring. The darkening of the
medium surrounding the mycelium, caused by the breakdown of tannic acid, indicated
the production of polyphenol oxidases (PPO), enzymes correlated with lignin
degradation. Darker medium discolouration indicated more PPO present.
The cellulose azure method described by Smith (1977) was used as an assay for
cellulolytic ability. Modified Melin-Norkrans agar (MMN: 12 g Difco agar, 3.0 g Difco
malt extract, 1.0 g d-glucose anhydrous, 1.0 g CaCh, 0.5 g NaCl, 10 g KH2POx,, 5.0 g
(NH4)2HPOg, 3.0 g MgSO4:7H20) was used as the basal medium. MMN (20 ml) was
added to 50-ml Pyrex culture tubes, autoclaved and allowed to solidify. A 2 % (w/v)
cellulose-azure (Sigma Chemical Co., St. Louis, MO) solution in MMN was autoclaved,
and 2 ml added to each tube using a sterile pipette. Isolates were incubated on the
cellulose azure for one month. Tubes were scored based on the amount of dye released,
by cellulose digestion, into the basal layer.
A similar procedure was used to prepare tubes of chitin azure. MMN lacking
(NH4)2HPO,4 (20 ml) was used as the basal layer. MMN lacking (NH4)2HPO,, but
containing 1 g L’' chitin azure (Sigma Chemical Co., St. Louis, MO) was used as the top
layer. Tubes were inoculated for eight months and scored for colour change.
Isolates were grown for three weeks on MMN containing 2.0 g L” potato starch
(B.D.H. Laboratory Chemicals Division, British Drug Houses Ltd., Poole, U.K.). Plates
were flooded with iodine solution (5.0 g KI, 1.5 g I, 100 ml distilled water). The
solution was decanted after several minutes and a clear zone around the mycelium in an
otherwise dark plate indicated amylase activity.
387
Pectin media was prepared by dissolving 5 g L' citrus pectin in MMN,
autoclaving, and pouring into petri plates. Inoculated plates were incubated for weeks
then flooded with a 1 % aqueous solution of hexadecylmethylammonium bromide
(Sigma Chemical Co., St. Louis, MO) for six hours. A clear zone around the mycelium
in an otherwise opaque background indicated pectinase activity. To aid in comparison,
Trichoderma harzianum, was used as a positive control.
Gelatinase was detected using a modification of the procedure described by
Hutchison (1990). MMN with 60 ml gelatin L’' (Unflavoured Knox Gelatine) instead of
agar was used. The gelatin was added to 900 ml distilled water, dissolved, and
autoclaved. The remaining ingredients were dissolved in 100 ml distilled water and
autoclaved separately. The salt medium was added to the cooled gelatin before pouring
into petri plates. Inoculated plates were incubated for three weeks. Gelatinase synthesis
was indicated by liquefaction of the medium beneath the mycelium.
MMN containing 0.1 g CaCl, L” was used to detect lipase synthesis. 10 ml
TWEEN 20 (polyoxyethylene sorbitan monolaurate) L’' was autoclaved separately and
added to the autoclaved agar before pouring. Isolates were incubated on the TWEEN
medium for three months. Lipase production caused the precipitation of the calcium salt
of the fatty acid released by lipolysis, forming macroscopically visible crystals beneath
and around the mycelium.
Data Analyses
Mean growth rates of all 22 isolates under the natural light and black light treatments
were compared using a paired, two-tailed t-test to determine if there were significant
differences in the growth rates between the two treatments. The same test was used te
determine whether the growth rates under the 20 °C and isoosmotic treatments (the two
controls) were different. A one-way ANOVA was performed to determine if any of the
isolates had significantly different conidiophore lengths. Two-tailed t-tests were
performed for each isolate to determine the extent of variation between the two sets of
conidiophore measurements.
Isolates were compared on the basis of the results of the growth rates, enzymatic
tests, and conidium and conidiophore dimensions. Dendrograms based on these
characters were constructed by neighbour joining and unweighted arithmetic averages
using the Bray-Curtis, Euclidean, Mean Censored Euclidean, and Canberra measures of
distance in a clustering program (http://www. biology.ualberta.ca/jbrzusto/cluster.php)
(Brzustowski 2001).
RESULTS
Morphology
Gross cultural morphology was similar for all but one of the isolates. At ten days, the
colonies were off-white to grey and flat around the periphery but higher near the centre
where conidiophores and conidia were abundant. Conidiophores were dematiaceous,
erect, and visible beneath the conidia with a dissecting microscope. Culture reverse was
dark brown to black, especially at the centre. After 10 days on CMA, colonies were 9-
18 mm in diameter (mean 13 mm; Table 2). H682 had conidia with darker pigmentation
than the other isolates, causing the culture to appear grey to green-grey, rather than off-
white. It also grew fastest and had the greatest diameter of all isolates after 10 days (18
388
mm; Table 2). UAMH 7022 was the same colour as the other isolates, but was
concentrically zonate.
Table 2: (Minimum) - mean — (maximum), colony diameters (number of replicates > 6)
of 22 test isolates after 10 days incubation on CMA at room temperature in the dark.
Isolates Diameter (mm)
F-01 (11) -12-(13)
F-02 (11) - 13 -—(15)
F-03 (12) - 13 —(15)
H682 (15) — 18 — (20)
BS-DCMP (12) — 13 -(14)
S1-P3-P-4 (10) — 11 —(12)
S1-P6-C-1 (10) — 10 —(12)
S2-P3-C-1 (13) — 14-(16)
S2-P6-P-9 (9)-—11-(12)
S3-P6-M-1 (8) — 10 — (12)
S4-P3-P-4 (8)-9-(11)
S4-P4-C-1 (10) —- 11 —(12)
S4-P6-C-1 (11) -12-(14)
UAMH 1540 (14) —- 15 -—(15)
UAMH 6514 (10) — 12 -(13)
UAMH 7022 (13) -— 14-16)
UAMH 8442 (12) — 13 — (13)
UAMH 8529 (11)-12-(14)
UAMH 8920 (12) - 14-(15)
UAMH 8921 (12) —-12-(14)
UAMH 8922 (14) —- 14-(15)
UAMH 8933 (14) — 15 -(15)
Mean 13
Overall, the mean conidiophore length (Table 3) was 174 um (average of the two
sets of measurements) and the mean conidial dimensions were 3.3 + 0.3 um x 1.4 + 0.2
um (Table 3). There were significant differences in conidiophore length among the
isolates (p<0.05 for both sets of measurements). In addition, conidiophore lengths
varied substantially within isolates (Table 3). Thirteen of the isolates displayed
significant variation (p<0.05) between the sets of measurements taken on separate
cultures at different times, with six isolates showing highly significant variation
(p<0.001) between measurements. There was also substantial variation within single
sets of measurements, for instance, conidiophores of UAMH 7022 ranged in length from
123 to 455 um in the second set of measurements (Table 3).
With the exception of H682, variation in conidial size and ornamentation among
the isolates was minimal. The conidia of all 22 isolates were covered by a perispore,
remaining from the cell wall of the conidiogenous hypha. In H682, the perispore was
highly wrinkled, forming a coarse polygonal reticulum on the conidial surface (Fig. 1).
The perispore was faintly asperulate or roughened, rather than wrinkled, in the other
isolates (Fig. 2). Conidia were ovoid to cylindrical or slightly dumbbell-shaped, or Y-
shaped when arising from branch points in the fertile hyphae (Fig. 2). Increasing
maturity of the conidiogenous hyphae resulted in a mass of arthroconidia loosely
389
Sl'OFP'I X ST'OFE'E
(S'1)-' 1-(0' 1)x(0'S)-9°€-(5°7)
(¢'Z)-€ 1-(0' D)x(0'b)-0' €-(0'Z)
(0'7)-9' 1-(0' 1) X(Z')-8' €-(¢ 7)
(S°Z)-6 I-(S' 1)X(0'S)-8' €-(S 7)
(S'1)-Z' 1-(0' Dx(0'b)-7 €-(0'°7)
(0'2)-t' 1-(0' 1)x(0'S)-L €-(5 7)
(S$: 1D)-t' 1-0 Dx(S'b)-b' €-(5°7)
(0'Z)-¢' 1-(0' D)x(0'b)-0'°€-(5°7)
(S'1)-€' 1-(0' 1)x(¢'€)-0'€-(5°7)
(0'Z)-$' 1-(0' 1)x(S'°€)-6°7-(0'7)
(0'2)-v' 1-(0' 1) X(0'b)-b' €-(S 7)
(S'1)-r'1-(0' 1) x(0'b)-S'€-(0'€)
(0'Z)-b' 1-(0' D)x(0'S)-€'€-(5'°7)
($°1)-r' 1-(0' L)x(0'b)-b' €-(S 2)
(S'1)-€' 1-0 DX 'b)-b' €-(5°7)
(0'Z)-9' 1-(0' DX(0'b)-€ €-(h'7)
(0'7)-9' 1-(0' 1) x(0'b)-€ €-(h'Z)
(0'°2)-' 1-0 ID) X(Z'b)-b' €(5°7)
($°Z)-L' 1-0 DX(0'b)-7 €(5°7)
(L'1)-€ 1-(0' D)x(0'p)-7 €-(0'7)
(S'1)-T' 1-0 Dx(€'p)-1'€-(0'7)
(S'1)-€ 1-0 Dx(S'b)-b'€-(Z'Z)
SUOISUSWIC] [PIpIuoD
KK
* Kx
8SF8LI
(€07)-ZEI-(€E8)
(OS¢)-E€7-(OTL)
(€S1)-r1I-(€9)
(O€€)-6€7-(S9 1)
(€Z1)-98-(SS)
(87Z)-6S I-(86)
($St)-987-(E71)
(O€h)-€€7-(OEL)
(Sre)-rEz-(Or LD)
(8S7Z)-L9I-(€8)
(SSe)-LS7-(SI 1)
(087Z)-777-(SS 1)
(007Z)-€S 1-(06)
(OS€)-O1Z-(EED)
(Ov7Z)-Z91-(8Z)
(061)-SEI-(€EL)
($07)-rS I-(09)
(00€)-LE7-(OTZ 1)
(S17)-7S 1-(06)
(0SZ)-8rI-(8Z)
(€L1)-€€1-(€8)
(801)-€LSr)
(Z) syjysus] s10ydorpruo;
pSFOLI
(S1Z)-6SI-(EET)
(80¢)-ZE7-(Or 1)
(091)-811-(s9)
(S61)-8S1-(801)
(SO1)-06-(SZ)
(S7Z)-65 1-(S6)
(SL7)-vLI-(€7D
(Sod)-ESI-(ELD)
(OZE)-SP7-(S9 1)
(O1Z)-S€1-(08)
(Ore)-6€7-(SS 1)
(00€)-Lr7-(SLD)
(Sr1)-1 1 1-(08)
(S67)-SP7-(007)
(S61)-99I-(OrT)
(SZZ)-€91-(OOT)
(Sr 1)-O€1-(S6)
(Ore)-197-(S81)
(097Z)-€07-(ET 1)
(OI 1)-88-(€9)
(061)-8EI-(ELD)
(8b 1)-S11-(06)
(,) syjsua] s10ydorpruog
np nines
er
‘AS F UBoW
€€68 HAVA
C768 HWVE)
1768 HNVY)
0768 HNV!)
67S8 HNV!
Crrs HNV
CCOL HWV 1)
vpIS9 HNVY
Ors HNV!
1-0-9d-v$
I-O-vd-v$
b-d-td-v$
I-W-9d-€S
6-d-9d-CS
1-2-¢d-Cs
I-0-9d-IS
Fes cdaLS
dNOG-Sd
C89H
€0-A
CO-A
10-d
So}e]OS]
“(WUBdTFTUSIS JOU = SU [00 0>Txxx 10 O>dex ‘S0'0>d4) PooU ore SJUSWAINSKdUT oY} Ud9MJoq SY}sUa] s10YdorpruOS
Ul SQOUIOTFIP JURIIFIUSIS ATTeONSHeIG ‘sosoyuored ur ore sonjeA WNUTTUT pue WNUNTXeY| “So}eTOST ZZ OY} JO (QT<U) (uM) (IPM x
y]Su9]) SUOISUSUIp [eIpIuOS pu (soiny[No opr[s JUspusdapul om} WosF) (UUM!) sy}SUD] sJoYydorpruoo WINWUTXeU pure “UBOLU “WINTUTUTY °€ 214".
390
Vibe) coms. Vee CO) EES AS eon ho Umesh 2 tes Sat al BE SR A cl 0 c9'0 c9'0 se0 910 sd00 90 $90 ues
OU Ue eet y. ata. 0 600 LEO "S2Z50°-"0L0. cs 0 90°0 IL'0 €L0 80 910 00 cLlO 690 £€68 HNVN
LOS tes LO TCO reo aes Oe £30 — 680 90°0 9L°0 IL0 80 810 sd00 SL0 940 @%68 HNVN
GUUS 2 St Una 9S Q) PU USG9EO ra Os CE 0 06-0 60°0 $90 09°0 to0 SLO S5t0 001.02 79.0" [c6S HIN Vi
Silay Ctl 0 O00 £6 0m S870 cs 0-7 060 S10 vs 0 v9°0 Se0 910 soo 190 I4L0 0¢68 HNVN
Ul VeeenGe Ue 9S. () 800 610 Ivo 690 160 veo cL 0 c9'0 €£0 €l0 vo0 e0 CLO 6768 HAWN
Seat Uae. LA Oe eit Ue LV OW, £607 36.0 L00 L9°0 6$°0 8¢£0 810 00 S90 p90 c¢chY8 HNVN
Vis oor Ueno 900s VY ro Oe £8) - 676-0 810 160 IL'0 8£0 90 = $005 -620= LE 02 — COOL HING
600 re0 990 LU 02-90 IvO 60 680 L00 19°0 vs 0 I€0 910 80 0995 02 0S Ur SriSS Hv)
OU me or sac. 800 ceo 190 -c8 0° S60 $00 €L'0 cL 0 00 Sh0 v0 05 SLO] ch 0S 207s EHNVit
tiOs ct Ore 219.0 DU er VG =e Ot 0-9 79 Ves 850 c0'0 0r'0 LS°0 9¢€°0 Vi See V0 On arc S Ua L9G 1LO-9d-v$S
EOS £t Ger 9s 0) L00 €c 0 ScO 83=—-: 910 8L°0 €1°0 8¢0 0s°0 Le0 L110 600) =«6€S0—8S°0 lO-td-v$
bisa ct Ue cy 0) a0 8h0 ~. 08 0°- $90 160 v0'0 LS0 0S°0 0 clo }6=6—.S00—S «TS 0sO9F'0 vd-€d-v$
CLO 80s cer 0 SO Uetee POM acre LL Oo 06 0 90°0 80 cS'0 L770 [VO =st00-eSS 0-525. 0 IW-9d-€S
tb 7.0% LS0 90.0 COS 7t.0 Se 990-2 9L0 91°0 ev'0 Ss'0 se0 Vis). = 2S0:0ee295.05 27S 0 6d-9d-CS
UL0= sr 02 2S. 0 L0'0 [oO 2 7S0 [80 880 970 LL0 69°0 Se0 SU 2 -S0 Olas Ome SLU TOr€dscS
OS tes 05.0 tO: Ose LO pa CO Pe SE 022 96:0 ST'0 0S'0 cS 0 ce 0 VEO 170009. 0 ecS.0 [O-9d-IS
1d 0} 29: Ueascs 0 SOU OGUS aye 0 aeel Ue 66.0 L00 6$°0 6S°0 ££.0 ClLO> 000) -=<65 0 Elo G [O-€d-I$
yl0 67vO 6 6S90 60:02 9C 0S asty 0. 25 -£2.0> = 1780 L70 99°0 99°0 8¢£0 SE0T 50:0; 09 0-5 = ¢9 0 dNWOG-Sd
ci er O ee Ul 960 860 660 ‘S60 980 0 0S°0 820 0€°0 C0 CGO UL Usencs C0 c89H
OTD =212. 0 4890 LO ee Ce Uae oe ey (ee LL: 0 O10 6L'0 $90 80 C10 = S00 V9 Ose UL0 €0-4
Glee A Re LU OeeeR COS OP ee or en 98-0 910 €L'0 $90 LEO CeO see SO OF 99 (eel 0 cO-A
{iG 2 92-690 LO 05> =6C 0" tr 0 89 0 C80 90°0 v0 c9°0 veo LIO>. 90 0 LS 0 == 680 10-4
0c Ol OST Reet 6H LH SH eas DAME ODoSC ODODE OSI OOI oS ‘Td "IN So}e [OS]
“SUOT]IPUOD
(VINO I 00S/10®N 3 07=8 07 “VINO TW00S/1ORN 3 O1=8 OL “CVIND peseyeun) sHoulsoosI—ost) o10uNso pue “Yd “(5,) smnjesrodura} “(WY 31]
yoe[q=Td Wst] [eInjeu=TN) Souder WYST] JUoJAJIP Jopun UMOIS SNIDU ‘CE JO SayeIOST ZZ JO (,_P WW) SoyeI YIMOIS URa :p 9IGUL,
391
Figs. 1-4. Cryostage SEM images of conidia and conidiophores of four isolates
identified as Oidiodendron maius. Fig. 1. Conidia of isolate H682 ex decaying spruce
log, Alberta. The wrinkled (reticulate) perispore indicated the species is anomalous
among other isolates of O. maius, bar = 1pm. Fig. 2. Portion of fertile hyphae from
conidial head of UAMH 8442 ex Rhododendron, Ireland. Perispore is asperulate.
Arthroconidial chains branch at Y-shaped conidia. Intervening spaces are areas where
the cell wall has collapsed, bar = lpm. Fig. 3. Conidia and conidiophore of UAMH
8921 ex Vaccinium myrtilloides, Alberta. The large head of fertile hyphae bears mature
ovoid conidia at the tips of arthroconidial chains. The asperulate nature of the perispore
and the connections between conidia where the cell walls have collapsed are apparent,
bar = 5um. Fig. 4. Conidia and conidiophore of S3-P6-M-1 ex Vaccinium myrtilloides,
Alberta. The branching pattern is approximately verticillate. Distal, older conidia are
ovoid while more proximal conidia are barrel or dumbbell shaped, bar = 10um.
392
attached, end-on-end, by the contracted remains of the parent hyphal walls (Figs 2, 3).
Variations in conidial shape were related to position in the chains, with distal, older
conidia ovoid and more proximal conidia barrel or dumbbell-shaped (Fig. 4). The
branching pattern of the conidiogenous hyphae from the central conidiophore apex was
approximately verticillate (Figure 4).
Growth Rates
Mean growth rates (mm d') of each isolate for each treatment are in Table 4. There was
considerable variation in growth rates among and within treatments and isolates. Two
treatments (20 °C and isoosmotic) involved the same growing conditions (room
temperature, unaltered CMA, and darkness) but were set up about two months apart.
While there were no significant differences in mean growth rates between the two
treatments (p>0.05), the growth rate of some isolates, such as H682, varied substantially
between the two treatments (Table 4) and there was greater variation in the mean growth
rates among the isolates in the isoosmotic treatment (0.42-1.01 mm d' compared to
0.50-0.78 mm d” in the 20 °C treatment).
Overall, there were no significant differences in mean growth rates under black
and natural light (p>0.05) (Table 4). However, there was considerable variation among
the isolates in response to each treatment, with ranges of 0.46-0.82 mm d' under natural
light and 0.51-0.79 mm d' under black light (Table 4).
Growth rates were highest at intermediate temperatures, with mean maxima
between 20 and 25 °C (mean 0.62 mm d"; Table 4). Growth rates were lowest at 5 °C
for all isolates except H682, which had its minimum at 30 °C and had a growth rate of
0.22 mm d” at 5 °C (Table 4). Some isolates reached maximal growth rates at 20 °C,
while others had maximal growth rates at 25 °C (Table 4). While there was variation in
response to each treatment, variation was greatest at higher temperatures (Table 4).
On average, growth rates were highest at pH 3 (0.86 mm d'') then decreased to a
minimum of 0.10 mm d” at pH 11 (Table 4). The exception was isolate H682, which
had its minimum at pH 3 (0.56 mm d”) and maximum at pH 7 (0.99 mm d’), with
growth rates greater than 0.95 mm d” from pH 5-11 (Table 4). Variation among the
isolates in response to the pH treatments increased as pH increased (Table 4).
None of the isolates grew on media containing glycerin. For all isolates except
H682, growth rates decreased with increased salt concentration and osmotic potential,
from a mean of 0.63 mm d" on the isoosmotic control to a mean of 0.14 mm d’ in the
medium containing 20 g NaCl per 500 ml (Table 4). H682 grew faster on the medium
containing 10 g salt than at isoosmotic conditions (1.04 and 1.01 mm d”, respectively)
and grew faster than any of the other isolates on 20 g NaCl (Table 4). Variation in
growth rates was high for all three treatments (isoosmotic, 10 g NaCl, and 20 g NaCl)
(Table 4).
Enzymatic Tests
Enzymatic ability was assessed qualitatively and the results are provided in Table 5. No
degradation is indicated by ‘-*, slight by ‘+’, moderate by ‘++’, and high by ‘+++’.
All isolates, except H682, grew on the TAM and caused the formation of a
brown pigment beneath the mycelium, indicating the production of PPO (Table 5).
H682 did not grow on TAM or cause a pigment change in the medium (Table 5).
UAMH 7022 showed the most intense pigmentation (Table 5). The depth of colour and
693
the length of time needed to detect positive reactions varied among isolates; however,
most isolates caused moderate amounts of pigmentation (Table 5) within two weeks.
Positive reactions from the cellulose azure were obtained for all isolates (Table
5). BS-DCMP produced the greatest colour change in the basal medium, while H682,
S3-P6-M-1, and S4-P3-P-4 showed slight colour change (Table 5). The remainder of
the isolates displayed moderate colour change (Table 5) within two weeks.
Positive reactions from the chitin azure took eight months to develop. Isolates
grew well on the chitin-enhanced medium and only H682 failed to produce a colour
change in the basal medium after eight months. Isolates F-03 and BS-DCMP released
the greatest amounts of azure into the basal medium (Table 5).
All isolates, except H682, degraded starch, but F-01, BS-DCMP, S4-P3-P-4, and
UAMH 8933 showed only moderate amylase activity relative to the other isolates,
which had more pronounced amylase activity (Table 5).
All isolates demonstrated slight pectinolytic ability (Table 5) when compared to
the positive control. UAMH 8921 had the greatest pectinolytic ability and was
designated moderately pectinolytic (Table 5).
All isolates liquefied the gelatin medium (Table 5) but F-03, S4-P4-C-1, and
UAMH were weakly gelatinolytic compared to the other isolates, while H682 and
UAMH 8922 caused the greatest liquefaction (Table 5).
None produced a precipitate in the TWEEN-enhanced medium (Table 5) but all
grew well on the medium. Substantial variation in morphology occurred on this
medium, with some isolates producing coloured (yellow, orange, brown, and dark
brown) exudates and some mycelia becoming pigmented (yellow, orange-brown, and
dark brown). Conidial production and culture texture ranged from highly sporulating
and floccose to non-sporulating and slimy.
Table 5: Enzymatic abilities of the 22 isolates ((-) = no reaction, (+) = slight reaction, (++) =
moderate reaction, (+++) = strong reaction).
F-01 + ++ + ++ “ ++ :
F-02 + ++ + +++ + dos 5
F-03 ++ ++ ++ +++ + + -
H682 - ‘ - + ++ :
BS-DCMP at Tah ++ Ee + ++ £
S1-P3-C-1 set ++ ae ++ + ++
S1-P6-C-1 se ++ + +++ + ++ =
$2-P3-C-1 ++ ++ ++ +++ + a :
S2-P6-P-9 ++ = fe bal + ++ 4
S3-P6-M-1 tate + ++ +++ + a e
S4-P3-P-4 me + + ++ + ++ =
S4-P4-C-] ++ ++ + +++ a - u
S4-P6-C-1 Ga ++ ++ +++ + ++ 2
UAMH 1540 pay ri ea +++ + + =
UAMH 6514 ++ sia ++ +++ 4 “+ ‘
UAMH 7022 Dae att + +++ t ++ is
UAMH 8442 ++ at ++ +++ + ++
UAMH 8529 a tre + +++ + ++ 3
UAMH 8920 5 ++ + +++ + ++ te
UAMH 8921 or ++ ++ +++ ++ ++ 3
UAMH 8922 ++ ++ ++ +++ + +++ -
UAMH 8933 at ae it =F + +
394
Cluster Analyses
Neither neighbour joining nor unweighted arithmetic averages provided clear results.
The dendrograms produced using the distance measures were. not well supported by
bootstrap analysis, with few branches receiving greater than 50 % support. The trees are
not shown. However, H682 was always on its own branch but other isolates did not.
form well-supported groups.
DISCUSSION
In spite of considerable variation in morphological and physiological characteristics, 21
of the 22 isolates were apparently conspecific and satisfactorily placed in Oidiodendron
maius. These isolates were similar in gross cultural morphology, in being uniformly
acidophilous (growing optimally at pH 3), in their intolerance to high salt
concentrations, and in having temperature optima around 20-25 °C. SEM examination
of conidia showed that although shape could vary within a single chain, surface
ornamentation in the 21 conspecific isolates was constant and due to fine asperulations
on a perispore membrane.
However, conidiophore length, one of the traditional characteristics used to
define the species was too variable to be a reliable character. Mean conidiophore length
varied from 73 um in isolate F-01 to 286 um in UAMH 7022 (Table 3) and varied
within an isolate depending on unknown factors associated with the time of preparation
of slide cultures. Substantial variation was also observed within a single slide culture.
Variation in conidiophore length in Oidiodendron maius has been noted before
(Tokumasu 1973, Hambleton & Currah 1997, Hambleton ef al. 1998); however, this
study systematically examined this variation. All keys so far published to this genus
(Barron 1962, Domsch, Gams & Anderson 1980) rely on conidiophore length as a key
character. This is unfortunate given its unreliability in this and similar species
(Hambleton et al. 1998). More reliable and distinctive characters may be found in
physiological tests and features visible using SEM.
Among our isolates, H682, was obviously an outlier. Gross cultural mOrpnoleey
and characters derived from light microscopic examination of this isolate had placed it
in Oidiodendron maius. Physiologically, it differed considerably from the other 21
isolates in that it had a pH optimum between 7 and 9, a predilection for high salt
environments, and was more psychrotolerant than O. maius, having much higher growth
rates than the other isolates at lower temperatures (Table 4). However, the growth rates
of H682 approached those of the other isolates at higher (>20 °C) temperatures (Table
4). Conidia of H682, by SEM, showed variation in conidial shape within that accepted
for O. maius but the perispore was coarsely wrinkled rather than asperulate, a character
scarcely detectable by routine light microscopy. This isolate was unable to degrade
tannic acid, starch, and chitin, unlike other isolates. Morphological characteristics in
keys did not allow confident placement of this isolate under a different species name.
The conidia of this isolate were darker in colour than in the O. maius isolates and the
broad wrinkles on the perispore gave the conidia a slightly flat-sided or truncate
appearance with the light microscope, a feature characteristic of O. truncatum (Barron
1962). Identification of this isolate remains tentative until a comparison can be made to
ex-type or authentic material.
Correlations among characters indicating subspecific taxa were not found in the
O. maius isolates. The three isolates from the fjell in Finland (F-01, F-02, and F-03)
395
were no more similar to each other than to the North American isolates. The three
Finnish isolates had shorter than average conidiophores but there was considerable
variation in this character. Their growth rates and enzymatic abilities were similar to
each other but also to many of the North American isolates. Similarly, there were no
correlations among isolates from bogs or from sand hills. The three isolates from bogs
(BS-DCMP, UAMH 1540, and UAMH 8920) had conidiophores that were longer than
average but there was considerable variation among them and the variation among their
growth rates and enzymatic abilities was comparable to that among all 21 isolates. Even
isolates obtained from the same study sites varied considerably in their morphology and
physiology. For example, the three isolates from the disturbed hilltop near Fort McKay,
Alberta (S4-P3-P-4, S4-P4-C-1, and S4-P6-C-1) showed variable growth rates and
enzymatic abilities, as did the two isolates from the pine forest near Fort McMurray,
Alberta (S1-P3-C-1 and S1-P6-C-1). Likewise, host plant of origin had no apparent
correlation with morphological and physiological traits. The isolates obtained from the
roots of Vaccinium myrtilloides spanned most of the range of variability present among
all 21 isolates and did not differ substantially from isolates from other plants and
substrates.
Enzymatic tests indicate that O. maius can degrade lignin and cellulose. This is
compatible with its predilection for roots and decaying plant material. Its ability to
degrade other substrates, including chitin, pectin, and gelatin, is compatible with
previous work showing that Hymenoscyphus ericae, another ericoid mycorrhizal fungus,
is enzymatically diverse and can attack complex forms of organic nitrogen (Read 1983,
Leake & Read 1989, Leake & Read 1990). It has been proposed that enzymatic
diversity among ericoid mycorrhizal fungi enables host plants to thrive in harsh, nutrient
poor, acidic environments (Hambleton & Currah 2000). However, because it took eight
months for positive reactions to occur on the chitin azure, possibly due to the coarse
nature of the substrate, this is not a practical test for routine work.
The 21 O. maius isolates were uniformly acidophilous, growing optimally at pH
3. This character correlates well with the observation that O. maius is frequently
isolated from acidic habitats, such as bogs. Hambleton and Currah (1997) reported that
O. maius was proportionally more common among ericoid mycorrhizal endophytes in
roots of plants growing in bog habitats than in alpine and sand dune habitats.
Conversely, the more alkaline sand dune habitats had a greater relative abundance of
Phialocephala fortinii than O. maius (Hambleton & Currah 1997). These relative
abundance data probably reflect the acidophilous nature of O. maius and a higher pH
optimum of P. fortinii (unpublished data).
No correlations were found among morphological and pee local variants as
indicated by the lack of support in clustering analyses. In addition, the morphological
and physiological variation was not linked to specific substrates, hosts, or geographical
locations. This level of variation among isolates indicates sexual recombination is
probably occurring although a sexual stage for O. maius, expected in the genus
Myxotrichum, has not yet been described. The ascomata of other species in
Myxotrichum are minute (less than 1 mm diam.), cleistothecial, and are only rarely
found in nature (Currah 1985) or in culture (Uchiyama, Kamiya & Udagawa 1995,
Udagawa & Uchiyama 1999, Lumley, Abbot & Currah 2000). Greater attention to the
physiological requirements of the O. maius anamorph may lead to the discovery of the
teleomorph and an explanation of the variation in the taxon.
396
AKNOWLEDGEMENTS
Thanks are extended to Grace Hill-Rackette, Markus Thormann, and Trevor Lumley for
providing isolates. Drs. S. Tokumasu and S. Perrotto provided useful comments on
earlier versions of this m.s. This project was funded by a Natural Science and
Engineering Research Council of Canada (NSERC) grant to R. S. C. and an NSERC
Undergraduate Research Award to A. V. R.
LITERATURE CITED
Barron, G. L. (1962). New species and new records of Oidiodendron. Canadian Journal of Botany 40: 589-607.
Couture, M., Fortin, J. A. & Dalpé, Y. (1983). Oidiodendron griseum Robak: an endophyte of ericoid mycorrhizae in
Vaccinium spp. New Phytologist 95: 375-380.
Currah, R. S. (1985). Taxonomy of the Onygenales: Arthrodermataceae, Gymnoascaceae, and Onygenaceae.
Mycotaxon 24: 1-216.
Currah, R. S., Tsuneda, A. & Murakami, S. (1993). Conidiogenesis in Oidiodendron periconioides. Canadian
Journal of Botany 71: 1481-1485.
Currah, R. S., Niemi, M. & Huhtinen, S. (1999). Oidiodendron maius and Scytalidium vaccinii from the mycorrhizas
of Ericaceae in northern Finland. Karstenia 39: 65-68.
Domsch, K. H., Gams, W. & Anderson, T. H. (1980). Compendium of Soil Fungi Volume 1. Academic Press Inc.,
London.
Douglas, G. C., Heslin, M. C. & Reid, C. (1989). Isolation of Oidiodendron maius from Rhododendron and
ultrastructural characteristics of synthesized mycorrhizas. Canadian Journal of Botany 67: 2206-2212.
Hambleton, S. & Currah, R. S. (1997). Fungal endophytes from the roots of alpine and boreal Ericaceae. Canadian
Journal of Botany 75: 1570-1581.
Hambleton, S. & Currah, R. S. (2000). Molecular characterizarion of the mycorrhizas of woody plants. In Molecular
Biology of Woody Plants (S. M. Jain & S. C. Minocha): 351-373. Kluwer Academic Publishers, The
Netherlands.
Hambleton, S., Egger, K. N. & Currah, R. S. (1998). The genus Oidiodendron: species delimitation and phylogenetic
relationships based on nuclear ribosomal DNA analysis. Mycologia 90: 854-869.
Hutchison, L. J. (1990). Studies on the systematics of ectomycorrhizal fungi in axenic culture. II. The enzymatic
degradation of selected carbon and nitrogen compounds. Canadian Journal of Botany 68: 1522-1530.
Leake, J. R. & Read, D. J. (1989). Biology of mycorrhiza in the Ericaceae. XIII. Some characteristics of the
extracellular proteinase activity of the ericoid endophyte Hymenoscyphus ericae. New Phytologist 112: 69-
76.
Leake, J. R. & Read, D. J. (1990). Chitin as a nitrogen source for mycorrhizal fungi. Mycological Research 94: 993-
995. :
Lumley, T. C., Abbott, S. P. & Currah, R. S. (2000). Microscopic ascomycetes isolated from rotting wood in the
boreal forest. Mycotaxon 74: 395-414.
Read, D. J. (1983). The biology of mycorrhizas in the Ericales. Canadian Journal of Botany 61: 985-1004.
Sigler, L. (1993). Preparing and mounting slide cultures. In Clinical Microbiology Handbook (H. D. Isenderg, ed.):
6.12.1-6.12.4. American Association for Microbiology, Washington, D.C.
Smith, R. E. (1977). Rapid tube test for detecting fungal cellulase production. Applied Environmental Microbiology
33: 980-981.
Stoyke, G. & Currah, R. S. (1991). Endophytic fungi from the mycorrhizae of alpine ericoid plants. Canadian
Journal of Botany 69: 347-352.
Tokumasu, S. (1973). Notes on Japanese Oidiodendron (Japanese Microfungi II). Transactions of the Mycological
Society of Japan 14: 246-255.
Uchiyama, S., Kamiya, S. & Udagawa, S.-I. (1995). A new variety of Myxotrichum ochraceum from Japanese soil.
Mycoscience 36: 289-292.
Udagawa, S.-I. & Uchiyama, S. (1999). Taxonomic studies on new or critical fungi of non-pathogenic Onygenales 2.
Mycoscience 40: 291-305.
Untereiner, W. A. & Malloch, D. (1999). Patterns of substrate utilization in species of Capronia and allied black
yeasts: ecological and taxonomic implications. Mycologia 91: 417-427.
Xiao, G. & Berch, S. M. (1992). Ericoid mycorrhizal fungi of Gaultheria shallon. Mycologia 84: 470-471.
MYCOTAXON
Volume LXXIX, pp. 397-399 July-September 2001
WENYINGIA, A NEW GENUS IN PEZIZALES (OTIDEACEAE)
ZHENG WANG
Systematic Mycology & Lichenology Laboratory
Institute of Microbiology, Chinese Academy of Sciences
Beying 100080, P. R. China
and
DONALD H. PFISTER
Farlow Reference Library and Herbarium of Cryptogamic Botany
Harvard University Herbaria, 22 Divinity Avenue
Cambridge, MA 02138, U. S. A.
ABSTRACT A new genus Wenyingia (Otideaceae, Pezizales), based on Wenyingia sichuanensis, a
new species, is reported from western Sichuan, China. An unusual membrane covering the hymenium,
the structure and origin of which are discussed in this paper, distinguishes this genus from others in the
family. The structure of the excipulum, size, shape and ornamentation of spores and pigmentation of
the apothecia place this genus close to TJarzetta.
KEY WORDS: Discomycetes, China
INTRODUCTION
Many fungi were collected in western Sichuan Province in China in the summer of 1997
by botanists and mycologists from the Harvard University Herbaria, the Institute of
Botany, Chinese Academy of Sciences and the Institute of Microbiology, Chinese
Academy of Sciences. Among the specimens collected, we found a fungus that could not
be placed in any existing genus of the Pezizales. It is described here as a new genus.
Wenyingia sichuanensis Zheng Wang & Pfister, gen. et sp. nov. Fig. 1
Apothecia cupulata, stipitata, brunneloa, usque 10mm diam, 22mm altitudo. Excipulum
ectal e cellulis brunneloa, angularibus 5-20um diam (textura angulari), excipulum
medullare ex hyphis brunneae. Compositum. Asci octospori, crasse tunicati, cylindracei,
398
270-295 x 13.5-l6yum. Ascospori ellipsoidei, biguttulati, 19-21.5 x 11-12um.
Apothecia cupulate, stiptate, outside pale-brown to buff, up to 10mm diam, 22mm high
when fresh; strongly concave when dry. Hymenium 250um thick, dark-brown when dry,
covered by a thin, white, spider web-like membrane originating from parallel hyphae at
the margin, hyphae forming the covering 10-21,m diam. Ectal excipulum of textura
angularis, ca (65-) 85-100um thick; cells brownish, 5-20u1m diam. Medullary
excipulum of textura intricata, brown, 75-150um thick. Asci 8-spored, operculate, thick
walled, J-, cylindrical, tapering to the base, ca 270-295 x 13.5-l6um. Ascospores
ellipsoid to ovoid, with two conspicuous oil drops, smooth-walled, 19-21.5 x 11-12um.
Paraphyses cylindrical, septate, prominently branched midway, 2-3pm wide below,
4-6um above, sometimes slightly swollen and deformed at apex.
Holotype: CHINA, Sichuan Province, Luding Xian, Gongga Shan, Camp 2, mixed
broad-leaved deciduous forest with Picea and Taxus, 29°35'11"N, 102°1'40"E, on bare
soil, 19 Aug 1997, Zheng Wang (2088) (HMAS 75909, isotype: FH)
Etymology: Wenyingia, in honor of Professor Wen-ying Zhuang, discomycetes specialist
and leader of the Systematic Mycology and Lichenology Laboratory, Chinese Academy
of Sciences.
COMMENTS
The most distinctive aspect of Wenyingia sichuanensis is the presence of a very thin
membrane covering the hymenium. It initially appeared to be the remains of a spider's
web. Such a covering on a mature member of the Pezizales in unusual. The excipular
layers are distinct delimited and the ectal excipulum is composed of distinctive angular
cells. These features, along with the absence of carotenoid pigments place Wenyingia in
the Otideaceae, close to Zarzetta. In addition, the ascospores are smooth, and there are
two prominent guttules; these are characters shared with Zarzetta (Cooke) Lamb. and
Otidea (Pers.) Bonord.
The most apparent and important difference between this species and all other genera in
Otideaceae is the membrane mentioned above. The membrane forms a continuous layer
over the hymenium and is not broken at maturity. It appears to be a barrier to ascospore
discharge. Discharge of ascospores was not observed nor were functional opercula.
There is little evidence in the ascocarp to suggest a specialized discharge/dispersal
apparatus or mechanism. Research on living material will be necessary for the biology of
this fungus to be understood. From anatomical sections we found that the membrane is
part of a layer continuous with the cells at the margin of the disc. It forms a dome, which
encloses the entire hymenium. Although the interpretation of this structure is uncertain in
regards to development or phylogeny, its presence provides reasonable justification for
recognition of this taxon at the level of genus. There seems to be no epigeous or
hypogeous taxon to which this material might be referred.
399
tn)
Y
vie
Nha
MG}
aH
|
[|
WED
Fig 1. Wenyingia sichuanensis (HMAS 75909) a) apex of ascus and paraphyses b) base of ascus .c)
ascospores d) excipulum near margin and towards the base. scale = 20pm.
ACKNOWLEDGEMENTS
The authors appreciate support from the National Science Foundation, grant DEB-97-05795 to
Michael Donoghue for field work in Sichuan, China, and also DEB-9521944 to Donald Pfister.
Thanks are also due to Dr. Amy Rossman for review of the manuscript, and the Institute of
Biology, Chengdu, Chinese Academy of Sciences, for hosting us in Sichuan, Professor Kaipu Yin
for his smooth organization of the field expedition, and the Systematic Mycology and
Lichenology Laboratory, Chinese Academy of Sciences, and Professor Wen-Ying Zhuang for
enthusiastically supporting this trip and for providing funds from her own research grants. The
senior author would like to express his deep gratitude to the other members of the field expedition,
including David E. Boufford, Michael J. Donoghue, David Hibbett, Yu Jia and Rick Ree for their
encouragement and support which made the field and herbarium work possible.
to
=
MY COTAXON
Volume LXXIX, pp. 401-415 July-September 2001
COMPLEMENTS A L’INVENTAIRE DES
BASIDIOMYCETES DE GRECE
Zacharias Athanassiou! et Ioanna Theochari?
' Institut d’Education Te echnologique de Larissa, Annexe de Karditsa, Terma Mavromichali,
43100 Karditsa, Gréce (e-mail: z.athan@teilar. gr)
? Institut National de Recherche Agronomique, Station des Recherches sur les Champignons,
411 10 Larissa, Gréce (e-mail: mrsl@bee.gr).
Resumé
Dans ce travail sont présentées 190 espéces de Basidiomycetes, inventoriées pour la premiére fois
en Gréce. Ces espéces ont été collectées et identifiées a la suite des prospections réalisées surtout dans des
écosystémes forestiers de la Gréce centrale, sur la période 1994-1999, pendant laquelle 485 espéces ont
été déterminées au total.
Les résultats de ce travail nous incitent 4 continuer l’effort de prospection dans d’autres
peuplements forestiers dans le reste du pays, afin de contribuer a établir une liste compléte de la mycoflore
grecque.
Abstract
In the present work, 190 Basidiomycetes species recorded for the first time in Greece are
presented. These species have been collected during surveys mainly realised in forest ecosystems of
central Greece in the period 1994-1999 resulting in the determination of a total number of 485 species.
The results incite us to realise more surveys in other forest communities over the rest of the
country in order to contribute to the preparation of an updated list of the Greek mycoflora.
Key-Words: biodiversity, Greece, macromycetes, mycoflora, new records.
INTRODUCTION
La biodiversité des macromycétes (Basidiomycetes et Ascomycétes) constitue
pour les écosystémes forestiers un indicateur important de stabilité écologique et de
situation sanitaire, étant donné le rdle fondamental que les champignons jouent dans les
équilibres biologiques de biocénoses diverses. En effet, les espéces saprotrophes
décomposent la matiére organique morte et participent de cette fagon au recyclage des
éléments minéraux de la nature. D’autre part, les espéces symbiotiques assurent la
symbiose mycorhizienne, qui contribue considérablement a une nutrition mineérale
améliorée des plantes partenaires. La détermination de la macroflore fongique est donc
un préalable indispensable pour |’ étude de cette biodiversité.
Dans notre pays un effort d’inventaire de la mycoflore endémique dans
différentes régions a été réalisé au cours des derniéres décennies (Avtzis & Diamandis,
1988 ; Athanassiou & Theochari, 1999 ; Diamandis, 1983, 1985, 1992 ; Diamandis &
Minter, 1981, 1983 ; Diamandis & Perlerou, 1990, 1994 ; Keltemlidis, 1990 ; Pantidou,
1980, 1990 ; Pantidou & Gonou, 1984 ; Pantidou & Watling, 1970). Citons aussi un
autre travail remarquable, réalisé antérieurement (Maire & Politis, 1940). Les espéces
détérminées au cou.s de ces travaux représentent un nombre trés faible par rapport aux
402
Tableau 1. Carte géographique de la Gréce avec les régions prospectées.
403
Roche-
mére
Régions Sites prospectées
640 m Péridotites
Péridotites
Futaie pure de Pinus nigra J. F. Arnold a Kerassia
Futaie mixte d’Abies borisii-regis Mattf. (elle est considérée
comme un hybride entre Abies cephalonica Loudon et Abies
alba Mill.), de Pinus nigra J. F. Arnold et de Quercus spp. a
Kerassia
Futaie mixte de Quercus spp. et d’Abies borisii-regis Mattf. a 530 m_| Péridotites
Papades 3
et calcaire
Futaie pure de Quercus frainetto M. Tenore a Papades 520m_ | Péridotites
et calcaire
Futaie mixte de Pinus nigra J. F. Arnold, de Pinus halepensis atin Perdoutes
Mill. et de Quercus frainetto M. Tenore a Papades etenlenire
Futaie pure de Pinus halepensis Mill. a Vassilika 200 m_ | Péridotites
et calcaire
ies pure de Fagus moesiaca (Maly) Domin au mont Sohities
ssavos
Futaie mixte de Fagus moesiaca (Maly) Domin et de GES ait lidichistes
Castanea sativa Mill. au mont Kissavos
Plantation de Castanea sativa Mill. au mont Kissavos Schistes
Plantation de Pinus nigra J. F. Arnold dans une futaie de GAO Wali Schistes
Fagus moesiaca (Maly) Domin au mont Kissavos si
Futaie mixte de Fagus moesiaca (Maly) Domin et d’Abies 730i F Schistes
borisii- regis Mattf. au mont Kissavos
Futaie de différentes espéces de Quercus au mont Kissavos Schistes
Futaie pure d’ Abies borisii-regis Mattf. au lac de Megdova Flysch
Futaie mixte d’Abies borisii-regis Mattf. et de Quercus Fivsch
frainetto M. Tenore au lac de Megdova
Futaie pure de Quercus spp. au lac de Megdova Flysch
Futaie pure de Quercus spp. a la region de Karditsa Calcaire
Futaie pure d’ Abies borisii-regis Mattf. 4 Pertouli 1100m_ | Flysch
Plantation de Pinus nigra J. F. Arnold dans une futaie d’ Abies 1100 Flysch
borisii-regis Mattf. a Pertouli He tae
Alluvions
Plantation pure de Pinus brutia Ten. a Larissa
Plantation mixte de Pinus brutia Ten. et de Cupressus :
65m _ | Alluvions
Ile d’Eubée
Thessalie
sempervirens L. a Larissa
Plantation de Pinus pinaster Aiton au mont Pélion 400 m
Karpenissi Futaie pure d’ Abies borisii-regis Mattf. 4 Karpenissi 1350 m
Tableau 2. Caractéristiques des régions prospectées.
Schistes
Flysch
404
espéces inventoriées dans d’autres pays d’Europe ; elles ont été présentées récemment,
dans leur ensemble, par Zervakis (Zervakis et al., 1998).
Dans le présent travail, nous citons, pour la premiére fois en Gréce, un certain
nombre d’espéces de Basidiomycetes. L’inventaire a surtout été réalisé dans des
écosystémes forestiers des régions sélectionnées de la Gréce centrale et sur la période
1994-1999. La détermination des espéces a été basée sur des caractéres macro-et
microscopiques et elle a été réalisée a |’aide d’ouvrages qui traitent de la macroflore
fongique (Breitenbach & Kranzlin, 1984 ; Courtecuisse & Duhem, 1994 ; Marchand
1971-1989, etc.). Citons que la plupart de ces espéces ont été photographiées sur place ;
des spéciments séchés, pour un nombre trés limité d’ espéces, existent aussi dans notre
herbier.
RESULTATS
Nous présentons, ci-dessous, 190 espéces inventoriées pour la premiere fois en
Gréce, réparties en ordres et familles selon la classification du Dictionary of Fungi
(Hawksworth et al., 1995). A l’intérieur de chaque famille les espéces sont présentées
par ordre alphabétique. Pour chaque taxon, nous citons aussi leur(s) habitat(s). Outre ces
espéces nouvelles pour la Gréce, nous avons aussi retrouvé, durant cette période de
prospection, 295 espéces déja mentionnées dans des travaux antérieurs.
Les régions prospectées sont localisées sur la carte géographique de la Gréce,
presentée dans le tableau 1. Des caractéristiques écologiques des peuplements forestiers
de ces régions sont référées dans le tableau 2.
Agaricales
Agaricaceae
Agaricus bitorquis (Quél.) Sacc.. Prairie a coté de Karditsa (Thessalie).
Agaricus essettei Bon (= Ps. abruptibulba ss. auct europ.). Futaie pure de Fagus
moesiaca au mont Kissavos (Thessalie) ; futaie pure d’Abies borisii-regis 4 Pertouli
(Thessalie) ; futaie mixte d’Abies borisii-regis et de Quercus frainetto au lac de
Megdova (Thessalie).
Agaricus niveolutescens Huijsman. Endroit herbeux dans une futaie mixte d’ Abies
borisii-regis et de Quercus frainetto au lac de Megdova (Thessalie).
Agaricus pampeanus Speg.. Prairie 4 coté d’une futaie pure d’ Abies borisii-regis au lac
de Megdova (Thessalie).
Lepiota brunneoincarnata Chodat & Mart.. Lisiére d’une plantation pure de Pinus
brutia et plantation mixte de Pinus brutia et de Cupressus sempervirens a Larissa.
Lepiota clypeolaria (Bull.) Quél.. Futaie mixte d’Abies borisii-regis et de Quercus
frainetto au lac de Megdova (Thessalie).
Lepiota grangei (Eyre) J. E. Lange (= Lepiotula grangei). Endroit herbeux a cété d’une
plantation pure de Pinus brutia a Larissa (Thessalie).
Lepiota ignivolvata Joss.. Futaie mixte d’ Abies borisii- regis et de rere frainetto au
lac de Megdova (Thessalie) ; futaie pure d’ Abies borisii-regis 4 Pertouli (Thessalie) ;
futaie mixte de Quercus spp. et d’ Abies borisii-regis 4 Papades (ile d’Eubée).
Leucoagaricus melanotrichus (Malengon & Bertault) Trimbach. Futaie pure de
Quercus spp. a la région de Karditsa (Thessalie).
Macrolepiota fuliginosa (Barla) Bon. Futaie mixte d’ Abies borisii-regis, de Pinus nigra
et de Quercus spp. a Kerassia (ile d’Eubée).
405
Macrolepiota rickenii (Velen.) Belli & Lanzoni (= M. gracilenta). Lisiére herbeuse
dans une futaie pure d’ Abies borisii-regis a Pertouli (Thessalie).
Sericeomyces subvolvatus (Malengon & Bertault) Bon. Plantation pure de Pinus brutia
a Larissa (Thessalie).
Amanitaceae
Amanita battarae (Boud.) Bon. Futaie pure de Quercus spp. au lac de Megdova
(Thessalie).
Amanita ceciliae (Berk. & Broome) Bas (= A. strangulata = A. inaurata). Clairiére dans
une futaie mixte d’Abies borisii-regis et de Quercus frainetto au lac de Megdova
(Thessalie) ; plantation de Castanea sativa au mont Kissavos (Thessalie) ; clairiére dans
une futaie pure d’ Abies borisii-regis a Pertouli (Thessalie).
Amanita spissa (Fr.) P. Kumm.. Futaie pure d’ Abies borisii-regis a Pertouli (Thessalie) ;
futaie mixte de Fagus moesiaca et de Castanea sativa au mont Kissavos (Thessalie).
Amanita submembranacea (Bon) Gréger. Futaie mixte de Quercus spp. et d’Abies
borisii-regis a Papades (ile d’Eubée).
Amanita verna Fr.. Plantation de Castanea sativa au mont Kissavos (Thessalie).
Amanita vittadinii Moretti. Sous Pinus brutia et dans une prairie a Larissa (Thessalie).
Entolomataceae
Entoloma lividum (Bull.) Fr. (= E. eulividum). Futaie pure de Quercus spp. au lac de
Megdova (Thessalie) ; futaie mixte d’ Abies borisii-regis, de Pinus nigra et de Quercus
spp. a Kerassia ; futaie mixte de Quercus spp. et d’Abies borisii-regis 4 Papades (ile
d’Eubée).
Entoloma pseudoturbidum (Romagn.) M. M. Moser. Clairiére dans une futaie mixte de
Quercus frainetto et d’ Abies borisii-regis au lac de Megdova (Thessalie).
Entoloma undatum (Fr.) M. M. Moser. Pelouse a cété dune plantation mixte de Pinus
brutia et de Cupressus sempervirens a Larissa (Thessalie).
Entoloma vernum S. Lundell. Futaie pure d’ Abies borisii-regis a Pertouli (Thessalie).
Hygrophoraceae
Hygrocybe spadicea (Scop.) P. Karst.. Clairiére herbeuse dans une futaie pure de
Quercus spp. au lac de Megdova (Thessalie).
Hygrocybe tristis (Pers.) F. H. Moller (= H. pseudoconica var. tristis). Clairiére
herbeuse dans une futaie mixte d’ Abies borisii-regis et de Quercus frainetto au lac de
Megdova (Thessalie) ; clairiére herbeuse dans une futaie pure de Pinus nigra a Kerassia
(ile d’ Eubée).
Hygrophorus gliocyclus Fr. (= H. flavodiscus). Futaie mixte de Pinus nigra, de Pinus
halepensis et de Quercus frainetto 4 Papades (ile d’Eubée).
Hygrophorus latitabundus Britzelm. (= H. limacinus). Futaie mixte de Quercus spp. et
@ Abies borisii-regis a Papades (ile d’Eubée).
Strophariaceae
Panaeolus acuminatus (Schaeff.) Quél. (= P. caliginosus). Clairiére herbeuse dans une
futaie mixte d’Abies borisii-regis, de Pinus nigra et de Quercus spp. a Kerassia (ile
d’Eubée).
406
Tricholomataceae
Clitocybe catinus Fr.. Futaie pure d’ Abies borisii-regis 4 Karpenissi.
Clitocybe costata Kihner & Romagn.. Futaie mixte d’Abies borisii-regis et de Quercus
frainetto, futaie pure de Quercus spp. au lac de Megdova (Thessalie) ; futaie mixte
d’Abies borisii-regis, de Pinus nigra et de Quercus spp. a Kerassia (ile d’Eubée) ;
plantation de Pinus nigra dans une futaie de Fagus moesiaca au mont Kissavos
(Thessalie).
Clitocybe geotropa (Bull.) Fr.. Futaie mixte d’Abies borisii-regis, de Pinus nigra et de
Quercus spp. a Kerassia (ile d’Eubée).
Clitocybe langei Singer ex Hora. Futaie pure d’ Abies borisii-regis 4 Karpenissi.
Clitocybe umbilicata (Schaeff.) P. Kumm.. Futaie pure d’Abies borisii-regis a
Karpenissi.
Collybia butyracea var. asema Quél.. Plantation de Pinus nigra dans une futaie de
Fagus moesiaca au mont Kissavos (Thessalie).
Collybia extuberans Fr.. Sur souche pourrie dans une futaie mixte d’ Abies borisii-regis,
de Pinus nigra et de Quercus spp. a Kerassia (ile d’Eubée).
Collybia maculata (Alb. & Schwein.) Quél.. Futaie pure de Pinus nigra a Kerassia (ile
d’Eubée) et futaie pure de Fagus moesiaca au mont Kissavos (Thessalie).
Collybia peronata (Bolton) P. Kumm. (= M. urens). Futaie mixte de Fagus moesiaca et
d’ Abies borisii-regis au mont Kissavos (Thessalie) ; futaie pure de Quercus spp., futaie
pure et futaie mixte d’Abies borisii-regis et de Quercus frainetto au lac de Megdova
(Thessalie).
Echinoderma carinii (Bres.) Bon. Plantation de Pinus brutia a Larissa (Thessalie).
Hohenbuehelia atrocaerulea (Fr.) Singer. Sur tronc de Platanus orientalis dans une
plantation de Pinus pinaster au mont Pélion (Thessalie).
Hohenbuehelia myxotricha (Lév.) Singer. Sur souche pourrie dans une futaie pure
d’ Abies borisii-regis au lac de Megdoba (Thessalie).
Lepista densifolia (J. Favre) Singer & Clémengon. Futaie mixte d’ Abies borisii-regis, de
Pinus nigra et de Quercus spp. a Kerassia (ile d’Eubée) ; futaie mixte d’ Abies borisii-
regis et de Quercus frainetto au lac de Megdoba (Thessalie).
Lepista sordida var. lilacea (Quél.) Bon. Prairie a Larissa.
Lyophyllum leucophaeatum (P. Karst.) P. Karst.. Clairiére dans une futaie mixte de
Quercus frainetto et d’ Abies borisii-regis au lac de Megdova (Thessalie) ; plantation de
Pinus brutia a Larissa (Thessalie).
Lyophyllum transforme (Britzelm.) Singer (= L. trigonosporum). Clairiére dans une
futaie mixte d’ Abies borisii-regis et de Quercus frainetto au lac de Megdova (Thessalie).
Macrocystidia cucumis (Pers.) Fr.. Futaie pure de Pinus halepensis a Vassilika (ile
d’Eubée).
Marasmius cohaerens (Alb. & Schwein.) Cooke & Quél.. Futaie pure d’ Abies borisii-
regis a Pertouli et au lac de Megdova (Thessalie).
Melanoleuca brevipes (Bull.) Pat.. Prairie 4 Lazarina (Thessalie).
Melanoleuca decembris Métrod ex Bon. Plantation pure de Pinus brutia a Larissa.
Melanoleuca evenosa (Saccardo) Konrad. Endroit herbeux d’une plantation de Pinus
nigra dans une futaie de Fagus moesiaca au mont Kissavos (Thessalie).
Melanoleuca iris Kihner. Prairie 4 Lazarina (Thessalie).
Melanoleuca meridionalis G. Moreno & Barrasa. Parmis des cistes d’une futaie pure de
Pinus nigra a Kerassia (ile d’Eubée).
Melanoleuca pseudolucina Bon. Pelouse a cété d’une plantation de Pinus brutia et de
407
Cupressus sempervirens a Larissa (Thessalie).
Melanoleuca subpulverulenta (Pers.) Singer. Clairiére dans une futaie pure d’ Abies
borisii-regis au lac de Megdova (Thessalie).
Mycena diosma Krieglst. & Schwobel. Futaie mixte d’ Abies borisii-regis et de Quercus
frainetto au lac de Megdova (Thessalie).
Mycena epipterygia var. pelliculosa (Fr.) Maas Geest. (= M. pelliculosa). Futaie pure
d’ Abies borisii-regis 4 Karpenissi et a Pertouli (Thessalie).
Mycena leptocephala (Pers.) Gillet (= M. chlorinella). Futaie pure de Pinus nigra a
Kerassia (ile d’Eubée) ; futaie de Quercus spp. au lac de Megdova (Thessalie).
Mycena pura f. alba (Gillet) Arnolds. Futaie mixte d’ Abies borisii-regis, de Pinus nigra
et de Quercus spp. a Kerassia (ile d’Eubée).
Mycena renati Quél. (= M. flavipes = M. luteoalcalina). Sous Arbutus unedo a
Koutsoupia (Thessalie) ; futaie pure de Quercus frainetto a Kerassia (ile d’ Eubée).
Mycena zephirus (Fr.) Quél.. Futaie mixte d’Abies borisii-regis et de Quercus frainetto
au lac de Megdova (Thessalie).
Oudemansiella melanotricha (Dérfelt.) M. M. Moser. Sur bois enfoui dans une futaie
pure d’Abies borisii-regis a Pertouli (Thessalie) ; futaie pure de Pinus nigra a Kerassia
(ile d’Eubée) ; clairiére d@ une futaie mixte d’Abies borisii-regis et de Quercus frainetto
au lac de Megdova (Thessalie).
Pseudoomphalina clusiliformis (Kthner & Romagn.) Bon (= Collybia clusilis p.p.).
Endroit herbeux dans une futaie mixte d’Abies borisii-regis et de Quercus frainetto au
lac de Megdova (Thessalie).
Tricholoma album (Schaeff.) Fr.. Futaie pure de Fagus moesiaca au mont Kissavos
(Thessalie) ; futaie mixte de Quercus frainetto et d’Abies borisii-regis au lac de
Megdova (Thessalie). ;
Tricholoma bufonium (Pers.) Fr.. Futaie pure d’Abies borisii-regis a Pertouli
(Thessalie) et 4 Karpenissi.
Tricholoma focale (Fr.) Ricken. Futaie mixte de Pinus nigra, de Pinus halepensis et de
Quercus frainetto 4 Papades (ile d’ Eubée).
Tricholoma fucatum var. subglobisporum (Bon) Bon. Parmi des mousses d’une
plantation de Pinus nigra dans une futaie de Fagus moesiaca au mont Kissavos
(Thessalie).
Tricholoma myomyces (Pers.) J. E. Lange. Lisiére d’une futaie pure de Pinus nigra et
d’une futaie mixte d’ Abies borisii-regis, de Pinus nigra et de Quercus spp. 4 Kerassia
(ile d’Eubée).
Tricholoma pardinum Quél. (= T. tigrinum = T. pardalotum). Futaie mixte d’ Abies
borisii-regis et de Quercus frainetto au lac de Megdova (Thessalie).
Tricholoma pessundatum (Fr.) Quél.. Futaie pure d’Abies borisii-regis au lac de
Megdova et a Pertouli (Thessalie).
Tricholoma pseudoalbum Bon. Futaie mixte de Quercus spp. et d’Abies borisii- regis a
Papades (ile d’Eubée).
Tricholoma pseudonictitans Bon. Futaie mixte de Quercus frainetto et d’ Abies borisii-
regis au lac de Megdova (Thessalie) ; futaie mixte de Pinus nigra, de Pinus halepensis
et de Quercus frainetto 4 Papades (ile d’Eubée).
Tricholoma saponaceum var. ardosiacum Bres.. Futaie mixte d’Abies borisii-regis et
de Quercus frainetto au lac de Megdova (Thessalie).
Tricholoma saponaceum var. squamosum (Cooke) Rea. Futaie pure d’ Abies borisii-
regis a Pertouli (Thessalie) et 4 Karpenissi.
Tricholoma sejunctum var. coniferarum Bon. Futaie pure de Pinus nigra a Kerassia
408
(ile d’Eubée).
Tricholoma sulphureum var. coronarium Pers.. Futaie mixte d’ Abies borisii-regis, de
Pinus nigra et de Quercus spp. a Kerassia (ile d’ Eubée); futaie pure d’ Abies borisii-regis
a Karpenissi.
Boletales
Boletaceae
Aureoboletus gentilis (Quél.) Pouzar (= Pulveroboletus cramesinus). Clairiére dans une
futaie mixte d’ Abies borisii-regis et de Quercus frainetto au lac de Megdova (Thessalie).
Boletus fechtneri Velen.. Futaie pure de Fagus moesiaca au mont Kissavos (Thessalie).
Boletus legalliae Pilat (= B. splendidus = B. satanoides p.p.). Futaie pure de Quercus
“spp. au lac de Megdova (Thessalie).
Boletus luteocupreus Bertéa & Estadés. Futaie pure de Fagus moesiaca au mont
Kissavos (Thessalie).
Boletus pseudoregius (Hubert) Estadés. Futaie pure de Fagus moesiaca au mont
Kissavos (Thessalie).
Boletus radicans Gillet (= B. albidus). Clairiére dans une futaie mixte d’ Abies borisii-
regis et de Quercus frainetto au lac de Megdova (Thessalie).
Boletus rhodoxanthus (Krombh.) Kallenb.. Futaie pure de Fagus moesiaca au mont
Kissavos (Thessalie).
Leccinum crocipodium (Letell.) Watling (= L. tesselatum = L. nigrescens). Clairiére
dans une futaie mixte d’Abies borisii-regis et de Quercus frainetto au lac de Megdova
(Thessalie).
Xerocomaceae
Xerocomus leonis (D. A. Reid) Bon. Futaie pure de Quercus spp. et clairiére dans une
futaie mixte d’ Abies borisii-regis et de Quercus frainetto au lac de Megdova (Thessalie).
Cortinariales
Cortinariaceae
Cortinarius allutus Fr.. Futaie mixte d’ Abies borisii-regis, de Pinus nigra et de Quercus
spp. a Kerassia (ile d’ Eubée).
Cortinarius anomalus Fr.. Futaie mixte de Fagus moesiaca et d’ Abies borisii-regis au
mont Kissavos (Thessalie) ; futaie mixte d’Abies borisii-regis et de Quercus frainetto au
lac de Megdova (Thessalie).
Cortinarius anomalus f. lepidopus (Cooke) Konrad & Maubl.. Futaie mixte de Fagus
moesiaca et d’ Abies borisii-regis au mont Kissavos (Thessalie).
Cortinarius argyrophilus Rob. Henry. Futaie mixte de Fagus moesiaca et d’ Abies
borisil-regis ; plantation de Pinus nigra dans une futaie de Fagus moesiaca au mont
Kissavos (Thessalie).
Cortinarius bulbosus (Sowerby) Fr.. Futaie pure de Pinus nigra a Kerassia (ile
d’Eubée).
Cortinarius bulliardii (Pers.) Fr.. Futaie mixte d’Abies borisii-regis et de Quercus
frainetto au lac de Megdova (Thessalie).
Cortinarius callisteus Fr.. Futaie mixte de Quercus spp. et d’Abies borisii- regis a
Papades (ile d’Eubée).
409
Cortinarius calochrous (Pers.) Fr.. Futaie mixte de Quercus spp. et d’ Abies borisii-regis
a Papades (ile d’ Eubée).
Cortinarius caninus Fr.. Futaie pure et mixte d’Abies borisii-regis et de Quercus
frainetto au lac de Megdova (Thessalie).
Cortinarius claricolor var. subturmalis Bon & Gaugué (= C. turmalis ss. Bres.). Futaie
pure d’ Abies borisii-regis au lac de Megdova (Thessalie).
Cortinarius claricolor var. turmalis (Fr.) Quadr.. Futaie pure d’ Abies borisii-regis au
lac de Megdova (Thessalie).
Cortinarius claroflavus Rob. Henry. Futaie mixte d’ Abies borisii-regis et de Quercus
Jrainetto au lac de Megdova (Thessalie).
Cortinarius croceus (Schaeff.) Hgil.. Futaie pure d’Abies borisii-regis a Pertouli
(Thessalie).
Cortinarius cumatilis Fr.. Futaie pure de Pinus nigra a Kerassia (ile d’ Eubée).
Cortinarius diabolicus Fr.. Futaie pure de Fagus moesiaca au mont Kissavos
(Thessalie).
Cortinarius dibaphus var. nemorosus (Rob. Henry) Rob. Henry. Clairiére dans une
futaie mixte de Quercus frainetto et d’ Abies borisii-regis au lac de Megdova (Thessalie);
futaie mixte d’Abies borisii-regis, de Pinus nigra et de Quercus spp. a Kerassia (ile
d’Eubée).
Cortinarius duracinus var. raphanicus Mos.. Futaie mixte d’ Abies borisii-regis et de
Quercus frainetto au lac de Megdova (Thessalie) ; futaie mixte de Fagus moesiaca et
d Abies borisii-regis au mont Kissavos (Thessalie).
Cortinarius elegantior Fr.. Futaie pure d’ Abies borisii-regis a Pertouli (Thessalie).
Cortinarius elegantissimus Rob. Henry. Futaie mixte de Fagus moesiaca et d’ Abies
borisii-regis au mont Kissavos (Thessalie).
Cortinarius fasciatus Fr.. Clairiére dans une futaie mixte de Quercus frainetto et
d’ Abies borisii-regis au lac de Megdova (Thessalie) ; futaie pure de Pinus nigra a
Kerassia (ile d’Eubée).
Cortinarius mairei var. juranus Rob. Henry. Futaie pure d’Abies borisii-regis a
Pertouli (Thessalie).
Cortinarius melanotus Kalchbr.. Futaie pure d’ Abies borisii-regis a Pertouli
(Thessalie); futaie mixte d’ Abies borisii-regis et de Quercus frainetto au lac de
Megdova (Thessalie).
Cortinarius polymorphus Rob. Henry. Clairiére dans une futaie mixte de Quercus
frainetto et d’ Abies borisii-regis au lac de Megdova (Thessalie).
Cortinarius prasinocyaneus Rob. Henry. Futaie mixte de Quercus spp. et d’Abies
borisii-regis a Papades (ile d’Eubée) ; futaie pure d’Abies borisii-regis au lac de
Megdova (Thessalie).
Cortinarius purpurascens var. largusoides Cetto. Clairi¢re dans une futaie mixte de
Quercus frainetto et d’ Abies borisii-regis au lac de Megdova (Thessalie) ; futaie pure
d’ Abies borisii-regis 4 Karpenissi.
Cortinarius riculatus Fr.. Futaie mixte de Quercus spp. et d’Abies borisii- regis a
Papades (ile d’Eubée).
Cortinarius rufo-olivaceus (Pers.) Fr.. Futaie mixte de Quercus spp. et d’Abies borisii-
regis a Papades (ile d’ Eubée).
Cortinarius safranopes Rob. Henry. Clairiére dans une futaie mixte d’Abies borisii-
regis et de Quercus frainetto au lac de Megdova (Thessalie).
Cortinarius sodagnitus Rob. Henry. Futaie mixte de Quercus spp. et d’Abies borisii-
regis a Papades (ile d’ Eubée).
410
Cortinarius spadiceus Fr.. Futaie mixte de Fagus moesiaca et d’ Abies borisii-regis au
mont Kissavos (Thessalie).
Cortinarius suillus Fr.. Futaie mixte de Quercus spp. et d’ Abies borisii-regis a Papades
(ile d’Eubée).
Cortinarius turgidus Fr.. Futaie pure d’Abies borisii-regis a Pertouli et au lac de
Megdova (Thessalie).
Cortinarius venetus var. venetus Mos.. Futaie pure d’Abies borisii-regis a Pertouli
(Thessalie) ; futaie mixte d’Abies borisii-regis et de Quercus frainetto au lac de
Megdova (Thessalie).
Cortinarius violaceus (L.) Fr.. Futaie mixte d’ Abies borisii-regis et de Quercus frainetto
au lac de Megdova (Thessalie).
Cortinarius xanthophyllus (Cooke) Rob. Henry. Futaie pure de Quercus spp. au lac de
Megdova (Thessalie).
Gymnopilus picreus (Pers.) P. Karst. (= Flammula picrea). Plantation de Pinus nigra
dans une futaie de Fagus moesiaca au mont Kissavos (Thessalie) ; futaie pure d’ Abies
borisii-regis a Pertouli (Thessalie).
Hebeloma cistophilum Maire. Sous cistes, dans une futaie de Quercus spp. au mont
Kissavos (Thessalie).
Hebeloma fastibile (Pers.) S. Imai. Futaie pure de Pinus nigra a Kerassia (ile d’ Eubée).
Hebeloma leucosarx P. D. Orton. Futaie de Quercus spp. au mont Kissavos (Thessalie),
au bord d’un ruisseau.
Inocybe asterospora Quél.. Clairiére dans une futaie pure d’Abies borisii-regis a
Pertouli (Thessalie) ; clairiére dans une futaie mixte d’ Abies borisii-regis et de Quercus
frainetto au lac de Megdova (Thessalie).
Inocybe hirtella Bres.. Futaie mixte de Quercus frainetto et d’ Abies borisii-regis au lac
de Megdova (Thessalie).
Inocybe jurana Pat. (= I. adaequata). Futaie mixte d’ Abies borisii-regis, de Pinus nigra
et de Quercus spp. a Kerassia (ile d’ Eubée).
Inocybe nitidiuscula (Britzelm.) Lapl. (= J. friesii). Plantation pure de Pinus brutia et
plantation mixte de Pinus brutia et de Cupressus sempervirens a Larissa (Thessalie).
Inocybe phaeoleuca Kihner. Futaie pure de Quercus spp. au lac de Megdova
(Thessalie).
Inocybe pudica Kihner. Futaie mixte de Quercus frainetto et d’ Abies borisii-regis au
lac de Megdova (Thessalie) ; futaie mixte d’ Abies borisii-regis, de Pinus nigra et de
Quercus spp. a Kerassia (ile d’ Eubée).
Leucocortinarius bulbiger (Fr.) Singer (= Cortinellus bulbiger). Plantation de Pinus
nigra dans une futaie de Fagus moesiaca au mont Kissavos (Thessalie) ; plantation de
Pinus nigra dans une futaie pure d’ Abies borisii-regis 4 Pertouli (Thessalie) ; futaie pure
d’Abies borisii-regis 4 Pertouli (Thessalie) ; futaie mixte d’Abies borisii-regis et de
Quercus frainetto au lac de Megdoba (Thessalie).
Gomphales
Ramariaceae
Ramaria flaccida (Fr.) Bourdot. Futaie pure de Pinus nigra a Kerassia (ile d’ Eubée).
Ramaria gracilis (Pers.) Quél.. Futaie mixte d’ Abies borisii-regis, de Pinus nigra et de
Quercus spp. a Kerassia (ile d’Eubée).
Ramaria largentii Marr & D. E. Stuntz. Futaie mixte d’ Abies borisii-regis et de Quercus
frainetto au lac de Megdova (Thessalie).
411
Hymenochaetales
Hymenochaetaceae
Phellinus lundellii Niemela. Sur tronc de Prunus spp. 4 Karditsa (Thessalie).
Phellinus vorax (Harkn.) Cerny (= Daedalea vorax). Sur tronc de pin dans une futaie
mixte de Pinus nigra, de Pinus halepensis et de Quercus frainetto a Papades (ile
d’Eubée).
Poriales
Coriolaceae
Daedaleopsis confragosa (Bolton) J. Schrét. (= Trametes rubescens). Sur branches
mortes d’ Ailanthus altissima a Larissa (Thessalie).
Lenzites warnieri Durieu & Mont.. Sur Populus spp., dans la plaine de Thessalie.
Trametes ochracea (Pers.) Gilb. & Ryvarden (= T. multicolor = T. zonatella). Sur tronc
tombé de chéne dans une futaie mixte de Quercus spp. et d’ Abies borisii-regis 4 Papades
(ile d’Eubée).
Lentinaceae
Pleurotus dryinus (Pers.) Fr. (= P. corticatus = P. tephrotrichus). Sur tronc de hétre
dans une futaie pure de Fagus moesiaca ; sur tronc de hétre a une plantation de Pinus
nigra dans une futaie de Fagus moesiaca au mont Kissavos (Thessalie).
Polyporaceae
Polyporus melanopus (Pers.) Fr.. Sur bois mort de sapin dans une futaie pure d’ Abies
borisii- regis 4 Karpenissi.
Russulales
Russulaceae
Lactarius blennius f. viridis (Schrad.) Quél. Futaie pure de Fagus moesiaca et
plantation de Pinus nigra dans une futaie de Fagus moesiaca au mont Kissavos
(Thessalie).
Lactarius camphoratus (Bull.) Fr.. Clairiére dans une futaie mixte de Quercus frainetto
et d’ Abies borisii-regis au lac de Megdova (Thessalie).
Lactarius cimicarius (Batsch) Gill.. Futaie mixte d’Abies borisii-regis et de Quercus
frainetto au lac de Megdova (Thessalie).
Lactarius fuliginosus Fr.. Futaie de Quercus spp. au lac de Megdova (Thessalie).
Lactarius intermedius Krombh.. Futaie pure d’ Abies borisii-regis a Pertouli (Thessalie).
Lactarius luridus (Pers.) Fr.. Futaie mixte de Quercus frainetto et d’ Abies borisii-regis
au lac de Megdova (Thessalie).
Lactarius pubescens Fr. (= L. blumii = L. cilicioides). Clairiére dans une futaie mixte de
Quercus frainetto et d’ Abies borisii-regis au lac de Megdova (Thessalie).
Lactarius salmonicolor R. Heim & Leclair. Clairiére dans une futaie mixte de Quercus
frainetto et d’Abies borisii-regis au lac de Megdova (Thessalie) ; futaie pure d’ Abies
borisii-regis 4 Karpenissi.
4}2
Lactarius semisanguifluus R. Heim & Leclair. Futaie pure de Pinus nigra a Kerassia
(ile d’Eubée).
Lactarius sphagneti (Fr.) M. M. Moser. Dans des sphaignes a une futaie pure d’ Abies
borisii-regis a Pertouli (Thessalie).
Lactarius tesquorum Malengon. Futaie de Quercus spp. au mont Kissavos (Thessalie) ;
sous des cistes, dans une plantation de Pinus pinaster au mont Pélion (Thessalie).
Lactarius uvidus (Fr.) Fr.. Futaie mixte d’ Abies borisii-regis et de Quercus frainetto au
lac de Megdova (Thessalie).
Lactarius vinosus Quél.. Futaie pure de Pinus nigra a Kerassia (ile d’ Eubée).
Russula adulterina Secr.. Futaie mixte d’ Abies borisii-regis et de Quercus frainetto au
lac de Megdova (Thessalie) ; futaie pure de Pinus nigra a Kerassia (ile d’Eubée) ; futaie
pure d’ Abies borisii-regis 4 Pertouli (Thessalie) et 4a Karpenissi.
Russula amethystina Quél.. Futaie pure d’ Abies borisii-regis 4 Karpenissi ; plantation
de Pinus nigra dans une futaie d’ Abies borisii-regis 4 Pertouli (Thessalie) ; futaie mixte
d Abies borisii-regis, de Pinus nigra et de Quercus spp. a Kerassia (ile d’Eubée) ; futaie
mixte d’ Abies borisii-regis et de Querqus frainetto au lac de Megdova (Thessalie).
Russula amoena Quél.. Futaie pure d’ Abies borisii-regis 4 Pertouli (Thessalie) ; futaie
pure de Quercus spp. et futaie mixte de Quercus frainetto et d’ Abies borisii-regis au lac
de Megdova (Thessalie).
Russula amoenolens Romagn.. Clairiére dans une futaie mixte de Quercus frainetto et
d’ Abies borisii-regis au lac de Megdova (Thessalie).
Russula azurea Bres.. Futaie pure d’Abies borisii-regis 4 Karpenissi ; futaie mixte
d’ Abies borisii-regis et de Quercus frainetto au lac de Megdova (Thessalie).
Russula badia Quél.. Futaie mixte de Fagus moesiaca et d’ Abies borisii-regis au mont
Kissavos (Thessalie).
Russula cicatricata var. fusca ss. Melz. & Zv.. Clairiére dans une futaie mixte de
Quercus frainetto et d’ Abies borisii-regis au lac de Megdova (Thessalie).
Russula cyanoxantha var. peltereaui Singer. Futaie mixte d’Abies borisii-regis et de
Quercus frainetto au lac de Megdova (Thessalie).
Russula densifolia (Secr.) Gillet. Futaie pure d’Abies borisii-regis au lac de Megdova
(Thessalie).
Russula fageticola (Melzer) S. Lundell (= R. mairei v. fageticola). Sous hétre dans une
plantation de Pinus nigra, dans une futaie pure de Fagus moesiaca au mont Kissavos
(Thessalie).
Russula faginea Romagn.. Plantation de Castanea sativa dans une futaie pure de Fagus
moesiaca au mont Kissavos (Thessalie).
Russula farinipes Romell. Futaie mixte d’ Abies borisii-regis et de Quercus frainetto au
lac de Megdova (Thessalie).
Russula graveolens Romell. Futaie mixte d’ Abies borisii-regis et de Quercus frainetto
au lac de Megdova (Thessalie).
Russula illota Romagn.. Futaie pure de Quercus spp. au lac de Megdova (Thessalie).
Russula insignis Burl. (= R. livescens). Futaie pure d’Abies borisii-regis au lac de
Megdova (Thessalie).
Russula krombholzii Shaffer (= R. atropurpurea). Futaie mixte d’ Abies borisii-regis, de
Pinus nigra et de Quercus spp. a Kerassia (ile d’ Eubée).
Russula langei Bon. Futaie mixte d’ Abies borisii-regis et de Quercus frainetto au lac
de Megdova (Thessalie).
Russula luteotacta Rea. Dans la mousse d’une futaie mixte d’Abies borisii-regis, de
Pinus nigra et de Quercus spp. a Kerassia (ile d’Eubée).
413
Russula melliolens Quél.. Futaie mixte d’ Abies borisii-regis et de Quercus frainetto au
lac de Megdova (Thessalie).
Russula mustelina Fr.. Futaie mixte d’ Abies borisii-regis, de Pinus nigra et de Quercus
spp. a Kerassia (ile d’Eubée).
Russula nana Killerm.. Endroit herbeux d’une futaie pure de Fagus moesiaca au mont
Kissavos (Thessalie).
Russula nauseosa (Pers.) Fr.. Futaie mixte d’ Abies borisii-regis, de Pinus nigra et de
Quercus spp. a Kerassia (ile d’ Eubée).
Russula persicina Krombh.. Futaie mixte de Quercus spp. et d’Abies borisii-regis a
Papades (ile d’Eubée).
Russula pseudointegra Arnauld & Goris. Futaie mixte de Quercus spp. et d’Abies
borisii-regis 4 Papades (ile d’Eubée).
Russula puellaris Fr.. Futaie pure de Quercus spp. au lac de Megdova (Thessalie).
Russula risigallina (Batsch) Sacc. (= R. lutea = R. chamaeleontina). Futaie mixte de
Quercus frainetto et d’Abies borisii-regis au lac de Megdova (Thessalie).
Russula risigallina f. luteorosella (Britzelm.) Bon. Futaie pure d’ Abies borisii-regis a
Pertouli (Thessalie).
Russula romellii Maire. Futaie pure de Fagus moesiaca au mont Kissavos (Thessalie) ;
futaie mixte de Fagus moesiaca et d’ Abies borisii-regis au mont Kissavos (Thessalie) ;
futaie pure d’ Abies borisii-regis a Pertouli (Thessalie).
Russula sphagnophila Kauffman. Dans des sphaignes a une futaie mixte de Quercus
frainetto et d’ Abies borisii-regis au lac de Megdova (Thessalie).
Russula vesca Fr.. Plantation de Castanea sativa au mont Kissavos (Thessalie).
Russula vesca f. viridata Sing.. Plantation de Castanea sativa au mont Kissavos
(Thessalie).
Russula vinosa Lindblad (= R. obscura). Futaie pure d’ Abies borisii-regis 4 Karpenissi.
Russula violeipes f. citrina Quél.. Futaie mixte d’Abies borisii-regis, de Pinus nigra et
de Quercus spp. a Kerassia (ile d’Eubée).
Russula viscida Kudina. Futaie mixte d’Abies borisii-regis, de Pinus nigra et de
Quercus spp. a Kerassia (ile d’ Eubée).
Sclerodermatales
Sclerodermataceae
Pisolithus arhizus (Pers.) Rauschert (= P. tinctorius). Sous plantules de pin dans une
futaie mixte d’ Abies borisii-regis, de Pinus nigra et de Quercus spp. a Kerassia (ile
d’Eubée).
Scleroderma meridionale Demoulin & Malen¢on. Bord de route d’une futaie mixte
d’ Abies borisii-regis et Quercus frainetto au lac de Megdova (Thessalie) ; bord de route
d’une futaie pure de Fagus moesiaca au mont Kissavos (Thessalie).
Thelephorales
Thelephoraceae
Hydnellum auratile (Britzelm.) Maas Geest.. Futaie mixte d’ Abies borisii-regis et de
Quercus frainetto au lac de Megdova (Thessalie).
Hydnellum concrescens (Pers.) Banker (= H. zonatum). Futaie de Quercus spp. et futaie
mixte de Quercus frainetto et d’ Abies borisii-regis au lac de Megdova (Thessalie).
Sarcodon amarescens (Quél.) Quel. (= S. glaucopus). Futaie pure d’ Abies borisii- regis
414
a Pertouli (Thessalie).
Sarcodon martioflavus (Snell et al.) Maas Geest.. Futaie mixte de Quercus frainetto et
d’ Abies borisii-regis au lac de Megdova (Thessalie).
DISCUSSION ET CONCLUSION
La plupart des espéces presentées dans ce travail, ont été trouvées plusieurs fois,
durant le temps des prospections et toutes les caractéristiques qui concernent leur habitat
sont en accord avec la bibliographie. Néanmoins, quelques récoltes rares concernant peu
d’espéces, comme. par exemple Mycena diosma, Cortinarius turgidus, Lactarius
pubescens et Tricholoma pardinum s’opposent aux données bibliographiques,
relativement a leur niche écologique. L’espéce Mycena diosma est mentionnée comme
inféodée au genre Fagus, tandis qu’ici elle est présente sous une futaie mixte de sapin et
de chéne. Cortinarius turgidus a été trouvé sous une sapiniére, tandis qu’ il est référé, par
Marchand, sous feuillus. Lactarius pubescens, inféodé au bouleau, a été trouvé sans
cette essence. Enfin Tricholoma pardinum, espéce calcicole selon les références
bibliographiques, nous |’avons trouvée dans un endroit ayant roche-mére le flysch, qui
donne naissance aux sols acides. Nous espérons que nous pourrons éclaircir ces
discordances écologiques, par la suite des prospections dans les années suivantes, qui
sont déja en route, aux mémes sites écologiques.
Quoiqu’il en soit, la conclusion qui sort de ce travail, tenant compte du nombre
considérable d’espéces présentées, est que les données sur la mycoflore fongique de la
Gréce sont incompleétes. De ce fait, elles sont insuffisantes pour tirer des conclusions en
ce qui concerne la rareté ou les menaces de disparition que peuvent subir certaines
espéces, a la suite de diverses modifications environnementales (Kapsanaki-Gotsi,
1997). Il devient clair qu’une extention des inventaires a d’autres régions de la Gréce est
nécessaire avant d’entreprendre une étude systématique, basée sur des données
suffisantes sur la composition et la structure des communautés fongiques.
BIBLIOGRAPHIE
Avtzis, N. & Diamandis, S. 1988. Insectes et champignons des parcs nationaux d’Olympe, de Pinde, des
lacs de Prespes et de la forét concervée de Fracton Dramas. Forest Research 2 (IX): 67-75 (en grec).
Athanassiou, Z. & Theochari, I. 1999. Contribution to the mycoflora of black pine. Forest Research 12:
41-46 (en grec).
Bidaud, A., Moénne-Loccoz, P. & Reumaux, P. 1990-2000. Atlas des Cortinaires, Fédération
Mycologique Dauphiné-Savoie Ed., Pars 1-9.
Bon, M. 1988. Champignons d’Europe occidentale, Arthaux, 368 pp.
Breitenbach, J. & Kranzlin, F. 1986-1995. Fungi of Switzerland, Vols 2-4. Mycologia Luzern, Lucerne.
Courtecuisse, R. & Duhem, B. 1994. Guide des champignons de France et d’Europe, Delachaux et Niestlé
Ed. ; 480 pp.
Diamandis, S. 1983. Contribution a la mycoflore des écosystémes forestiéres grecques. Forest Research, |
(IV) : 59-66 (en grec).
Diamandis, S. 1985. Inventaire de la mycoflore des foréts grecques. Forest Research, 2(V1) : 101-118 (en
grec).
Diamandis, S. 1992. Les champignons de la Gréce. Edition “ION” Athénes, 591 pp. (en grec).
Diamandis, S. & Minter, D. 1981. Contribution a la mycoflore du sapin de Cephalonie (Abies cephalonica
Loud.). Partie I. La Forét, 92: 46-60 (en grec).
Diamandis, S. & Minter, D. 1983. Contribution a la mycoflore du sapin de Cephalonie (Abies cephalonica
Loud.). Partie II. Forest Research, 2 (IV): 131-136 (en grec).
Diamandis, S. & Perlerou, C. 1990. Nouvelles espéces de Basidiomycétes et d’Ascomycétes en Gréce.
Annales scientifiques du département de la science forestiére et du milieu naturel, Université de
Thessalonique, 15/2 : 291-303 (en grec).
415
Diamandis, S. & Perlerou, C. 1994. Macrofungi in Greece. Ann. Mus. Goulandris, 9 : 113-123 (en grec).
Hawksworth, D.L., Kirk, P.M., Sutton, B.C. & Pegler, D.N. 1995. Ainsworth &Bisby’s Dictionary of
Fungi. 8" edition, CAB, 616 pp.
Kapsanaki-Gotsi, E. 1997. Towards the conservation of fungi in Greece. Proceedings of the 4 meeting of
the ECCF, 139-140, Vipitemo, 9-14 September 1997
Keltemlidis, D. 1990. Champignons des montagnes et des plaines. Edition Psychalos, Athénes, 259 pp.
(en grec).
Maire, R. & Politis, J. 1940. Fungi Hellenici. Actes de l'Institut Botanique de l'Université d’Athénes | :
27-179.
Marchand, A. 1971-1989. Champignons du nord et du midi. Edition de la Societé Mycologique des
Pyrénées Mediterranéennes, 9 vols.
Pantidou, M. 1980. Macrofungi in forest of Abies cephalonica in Greece. Nova Hedwigia 32 : 709-723.
Pantidou, M. 1990. Champignons des foréts grecques. Muséum Goulandris, Kiphissia, Athénes, 197 pp.
(en grec).
Pantidou, M. & Gonou, Z. 1984. Macrofungi in forest of Castanea sativa and Fagus silvatica in Greece.
Nova Hedwigia 34 : 245-257.
Pantidou, M. & Watling, R. 1970. A contribution to the study of the Boletaceae-Suilloidae. Not. Roy. Bot.
Garden Edinburg 30 : 207-237.
Zervakis, G., Dimou, D. & Balis, C. 1998. A check-list of the greek macrofungi including hosts and
biogeographic distribution: I. Basidiomycotina. Mycotaxon, 67 : 273-336.
MYCOTAXON
Volume LXXIX, pp. 417-432 July-September 2001
AN INDEX TO BATSCH’S
ELENCHUS FUNGORUM, 1783-89
S.R. PENNYCOOK
Landcare Research, Private Bag 92 170, Auckland, New Zealand
PennycookS@landcare.cri.nz
ABSTRACT
The taxa described and illustrated in the 3 volumes of Batsch’s Elenchus
Fungorum are fully indexed, and all references to these taxa in the
sanctioning works of Persoon and Fries, and in Fries’s Hymenomycetes
Europaei, are listed. KEYWORDS: nomenclature, sanctioned names
INTRODUCTION
August Johann Georg Carl Batsch (1761-1802) was a German botanist and professor at,
Jena. His major, and only, contribution to mycological literature was the Elenchus
Fungorum (Batsch 1783) and its two Continuatio volumes (Batsch 1786, 1789). The
pagination of these three volumes is intriguing. The 25 x 21 cm pages are unnumbered, but
each contains two columns of parallel text, one in Latin and the other in German, and
these columns are numbered consecutively throughout the volume. Thus the Latin text
occupies the odd-numbered columns, and the German text the even-numbered.
Consequently, all nomenclatural citations must refer to odd-numbered columns, because
only they contain Latin binomials. The illustrations are printed from 23 x 18.5 cm plates
engraved and coloured from Batsch’s original paintings; the habit studies are very lifelike
and demonstrate sufficient detail to enable determination at the macroscopic level.
The layout of the initial volume (Batsch 1783) is complex. There are five major sections —
Praefatio (the preface); Synopsis Fungorum (synopses of orders and genera); Subordines
Species (the nomenclature, figure references, and basic descriptions of the taxa);
Annotationes (descriptive material pertaining to the illustrated collections, including details
of habitat, substrate, and time of year); and Icones Fungorum Nonnullorum Agri Jenensis (the
coloured plates). The Subordines Species section describes 283 fungal species (plus
numerous varieties) in9 genera — Agaricus, Boletus, Clathrus, Clavaria, Hydnum, Lycoperdon,
Mucor, Peziza, and Phallus. These taxa are numbered in a hierarchical system, with the
genera enumerated by Roman numerals, the species within each genus by Arabic
numerals, and the (un-named) varieties within a species by Greek letters. Most of the taxa
are referred to one or more previously published illustrations, particularly those of
Schaeffer (1762-74) and Micheli (1729); however, 57 taxa (i.e. about a fifth of the species)
are referred to "Ic. jen.", i.e. to the 12 plates of Batsch’s figures (Tab. 1-12, Fig. 1-57) that
are annexed to the volume. The Annotationes section deals only with those taxa that are
418
illustrated in Batsch’s "Ic. jen." Each paragraph is headed somewhat cryptically with a
Roman numeral, followed by an abbreviated genus name and an Arabic numeral, but no
specific epithet, making it difficult to ascertain the corresponding taxonomic treatment in
the Subordines Species section. In fact, the Roman numeral is the number of the relevant
figure in the annexed "Ic. jen." plates, and the Arabic numeral is the number of the relevant
species in the hierarchical numbering system of the Subordines Species section.
The two Continuatio volumes add 143 species and 15 varieties, and a further 4 genera —
Elvela [= Helvella], Embolus, Sphaeria, and Stemonitis — as well as revisiting 17 taxa (and
recombining one of them) from the initial volume. Six of the varieties have varietal
epithets, in addition to the Greek letters by which most varieties are designated
throughout the three volumes. Every taxon in the Continuatio volumes is illustrated in 30
plates of figures (Tab. 13-42, Fig. 59-232). In contrast to the complex layout of the initial
volume, the Continuatio volumes have a single comprehensive text entry for each taxon.
The numbering of these text entries (59-232) corresponds exactly to the numbering of the
relevant figures; it is thus a continuation of the numbering of the initial volume’s
Annotationes section, but has no relationship with the hierarchical numbering system of the
initial volume’s Subordines Species section.
The importance of Batsch’s opus is indicated by the number of his epithets that were
accepted in the sanctioning works of Persoon and Fries, and in Fries’s later publications.
Accurate citation of these epithets can be a problem. Fries’s citations are not to be relied
on, since they are often mistranscribed, or are ambiguous as to which of Batsch’s three
volumes is involved, or cite a figure/taxon number rather than a "page" [= column]
number. (The establishment of an accurate citation is not a mere exercise in pedantry!
Widespread practice notwithstanding, a citation attributing publication of a pre-Friesian
name to the page in the sanctioning works on which it was taken up by Fries is no
substitute for the citation of the original point of valid publication. It is, for example, the
date of the original valid publication that determines priority between competing
sanctioned names.) Laplanche (1894, pp. 354-361) gives a useful "Tableau de Concordance
de Batsch", but this includes only the hymenomycetous subset of Batsch’s figures and
makes no reference to the text. Batsch’s volumes themselves are not widely available for
consultation, and Iam not aware of any easily accessible index to them. The INDEX below
has been compiled to fill this gap. All the specific and varietal epithets from Batsch’s three
volumes are listed in a single alphabetic sequence, with: (I) Batsch’s generic placement of
the epithet; (ii) the taxonomic "page" [= column] citation for the taxon, together with the
"page" reference (in parenthesis) of any additional text; (iii) the plate+ figure citation(s) for
the taxon; (iv) reference(s) to the taxon in the Persoonian sanctioning work (Persoon 1801);
(v) reference(s) to the taxon in the Friesian sanctioning works (Fries 1821, 1822-23, 1828a,
1828b, 1829-32, 1832); and (vi) reference(s) to the taxon in a later Friesian work (Fries
1874). Substitution of Helvella for Elvela, and minor alterations to Batsch’s original spelling
(in accordance with ICBN’s instructions for grammatical corrections) have been
incorporated without comment.
SANCTIONED AND ACCEPTED EPITHETS
A total of 70 of Batsch’s names were sanctioned, by being accepted either directly, or ina
different genus, or at a different rank. These names are in bold type in the INDEX, below.
419
-Persoon sanctioned 5 of Batsch’s names — Lycoperdon giganteum, L. pusillum (as Bovista),
L. fenestratum var. B (as Geastrum quadrifidum y fenestratum), Lycoperdon furfuraceum (as
Bovista), and Peziza olla (as Cyathus). The first three are sanctioned explicitly, the fourth and
fifth by implication. Although Persoon attributed L. furfuraceum to Gmelin, Batsch’s earlier
taxon of the same name is stated (Fries 1829-32, De Toni 1888, sub Bovista plumbea) to be
synonymous. Similarly, although Persoon did not attribute the epithet olla to any previous
author, Fries synonymised both Cyathus olla and Peziza olla with Nidularia campanulata
(Fries 1822-23, 1832, respectively), and Brodie (1971) attributed the basionym of Persoon’s
name to Batsch.
Fries sanctioned 65 of Batsch’s names. These include 2 names that Fries accepted but
mistranscribed — Agaricus violaceofulvens (as A. violaceofulvus), and Peziza cupressi (as P.
cupressina) — and 7 names that were sanctioned at a different rank — Agaricus candidus (as
A. geophyllus B [candidus}), Agaricus saccharinus (as A. pterigenus B saccharinus), Agaricus
sphinx (as A. velutipes B sphinx), Hydnum suberosum var. B aurantiacum (as Hydnum
aurantiacum); Peziza convivalis (as P. cyathoidea B convivalis), Peziza infundibulum (as P.
calyculus B infundibulum), and Sphaeria acinosa (as S. hirsuta B acinosa).
Many other of Batsch’s names were also accepted in the sanctioning works, but fall outside
the sanctioning canon, e.g., Myxomycete names accepted by either Persoon or Fries, and
Gasteromycete names accepted by Fries. (N.B. Phallus gigas and P. undosus were accepted
by Fries in the Ascomycete genus Morchella, and therefore are sanctioned; whereas Peziza
nutans was accepted by Fries in the Myxomycete genus Craterium, and therefore is not
sanctioned.) A large proportion of the remaining names were placed in synonymy in the
sanctioning works, but many of these were accepted subsequently as good species in
Fries’s later publications.
Attention must be drawn to four further names mistranscribed by Fries — Agaricus digitalis
(as A. digitellus), Agaricus fritillarius (as A. frittilarius), Lycoperdon arrhizon (as L. arrhizum),
and Lycoperdon polyrhizon (as L. polyrhizum) — and to one mistranscribed by both Persoon
and Fries — Agaricus laterinus (as A. lateritius). The latter error is particularly confusing,
because Batsch used both these epithets, one fora Cortinarius, the other for a Hebeloma. He
referred his A. lateritius to two Schaeffer illustrations, T.42 [= Cortinarius varius
(Schaeff.:Fr.) Fr.] and T.54 [= Cortinarius ochroleucus (Schaeff.:Fr.) Fr.]. When Persoon (1801)
and Fries (1821) synonymised "A. lateritius Batsch f.195" with A. fastibilis [= Hebeloma
fastibile (Pers.:Fr.) Fr.], they clearly intended A. laterinus Batsch, since that is the taxon
illustrated in the figure they both cited. Fries (1832) went some way towards correcting the
error, by explicitly synonymising A. laterinus Batsch with A. fastibilis, while failing to
contradict the erroneous synonymy of A. lateritius Batsch.
Other potential sources of confusion are taxa for which Fries, in at least one reference,
substituted a different epithet (or genus) while still attributing the name to Batsch —
Agaricus hypni (as A. hypnorum), Agaricus ochraceus (as Cortinarius isabellinus), Agaricus
serpentiformis (as Helvella serpentiformis), Agaricus subantiquatus (as A. cristatus), Agaricus
subhepaticus (as A. hepaticus), Agaricus subtestaceus (as A. testaceus), Helvella sepulcralis (as
Embolus sepulchralis), Hydnum hystricinum (as H. hystrix), Hydnum pectiniforme (as H.
orbiculatum), Lycoperdon palmiforme (as L. palmatum), Peziza nutans f (as P. cernua B), Peziza
tuba (as P. tubaeformis), and Phallus fungoides (as P. lobatus).
420
The INDEX includes all references to Batsch’s names that occur in the specified works of
Persoon and Fries, with the exception of index references that contribute no additional
information. Some of the references are indirect, via figure /taxon numbers rather than the
names themselves. References in which Batsch’s epithet is sanctioned or accepted are in
bold type. References that involve the erroneous names detailed above are enclosed in
[square brackets]; as are also the references of the two implied Persoonian sanctionings,
detailed above.
ANOMALOUS NAMES
Unaccountably, Batsch used the same name, Agaricus fulvens, for two different taxa. He
referred them to different Schaeffer illustrations, one to T.5 [= a Lactarius], the other to
T.245 [= an Amanita]. In the INDEX, these two taxa are differentiated by their Schaeffer
references. Batsch published one illustration (t.12 f.58) of a fungus for which he provided
no formal name. This taxon is included in the INDEX under [roseus, Aspergillus], the name
subsequently applied to it by Fries (1829-32).
ACKNOWLEDGEMENTS
I wish to thank: Brian Spooner and the Mycology staff at the Herbarium, Royal Botanic
Gardens, Kew, for the opportunity to consult their copy of Batsch’s Elenchus Fungorum,
and for the provision of working space and practical assistance during my visit; Gary
Samuels, Systematic Botany and Mycology Laboratory, United States Department of
Agriculture, Beltsville, for searching out answers to numerous queries, and for providing
details of the Schaeffer illustrations; and Geoff Ridley, New Zealand Forest Research
Institute, Rotorua, and Gary Samuels for refereeing the manuscript.
REFERENCES
Batsch, A.J.G.C. 1783. Elenchus Fungorum. Halle.
Batsch, A.J.G.C. 1786. Elenchus Fungorum, Continuatio Prima. Halle.
Batsch, A.J.G.C. 1789. Elenchus Fungorum, Continuatio Secunda. Halle.
Brodie, H.J. 1971. The Bird’s Nest Fungi. Toronto & Buffalo, University of Toronto Press.
De Toni, J.B. 1888. Lycoperdaceae. Sylloge Fungorum 7: 48-154.
Fries, E.M. 1821. Systema Mycologicum. Vol. 1. Lund.
Fries, E.M. 1822-23. Systema Mycologicum. Vol. 2. Lund.
Fries, E.M. 1828a. Elenchus Fungorum. Vol. 1. Greifswald.
Fries, E.M. 1828b. Elenchus Fungorum. Vol. 2. Greifswald.
Fries, E.M. 1829-32. Systema Mycologicum. Vol. 3. Greifswald.
Fries, E.M. 1832. Systema Mycologicum. Index Alphabeticus. Greifswald.
Fries, E.M. 1874. Hymenomycetes Europaei. Uppsala.
Laplanche, M.C.de 1894. Dictionnaire Iconographique des Champignons Supérieurs
(Hyménomycetes). Paris.
Micheli, P.A. 1729. Nova Plantarum Genera. Firenze.
Persoon, C.H. 1801. Synopsis Methodica Fungorum. Gottingen.
Schaeffer, J.C. 1762-74. Fungorum qui in Bavaria et Palatinatu Nascuntur Icones. Vol. 1-4.
Regensburg.
421
INDEX TO BATSCH’S ELENCHUS FUNGORUM
Abbreviations: E = Batsch (1783)
C1 = Batsch (1786)
C2 = Batsch (1789)
SMF = Persoon (1801) SM1 = Fries (1821)
SM2 = Fries (1822-23)
EF1 = Fries (1828a)
SM3 = Fries (1829-32)
IA = Fries (1832)
HE = Fries (1874)
Taxon Page Figure Persoon Fries Fries
citation citation (1801) (1821-32) (1874)
abietis, Agaricus E:73 (163) t.3 £.10 $M1:139 HE:478
acaulis, Phallus E1295 aa $M2:33
acinosa, Sphaeria C1:269 ¢.30f.179 SMF:73 SM2:450
acuminatus, Phallus E153 e 5 Fe es
adiposus, Agaricus GIIA7AA22 £113 2% SM1:242 HE:222
admorsum, Lycoperdon E149".
adnatus, Clathrus E:141 ..
adustus, Agaricus E3675...
aethiops, Agaricus ET Agi.
alneus, Agaricus | stge se) aa a fs
alutaceus, Agaricus Cl:163 R023. £119 ere IA:6 HE:198
amanitae, Agaricus C1:109 ¢.18f93 SMF:374 $M1:133 HE:119 «
: amenti, Peziza C1:211 t.27£.148 SMF:669 SM2:127
anastomosis, Phallus ENSIVas $M2:9
angulatus, Agaricus E73 es = SM1:140, IA:7
annularis, Peziza C1:2018t26 £139: $M2:137, 306
__ antiquata, Peziza E:119 (C1:203) ¢.27 f.141 ... =
| antiquatus, Agaricus BASS) a bes S$M1:20 os
_ applicatus, Agaricus C1:171 .24f.125 SMF:484 SM1:192 HE:180
| aquamarinus, Agaricus Japoy Loe
aqueus, Agaricus Eolas cee ce bs
arcularius, Boletus £973 SMF:518 SM1:342 HE:526
___ arrhizon, Lycoperdon C1:239.5t.29 £166 5 SME-137 S$M3:23 [IA:110]
_ aspersus, Agaricus Es/Siace << ee
asserculorum, Agaricus E9502 SMF:487 SM1:334, IA:8
_ ater, Mucor | SNS ee ee ay
__ atricapillus, Agaricus C1:77 .16 £.76 SM1:199 HE:185
atrocyaneus, Agaricus C1:101 t.18f.87 SMF:378 SM1:147 HE:141
atropurpurea, Clavaria £E:133 (179) t.11f47 SMF:609 SM1:490
atrosquamosus, Agaricus E:81 (171) .6 £.27 IA:8 co
atrotomentosus, Agaricus E:89 (173) t.8f.32 | SMF:473 SM1:272 HE:403
aurantiacum, Hydnum
suberosum var. B C2:103 t.40 £.222 SMF:xxx SM1:403, 516
aurantius, Agaricus J etfs) ee a8
aurantius var. a, Agaricus EAS SM1:42
aurantius var. B, Agaricus E45 %...
aurantius var. Y, Agaricus E:aoite oa
aureus, Agaricus ES /ar $M1:15 =
auricomus, Agaricus E:75 (167) atS £21 $M1:259 HE:233
Bold taxon = sanctioned name.
Bold reference = Batsch’s name accepted.
[Bracketed reference] = erroneous name cited.
422
Taxon Page Figure
citation citation
auricula, Peziza B47) nc
auriscalpium, Hydnum Elion
aurivellus, Agaricus C1:153 t.22 f.115
aurivenius, Agaricus C1:137 t.20 £.107
aurora, Agaricus E:93 (175) t.9 £.36
aurora var. «, Agaricus |e)
aurora var. B, Agaricus E:93 (175) t.9 £.36
balanus, Agaricus F-63704.
barbatus, Agaricus E:39 (163) t.3 f.11
berylius, Agaricus E:83 (C2:83) .38 f.213
bicolor, Agaricus E957 =
bolaris, Peziza C1:221 t.28 f.155
boletiforme, Lycoperdon E:149 ...
bombacinum, Lycoperdon E1530.
bombarda, Sphaeria C1:271 ¢.30 f.181
bovinus, Boletus ESoo
brachiata, Clavaria C1:233 t.28 f.163
brunnea, Peziza E:125 (181) t.11 £.50
brunneus, Phallus E1297
buccinalis, Agaricus C2:85 t.39 f.214
bulbularis, Agaricus C1:137 t.21 f.108
caesius, Agaricus C1:113 t.18 £.94
callosa, Peziza C2:95 ¢.39 f.219
calyciformis, Helvella C1:195 t.26 f.135
calyculus, Peziza E:123 (181) .12 £.57
calyculus var. «, Peziza E123 82:
calyculus var. B, Peziza | PES jo
calyculus var. y, Peziza E5123 (181) £12 f.52
campanella, Agaricus EVSa.
cancellatus, Clathrus E14ho
cancellatus, Mucor C2:135 t.42 £.232
candidus, Agaricus C1:133 t.20 £.106
canescens, Agaricus E:95 (175) t.9 £.38
canobrunneus, Agaricus C1:133 .20 f.105
cantharellus, Agaricus E:95 (175) t.9 £.34
canus, Boletus E10
canus var. «, Boletus E:101 ...
canus var. B, Boletus EA0res
capitatum, Lycoperdon E:147 4.
carbonarius, Agaricus E:69 (161) t.2 £.6
carbonarius var. a, Agaricus 69a
carbonarius var. B, Agaricus E695
carbonarius var. y, Agaricus E:69 (161) t.2 f.6
carbonarius var. 5, Agaricus C1:107 t.18 f.91
carneolus, Agaricus jes oe ae
carneotomentosus, Agaricus E:89 (173) t.8 £.33
carneotomentosus var. a,
Agaricus E:91 (173) t.8 f.33
carneotomentosus var. B, Agaricus EDL...
carnosum, Hydnum E:111 (C1:197) .26 f.136
carpini, Peziza C1:215 t.27 £.150
Persoon
(1801)
SMF:269
SMF:310
SMF:660
SMF:660
SMF:470
SMF:190
SMF:287
SMF:411
SMF:411
SMF:475
Fries
(1821-32)
SM1:242
SM1:258
$M1:320
SM1:237
$M1:286
SM2:112
SM3:184
SM2:456
IA:56
SM3:279
$M2:167
$M1:163
$M1:283
IA:10
SM2:91
$M2:118
SM1:166
SM3:165
SM1:259
SM1:274
SM1:294
$M1:330, EF1:50
$M3:53
$M1:301
SM1:298
IA:11
SM1:181, IA:11
SM1:400
SM2:118
Fries
(1874)
HE:220
HE:232
Taxon Page Figure
citation citation
carpobolus, Lycoperdon E1537;
caryophyllatus, Agaricus 7D es.
castaneus, Agaricus E3495
cepiforme, Lycoperdon En47@
ceraceus, Agaricus Ea
cervinum, Lycoperdon E:143
chalybeum, Lycoperdon E550
chamaeleo, Agaricus E-637).0
chrysodon, Agaricus C2:79 ¢.38 £.212
chrysolithus, Agaricus E:Siex:
cimicarius, Agaricus CT 595.015 £59
cinctus, Agaricus E69
cinerascens, Agaricus C1:125 t.19 f.101
cinerea, Peziza C1:1974 26 £.137
cinereorimosus, Agaricus C2:63 t.37 f.206
cinereum, Hydnum
suberosum var. Y C2:107 t.40 f.223
cinereum, Lycoperdon E:155 (C1:249) .29 f.169
cinereus, Agaricus La BY
circumscissum, Lycoperdon E:145 ...
circumscissum var. a, Lycoperdon _E:145 ...
circumscissum var.B, Lycoperdon _E:145 ...
circumscissum var. y, Lycoperdon _E:145 _...
circumscissum var. 6, Lycoperdon _—E:145 ...
circumseptus, Agaricus CP119) t:19:5:98
citrina, Peziza C2:95 t.39 f.218
clandestinum, Hydnum E:113 (177) t.10 £.44
clavatus, Agaricus BS5ar.
clavularis, Agaricus C1:89 t.17 £.81
clavus, Agaricus C2:41 .35 f.199
cochleata, Peziza Eel
cochleata var. a, Peziza E:117 (C1:225) t.28 f.158
cochleata var. }, Peziza E:117 (C1:223) t.28 £.157
cochleata var. y, Peziza E1375.
comitialis, Peziza CH2V76 t27 £152
complanatum, Lycoperdon C1:2515,€:29 £170
conchiformis, Boletus
suberosus var. B C2:121 ¢.41 f.227
convivalis, Peziza E12 Vere
coralloideum, Hydnum E13 te
coriaceus, Agaricus C1:139 ¢.21 f.109
coriaceus, Boletus E:105 (C1:177) t.24 £.127
cornea, Clavaria E:139 (C1:229) t.28 f.161
cornu-alces, Clavaria E135...
cornu-cervi, Clavaria E:135, 22
corollinum, Lycoperdon PAlSte
coronata, Peziza Eel loo.
corticale, Lycoperdon BaSohc.
corticalis, Clavaria C1:231 ¢.28 f.162
coryli, Sphaeria C2:131 ¢.42 f.231
costatus, Phallus Est29er
costatus var. «, Phallus [4 Ws) Ve
Persoon
(1801)
SMF:115
SME:365
SMF:434
SMF:634
SME:xxix
SME:xxx
SMF:170
SMF:646
SMF:170
SMF:529
SMF:596
SMF:595
SMF:636
SMF:36
Fries
(1821-32)
$M2:310
IA:11
SM3:46
S$M1:249
SM1:32
SM1:70
SM1:171
SM2:142
SM1:116
SM1:404
SM3:126
423
Fries
(1874)
HE:405
HE:437
HE:100
HE:61
SM3:29
SM1:266 HE:273°
SM2:131, 609
SM1:400
SM1:25, IA:13
SM1:159
$M1:249
HE:151
HE:239
$M2:49, 55
$M2:577
SM3:126
SM1:363 =
SM2:124, $SM3:153 ...
SM1:129 HE:468
SM1:371, IA:57
SM1:486 HE:680
$M3:17
$M2:52
$M3:191
EF1:233
SM2:436
424
Taxon
costatus var. B, Phallus
costatus var. y, Phallus
crater, Peziza
crenulatus, Agaricus
crispus, Agaricus
crispus, Boletus
crocatus, Agaricus
crocatus, Boletus nitens var. €
crocatus, Embolus
crucitbulum, Peziza
cucullata, Helvella
cupressi, Peziza
cupula, Peziza
cyanophallus, Agaricus
cyprinus, Agaricus
dealbatus, Agaricus
defossum, Lycoperdon
defossus, Agaricus
delicatus, Agaricus
delicatus var. a, Agaricus
delicatus var. B, Agaricus
delicatus var. y, Agaricus
deliciosus, Agaricus
deliciosus var. a, Agaricus
deliciosus var. B, Agaricus
deliciosus var. y, Agaricus
deliciosus var. 6, Agaricus
deliciosus var. €, Agaricus
deliciosus var. ¢, Agaricus
deliciosus var. n, Agaricus
deliciosus var., Agaricus
denudatus, Agaricus
depluens, Agaricus
diadema, Peziza
diffusus, Agaricus
digitalis, Agaricus
digitata, Clavaria
discors, Agaricus
dispar, Agaricus
dispar, Lycoperdon
dubia, Peziza
echinus, Lycoperdon
elatus, Agaricus
elvela, Boletus
eruciformis, Peziza
fastigiata, Clavaria
fastigiata var. a, Clavaria
fastigiata var. B, Clavaria
fastigiata var. y, Clavaria
Page
citation
Figure
citation
B31
Blais
B:125.%
Es7 ie
E:6/a, 3
E5103+ 23
E:71
C2113
C1:265
E:119
C1:189
t.41 £.225
t.30 £.177
t.26 f.132
HE) oo
E:127
C1:97
t.17 £.85
ED en
E:75
C2:125
C1:69
t.42 £.229
t.15 £.73
E:43. ...
E:43 ...
E:430
E4370
E417
E:41 ..,
Eat
E44) on
E:41 ..,
E:41" 3.
E:41 ...
E:43
Ci57
E:53
C1:167
E:119
C1:143
E:61 (159)
EBsis7i
G231
G275
E:147
C1:209
E:145
C211
t.14 £.68
t.24 £.122
E2LEIttE
a WS a
t.34 £.196
t.38 £.210
t.27 £.145
t.32 £.188
E:105 .
E25ae5
E:137 (179)
E:137
E:137 (179)
t.11 £.48
t.11 £.48
E1370 )=
Persoon
(1801)
SMF:642
SMF:611
SMF:378
SMF:153
SMF:437
SMF:484
SMF:425
SMF:351
SMF:368
SMF:332
Fries Fries
(1821-32) (1874)
SM1:353
SM3:177
SM2:53
SM1:493, EF1:233
SM2:135, 610
SM1:146
SM3:48 rey
SM1:223 HE:344
SM1:62
SM1:65 HE:428
SM1:275 HE:214
SM1:299 HE:318
SM1:310 HE:327
SM1:34, [A:17 HE:411
SM1:123, IA:17 HE:471
SM3:49 Be
SM2:138
SM1:248 — HE:241
SM2:203, IA:131
SM1:467 HE:671
Taxon
favogineum, Lycoperdon
favus, Boletus
fenestratum, Lycoperdon
fenestratum var. «, Lycoperdon
Page
citation
Ch257
Figure
citation
t.30 £.173
E97 ae.
f15ie
E:151
fenestratum var. B et y, Lycoperdon C1:243
fenestratum var. B,
' Lycoperdon
E:151 (C1:245)
Persoon
(1801)
SMF:181
C29 £1683
t.29 £.168
t.29 £.168
SMF:134
SMF:134
{32 £187,%..,
t.18 f.92
t.25 £.128
t.30 f.175
B/S
t.28 f.159
SMF:508
SMF:198
SMF:584
t.41f.226 ...
t.7 £.30
t.19 £.97
SMF:264
t.28 £.156 ...
3 7a
t.24 f.124
t.39 f.215
E:49 ...
t.9 £.40
t.6 £.26
EB:43 5
B51.
ES tae
ES lane
£17 £79
E695.
SMF:455
€32 1.189 Bae
t.29 £.165
t.18 £.86
fenestratum var. y, Lycoperdon C1:247
ferruginascens, Agaricus G29
ferruginatus, Agaricus C1:109
ferruginatus, Boletus C1:179
ferrugineus, Agaricus E:85
ferruginosa, Stemonitis C1:261
fibrillosus, Agaricus
fimbriatus, Agaricus E53
flabeilaris, Clavaria Cl:227
flabelliformis, Boletus
suberosus var. C2117,
flammans, Agaricus E:87 (173)
flavens, Agaricus E:75
flavofloccosus, Agaricus Gini,
floccosa, Peziza C1:223
floccosus, Agaricus
floribundus, Boletus E:107
flurstedtiensis, Agaricus C1:171
fragilis, Agaricus C2:87
fritillarius, Agaricus
fructiculosa, Clavaria E:137
fuliginarius, Agaricus E:71 (177)
fuliginatus, Agaricus E:81 (171)
fulvens, Agaricus ["Sch. V"]
fulvens, Agaricus ["Sch. CCXLV"]
fungites, Agaricus
fungites var. a, Agaricus
fungites var. B, Agaricus E:51
fungites var. y, Agaricus C1:85
fungoides, Phallus E:129_...
furfuraceum, Lycoperdon E:145
furfuraceus, Mucor E:157 (C1:267)
furnus, Agaricus
furnus var. a, Agaricus E695r.
furnus var. B, Agaricus E:69 ..
fuscescens, Agaricus | OY ae
fuscus, Agaricus E:47
fusiformis, Agaricus E:47
fusus, Agaricus C2313
geaster, Lycoperdon E:151
gemmatum, Lycoperdon E:147
giganteum, Lycoperdon C1:237
gigas, Phallus E:131
glandifer, Agaricus Cig
SMF:140
J [SMF:138]
t.30f.178 ...
Fries
(1821-32)
SM3:187
SM3:12
SM1:226, IA:19
SM1:107
SM1:388
SM3:195
SM1:433, EF1:166
SM1:363
SM1:244
SM1:24
IA:20
SM1:274
425
Fries
(1874)
HE:340
HE:500
HE:634
HE:220
HE:37
HE:276
SM1:269, EF1:36, IA:20 ...
SM1:53, IA:21
TA:73
SM1:146, IA:21
SM1:200
SM1:14
[SM2:14, IA:141]
SM3:24
IA:21
IA:22
SM3:16
SM3:36, 37
SM3:29
SM2:11
SM1:166
HE:27
HE:247
HE:163
426
Taxon
glaucus, Agaricus
glaucus, Mucor
globularis, Sphaeria
glutinosus var. a, Agaricus
glutinosus var. B, Agaricus
glutinosus var. y, Agaricus
granulosus, Agaricus
grisea, Peziza
griseus, Agaricus
gyrans, Clavaria
hepatica, Peziza
hepaticus, Agaricus
hepaticus var. a, Agaricus
hepaticus var. B, Agaricus
hepaticus var. y, Agaricus
hians, Peziza
hirsuta, Peziza
hirsutus, Boletus
hirta, Clavaria
hirtum, Lycoperdon
hirudo, Peziza
hispidus, Agaricus
hyacinthus, Agaricus
hypni, Agaricus
hypoxylon, Clavaria
hystricinum, Hydnum
ichoratus, Agaricus
igniarius, Boletus
igniarius var. a, Boletus
igniartus var. B, Boletus
igniarius var. y, Boletus
igniarius var. 6, Boletus
imbricatus, Agaricus
imperialis, Agaricus
imperialis var. a, Agaricus
imperialis var. B, Agaricus
impuber, Agaricus
incarnatus, Agaricus
infundibuliformis, Boletus
infundibuliformis, Peziza
infundibulum, Peziza
involutus, Agaricus
janthinus, Agaricus
janthinus var. a, Agaricus
janthinus var. B, Agaricus
janthinus var. y, Agaricus
jenensis, Agaricus
jenensis, Peziza
E:79 (169)
E:117 (181)
C1:87
Gt BS
C1:199
E:43 (165)
E:43 (165)
E:43
E:43
E:121
E:127
E:99
C1:229
E:145
C1:213
E:81 (169)
E:81 (171)
C1:117
E:139 .
E1135
C1:37
E:109 .
E:109
E:109 .
E:109 .
E:109
C1:149
E:59
E:59
E:59
E:85 (C1:155)
E:51
E:97
E:121
C1:211
C1:39
E:79 (167)
E:79
E:79
E:79 (167)
E:83
E:123 (C1:219)
Figure
citation
t.24 £.123
t.30 f.180
t.15 £.70
t.15 £.71
t.35 £.200
t.6 £.24
t.12 £.55
t.17 f.80
t.28 £.164
t.26 f.138
t.4 f.15
t.4 f.15
tee
ae
vee
nee
t.28 £.160
t.27 £.149
t.6 £.25
t.7 £.28
t.19 £.96
t.22 f.114
t.23 £.116
vee
t.27 £.147
t.13 f.61
t.5 £.20
t.5 £.20
t.7 £.29
t.28 £.153
Persoon
(1801)
SMF:484
SMF:75
Fries Fries
(1821-32) (1874)
SM1:191 HE:460
SM2:457 =
SM1:36, IA:22 HE:414
SM1:25 HE:36
$M2:143 =
SM1:145, EF1:21 HE:146
SM1:494 HE:684
$M2:71, IA:132 a
$M1:315 a
IA:59 =
$M2:327 =
SM3:40 =
$M2:124 ies
SM1:201 Bi
SM1:103 HE:419
SM1:267 [HE:270, 720}
SM1:410 [517] HE:618
SM1:71 HE:436
SM1:243 HE:220
SM1:16 jas
SM1:42 ok
S$M1:277 HE:182
IA:59 fe:
IA:133 a
SM2:130 be
SM1:271, EF1:10 HE:403
SM1:151 HE:133
SM1:288 HE:291
SM2:154 me
Taxon
laceratus, Agaricus
lacerum, Lycoperdon
lacrimalis, Agaricus
lacteus, Agaricus
lacteus, Boletus
lacteus var. a, Boletus
lacteus var. B, Boletus
lacteus var. y, Boletus
lacteus var. 6, Boletus
lanatum, Lycoperdon
laterinus, Agaricus
lateritius, Agaricus
leporina, Peziza
libertatis, Agaricus
lilacina, Helvella
lipsiensis, Boletus
livescens, Agaricus
lividorubescens, Agaricus
lumbricale, Lycoperdon
lumbricalis, Clavaria
luridus, Agaricus
luteolus, Agaricus
luteum, Lycoperdon
luteus, Agaricus
luteus, Boletus
luxurians, Agaricus
maculatus, Agaricus
madreporeus, Agaricus
mappa, Agaricus
margaritiferus, Agaricus
Page
citation
Figure
citation
ee y ©
E:145
E:75 (163)
E:39
E:103 (177)
E:103 (177)
t.3 £.7-8
t.10 f.42
t.10 f.42
EAQ3 aie
E103mre
E:103 ee
E:147
C2:29
t.33 £.195
Else
E117
C1:43
C1:187
C1:183
C1:53
C251
C1:259
E2135
GCL107.
C1:163
t.14 f.62
t.25 f.131
t.25 £.130
t.14 f.67
t.36 £.202
t.30 £.174
t.18 £.90
t.23 f.120
E:155- 55
E:45 ..
E99 4
E:49 ..
E:41
C2:53
Persoon
(1801)
SMF:517
[SMF:326]
Fries
(1821-32)
$M3:33
SM1:266
$M1:348
SM3:40
[SM1:249] IA:27
427
Fries
(1874)
HE:257, 262
HE:526
[SMF:326, in error] [SM1:249, IA:27, inerror] ...
SMF:637
SMF:572
SMF:537
SMF:437
SMF:182
t.36,37 £.203 SMF:xxix
ED iaes
E57 aoe
margaritiferus var.a, Agaricus :57 ..
margaritiferus var.B, Agaricus —_E:57
marginatus, Agaricus 27,60 37 £207
membrana, Boletus E1052
membrana var. a, Boletus E:105.¢e
membrana var. B, Boletus EAS a ne
mesentericus, Agaricus ESia
mesentericus var. a, Agaricus EXi a
mesentericus var. B, Agaricus E9ie
mesentericus var. y, Agaricus ED lene
michelii, Clavaria jee Fe Pte
militaris, Clavaria E:135a4
miniata, Peziza C1:207 t.27 f£.144
miniatus, Agaricus Boule
minutissima, Peziza C1:205 t.27 £.143
mitella, Agaricus E:63 ..
mitella var. a, Agaricus E6356
mitella var. 8, Agaricus E630.
mitella var. y, Agaricus B-G3ew
modestus, Agaricus E55 ese
mollis, Agaricus E:45 (165) ¢.4 f.14
SMF:251
SMF:272
SM2:47 és
IA:27 HE:300
SM1:440 A8
SM1:374, IA:60 HE:558
SM1:59 tat
SM1:66 HE:427
SM3:188
SM1:206
SM1:318
SM3:93
SM1:41, IA:29
SM1:44, IA:29 HE:59
HE:19
SM1:18
SM1:245 HE:225
SM2:137, IA:134
IA:30 oak
$M1:121 HE:113
428
Taxon Page Figure
citation citation
mucedo, Mucor E1572,
mucor, Agaricus GLEOTtl7 £82
multifidum, Lycoperdon Bid lore
multifidus, Agaricus C1:173 t.24 f.126
muricatum, Lycoperdon E:145_ ..
murinus, Agaricus E:79 (167) t.5 £.19
mutabilis, Agaricus C2:69 .38 f.208
mutabilis, Boletus E:99
mutabilis var. «, Boletus Eo te
mutabilis var. B, Boletus B99 5.0
mutabilis var. y, Boletus E:99'Sr...
mutabilis var. 6, Boletus E01a..
mutabilis var. €, Boletus E:101 ti.
mutabilis var. €, Boletus EAE
narcoticus, Agaricus C1:79 t.16 £.77
nebularis, Agaricus G2:25t.33 £193
neptuneus, Agaricus C1:161 t.23 f.118
nimbatus, Agaricus C1:49 ¢.14 f.65
nitens, Agaricus C2:21 t.33 f.192
nitens, Boletus E:109 5...
nitens var. «, Boletus E109 os
nitens var. B, Boletus E-109\ ...
nitens var. Y, Boletus E:109 ...
nitens var. 5, Boletus E2109» 2
nitens var. €, Boletus E:109 ...
nitens var. € crocatus, Boletus C2:113 t.41 £.225
nivea, Peziza E:117 (181) .12 £.56
niveobrunneus, Agaricus E77
niveoflavens, Agaricus EO mae
nivosus, Agaricus C1:49 ¢.14 f.64
nutans, Peziza EA2Ur..
nutans var. a, Peziza 1 ay Boe
nutans var. B, Peziza E-1210ee
obesus, Agaricus C2:89 .39 f.216
obsolescens, Agaricus C1:127 t.20 f.102
obsoletus, Agaricus C1:129 t.20 f.103
occarium, Hydnum Eli3a
occultans, Agaricus | Sete 8) (he
ochraceus, Agaricus E:51 (167) t.4 £.17
officinalis, Boletus Edin.
olivacea, Peziza E:127 (181) .12 f.51
olivaceus, Agaricus £457.
olivascens, Agaricus C2:3 t.31 £.185
olla, Peziza El27 a0
olla var. «, Peziza E127 bie:
olla var. B, Peziza E127 as.
ophioglossoides, Clavaria E135...
ophioglosscides var. a, Clavaria E2135...
ophioglossoides var. 8, Clavaria E135e
ophioglossoides var. y, Clavaria F135046
Persoon
(1801)
SMF:469
SMF:485
SMF:271
SMF:405
SMF:349
SMF:359
SMF:522
SMF:330
SMF:666
[SMF:237]
Fries Fries
(1821-32) (1874)
SM1:155 HE:152
IA:112 rs
SM1:330 HE:492
SM1:115 HE:128
SM1:245
SM1:311 HE:329
SM1:86 HE:79
SM1:98, IA:31 HE:86
SM1:87 HE:81
SM1:116, 511, IA:32 HE:421
IA:60
IA:60
IA:60
SM1:353 HE:537
S$M2:136, 143
IA:32 HE:81
SM2:125, SM3:151 ‘
[SM3:150, IA:128]
SM1:257, IA:32 HE:198
SM1:172 rot
SM1:172 HE:105
SM1:412
SM1:30 ak
IA:33 [HE:392, 721]
SM1:365, IA:61
SM2:142
IA:33 ed
SM1:39, IA:33 HE:354
IA:135
Taxon Page Figure
citation citation
ophioglossoides var. 6, Clavaria jee) Vela Te
ophioglossoides var. €, Clavaria EAgsee.
orichalceus, Agaricus C2:1 t.31 £.184
ovum, Agaricus E25 & «ss
pallescens, Agaricus E:6 lie
pallor, Agaricus C1:115 t.18 £.95
palmiforme, Lycoperdon E:149 ...
papillatus, Agaricus C1:81 t.17 £.78
patella, Agaricus feteley cs
pauperatus, Agaricus epee ee
pectiniforme, Hydnum EAISS
pedicellatum, Lycoperdon EIST es.
pedunculata, Clavaria EASo SR,
pedunculatum, Lycoperdon E:149 (C1:241) t.29 £.167
pedunculatus, Clathrus E1Aie
pellitus, Agaricus jouer,
peltigerus, Agaricus C2:17 t.32 £.190
perennis, Boletus E:103 (C1:181) t.25 £.129
pertusus, Clathrus
[= Embolus pertusus] E:143. ..,
pertusus, Embolus
[= Clathrus pertusus] C1:263 t.30 £.176
pileatus, Agaricus C1:47 ¢.14 f.63
pilosus, Agaricus E:67 (159) t.1£.2
pineti, Agaricus E:73 (163) t.3 £.9
pineti var. a, Agaricus E73
pineti var. B, Agaricus E:73,(163) 8 t3i£,9
pineti, Peziza C1:201 t.26 f.140
pineum, Lycoperdon BESSY os
piperatus, Agaricus C1:33 t.13 £.59
pistillaris, Agaricus E5506
pistillaris, Clavaria E:133 (179) t.11 £.46
pistillaris var. o, Clavaria E:133 (179) t.11 £.46
pistillaris var. B, Clavaria Eigse.
pistillaris var. y, Clavaria E33 eRe
placenta, Agaricus E:79 (167) t.5 £.18
plicatus, Agaricus E:63. ...
pluteus, Agaricus E793
polyrhizon, Lycoperdon E1472
porphyrea, Peziza E:127 (181) .12 £.53
pratensis, Agaricus E:77 (161) t.2£.5
pruinatus, Agaricus E:93 (175) .9:£.35
pseudodeliciosus, Agaricus EQia'.
pseudounctuosus, Agaricus E:93 (175) .9 £.37
puccinia, Clavaria E:139 (179) t.11 £.49
puella, Agaricus ESO
pullus, Agaricus E47
pullus var. a, Agaricus E47 Fone
pullus var. B, Agaricus EAToR
pullus var. y, Agaricus E47,
punicea, Peziza C2:97 t.39 £.220
Persoon
(1801)
SMF:406
SMF:139
SMF:523
SMF:187
SMF:381
SMF:666
SMF:429
SMF:597
SMF :351
SME :357
SMF :633
SME 490
SMF:688
SMF:253
Fries
(1821-32)
$M1:223
$M1:134
[SM3:42, IA:112]
SM1:312
SM1:412 {IA:100]
SM3:13
SM3:43
IA:71
SM1:352
SM3:158
IA:35
SM1:142
TA:35
SM2:101
SM3:192
SM1:76
$M1:30
SM1:477
$M1:195
SM1:199
SM3:46, 48
S$M2:168
$M1:124
$M1:320
SM1:318
SM3:294
IA:37
SM1:44
SM1:44
SM2:71
429
Fries
(1874)
HE:348
HE:326
HE:359
HE:144 ©
HE:470
HE:430
HE:190
HE:456
430
Taxon
purpurascens, Agaricus
pusillum, Lycoperdon
pusillus, Agaricus
pyriforme, Lycoperdon
pyxis, Peziza
quercinus, Agaricus
radians, Agaricus
radiatum, Lycoperdon
resinosorum, Clavaria
rete, Phallus
risigallinus, Agaricus
rosellus, Agaricus
[roseus, Aspergillus]
rostratus, Agaricus
rubellus, Agaricus
ruderatus, Agaricus
rudolphii, Agaricus
rufolivescens, Agaricus
rufolivescens var. a, Agaricus
rufolivescens var. B, Agaricus
saccharinus, Agaricus
sanguinalis, Agaricus
sanguineus, Agaricus
sanguineus var. a, Agaricus
sanguineus var. B, Agaricus
sanguineus var. y, Agaricus
sceptrum, Peziza
schenkii, Peziza
scutellata, Peziza
scutellata var. «, Peziza
scutellata var. B, Peziza
scutellata var. y, Peziza
scutellata var. 6, Peziza
semiglobatus, Agaricus
seminulum, Peziza
senescens, Agaricus
sepulcralis, Helvella
sepulcralis, Peziza
sericeus, Agaricus
serpentiformis, Agaricus
sigillatoria, Peziza
simulans, Agaricus
spadicea, Peziza
spadiceus, Agaricus
sphaerocephalus, Mucor
sphinx, Agaricus
spiculosa, Sphaeria
spongiosum, Hydnum
suberosum var.
Page
citation
E:93
C2:123
CTS}
Figure
citation
t.41f.228 SMF:138
t.14 £.66
E1478.
E129 ¥
Bo5e
E:61 ...
EAS).
E139 4
E:131
C1:67
rer Gi pil
(E:183)
t.15 £.72
t.19 £.99
t.12 £.58
E6532
E39"
E:59
E:45 (169)
t.6 £.23
E285 eae
E:85 ..
E:85_ ..
C1:93
C2:47
E:39 (165)
E:39
E:39 (165)
t.17 £.83
t.36 f.201
t.3 £.13
t.3 £.13
E339...
E:123
E:125 (181)
E:123 (181)
E:123 (181)
t.12 £.52
t.12 £.54
t.12 £.54
B1237 5.
E:125
C1:221
C1:141
E:117
C2:35
C1:191
t.28 £.154
t.21 f.110
t.34 £.197
t.26 f.133
E119).4..
BA5e.
E:89
C1:205
E:85
C2:93
E:49 (165)
E:157
C1:145
C1:273
C2:99
t.27 £.142
39 £.217
t.4 £.16
t.22 f.112
t.30 £.182
t.40 f.221
Persoon
(1801)
SMF:442
SMF:453
SMF:691
SMF:469
SMF:430
SMF:644
SMF:648
SMF:408
SMF:315
SMF:36
Fries Fries
(1821-32) (1874)
IA:37
SM3:33
SM1:141
SM2:11 =
SM1:56 HE:454
SM1:107 HE:108
SM3:386
IA:39
SM1:17 =
$M1:121, IA:40 HE:392
SM1:160 HE:479
SM1:62 HE:424
SM1:57 HE:444
SM2:56
SM2:71
SM2:86
SM1:284 HE:287
IA:41 HE:355
[SM3:189] IA:97
IA:137
[SM1:176] IA:41
$M2:137, IA:137
IA:41
SM2:154 ®
$M1:223 HE:339
SM1:119 HE:115
SM2:436
SMF:xxix, 556 SM1:404
Taxon
Page Figure
citation citation
squamula, Agaricus C1:95 t.17 £.84
squamulosus, Agaricus CLIS7T 230.117
squarrosus, Agaricus E:85 (173) t.8 f. 31
stellatum, Lycoperdon E:145 ...
stellatum var. «, Lycoperdon E:145 ..
stellatum var. B, Lycoperdon E145 455
stellatus, Agaricus E:O3nea
striatellus, Agaricus E69 7.
suaveolens, Boletus E975 sc
subalutaceus, Agaricus C2:27 t.33 £.194
subannulatus, Agaricus C1:75 t.16f.75
subantiquatus, Agaricus C2:59 .37 f.205
subatratus, Agaricus C1:103 t.18 f.89
subcarneus, Agaricus C1:123 t.19 f.100
subcoriaceus, Agaricus E71 Wa.
subcorneus, Agaricus E630 es
subcyaneus, Agaricus 47%...
suberosum, Hydnum E:113 (179) t.10 f.45
suberosum var. o&
spongiosum, Hydnum C2:99 t.40 f.221
suberosum var. B
aurantiacum, Hydnum C2:103 t.40 f.222
suberosum var. Y
cinereum, Hydnum C2:107 .40 f.223
suberosus, Boletus E1078.
suberosus var. &
flabelliformis, Boletus C2:117 .41 f.226
suberosus var. B
conchiformis, Boletus C2:121 t.41 £.227
subferrugineus, Agaricus C2:7 t.31 £.186
subgracilis, Agaricus ESO it
subgranulatus, Agaricus E:45 (169) t.5 f.22
subhepaticus, Agaricus C2:77 ¢.38 f.211
subinvolutus, Agaricus C2:57 ¢.37 f.204
submaculatus, Agaricus EG7 en
submaculatus var. «, Agaricus [ROY ! pe
submaculatus var. B, Agaricus E39.
subpurpurascens, Agaricus C1:71 t.16 f.74
subsquamosum, Hydnum E:111 (177) t.10 f.43
subsquamosum var. a, Hydnum Billie.
subsquamosum var. B, Hydnum E:111 (177) .10 £.43
subsquamosus, Boletus E:97 (177) t.10 f.41
subsquamulosus, Agaricus C219, t33 £191
subtestaceus, Agaricus C2:39 t.35 f.198
subulatus, Agaricus E:65.4.0
subviolascens, Agaricus EAT es
succineus, Agaricus BO aoe
sulphuratus, Agaricus ESOP ices
sulphurea, Peziza E:121 (C1:209) t.27 £.146
Persoon
(1801)
SMF:468
SMF:297
SMF:260
SMF:453
SME:xxix, 556
SME:xxx
SME:xxx
SMF:529
SMF:428
SMF:431
SMF:280
43]
Fries Fries
(1821-32) (1874)
SM1:139 HE:479
SM1:229 HE:371
SM1:243 HE:222
SM3:33
SM1:90, EF1:15 HE:84
SM1:31, IA:43 HE:41
SM1:22 [508] HE:33
IA:43 HE:313
SM1:107 HE:108
SM1:404
SM1:403, 516
SM1:404 HE:605.
SM1:363
SM1:363 HE:549
SM1:363 =
SM1:234 HE:387
SM1:225 na
SM1:164 [HE:160, 719]
SM1:80
SM1:224 HE:346
SM1:399 HE:598
SM1:230 HE:374
SM1:249 [HE:238, 735}
IA:44
SM2:123 HE:665
432
Taxon
tenella, Peziza
tenellus, Agaricus
tentaculata, Sphaeria
tintinnabulum, Agaricus
tortus, Agaricus
tremulans, Agaricus
tremulus, Agaricus
tristis, Agaricus
truncatum, Lycoperdon
tuba, Peziza
tuber, Lycoperdon
tubiformis, Agaricus
umbraculum, Agaricus
unctuosa, Helvella
unctus, Agaricus
undosus, Phallus
variabilis, Agaricus
vellus, Agaricus
ventricosus, Agaricus
vermicularis, Clavaria
verrucosum, Lycoperdon
versicolor, Boletus
versicolor var. a, Boletus
versicolor var. f, Boletus
versicolor var. Y, Boletus
versicolor var. 5, Boletus
vesiculosum, Lycoperdon
vesparium, Lycoperdon
Page
citation
CU215
C1:103
Gii277
E:67 (161)
E:61
C2:73
C1:129
C1:165
C2:129
Figure
citation
t27 £151
t.18 £.88
t.30 £.183
t1Lf3
t.38 £.209
t.20 £.104
t.24 f.121
t.42 £.230
Eal2iee
E:143 ...
jae
E:77 (161)
C1:193
t.2 £.4
t.26 f.134
EGO
EASTER
E2079
EAD Ge:
E389).
E2135 a.
£:155ar.
E1071 9.4
E107 a2
E2107 pts
E:107 ve.
E:107
C1:253
C1:253
violaceofulvens, Agaricus E:95 (177)
E:47 ...
E-157i8.3
violaceus, Agaricus
virens, Mucor
virginea, Peziza
virgineus, Agaricus
vitellinus, Agaricus
volvatus, Boletus
volvatus, Phallus
vulneratus, Agaricus
zonatum, Hydnum
zonatus, Boletus
zonatus var. «, Boletus
zonatus var. B, Boletus
E:125
E:39 (165)
(29 6175
t.30 f.172
ES E39
t.3 f.12
E53
E99" 35
E153 oe.
E53"
E:111 (C2:109)
t.40 f.224
BA05 te.
E05mee
E1050.
Persoon
(1801)
SMF:662
SMF:384
SMF:39
SMF:368
SMF:644
SMF:177
SMF:483
SMF:653
SMF:364
SME:xxx
Fries
(1821-32)
$M2:124
$M1:155
$M2:365, IA:175
$M1:305
SM1:124
$M1:123, IA:45
$M1:431
SM2:58 [612]
SM1:118
SM2:31, IA:97
TA:46
SM2:11
SM3:82, IA:114
SM3:188
$M3:183
SM1:276
SM2:90
SM1:33
1A:64
IA:141
SM1:21
SM1:405
IA:64
Fries
(1874)
HE:150
HE:316
HE:120
HE:117
HE:635
HE:490
HE:605
MYCOTAXON
Volume LXXIX, pp. 433-446 July-September 2001
ADDITIONS TO THE KNOWLEDGE OF THE GENUS CLADONIA
(CLADONIACEAE, LICHENIZED ASCOMYCOTINA) IN THE ALPINE BELT
OF THE PYRENEES IN ANDORRA
Teresa AZUAGA, Mercedes BARBERO and Antonio GOMEZ-BOLEA
Dep. Biologia Vegetal (Botanica).Fac. Biologia. Universitat de Barcelona.
Avda Diagonal, 645. E-08028 Barcelona. Spain.
E-mail:agomez@porthos.bio.ub.es
Abstract
Field and laboratory studies of the lichen genus Cladonia in the alpine
meadows of Andorra (NE of Spain, Iberian Peninsula), yielded 24 taxa: 19
species, 3 subspecies and 2 unidentified taxa. Cladonia galindezii, earlier
believed to be endemic to the Antarctic, is reported for the first time from the
Northern Hemisphere. C. asahinae, C. macroceras, and chemotypes IV of C.
subcariosa and || of C. pyxidata are new reports for Europe. The lichen
substances, reported for each taxon, and the altitudinal distribution are
discussed.
Key words: Chemotaxonomy, ecology, altitudinal distribution, Iberian
Peninsula.
Introduction
As part of a survey of the lichen flora of Andorra (Azuaga et al., in
preparation), the genus C/adonia was studied in the alpine meadow belt. The
secondary chemistry and the altitudinal distribution were evaluated for each
taxon. Andorra is a little country located in the Pyrenees adjacent to Spain. Its
meadow belt, above the tree line, extending from 2100 m to the highest
summit (2942 m), has an area of ca. 173 km’.
Materials and Methods
We have standardised the collection method for the alpine belt from 15
mountains (Fig. 1). At every ca. 100 m of altitude we have established one
station that was exhaustively explored. A total of 83 stations were studied, and
750 samples of the genus Cladonia were collected in the years 1995-1999.
The taxa were identified by their morphological and chemical characters. The
chemical composition was screened for 450 specimens, by thin-layer
chromatography (TLC), following Elix & Ernst-Russell (1993).
The taxa were listed alphabetically, following the nomenclature of Eriksson
(1999) and Ahti (27000).
434
The specimens were deposited in the personal herbarium of the first author
(Herb. Azu).
Additional specimen investigated: Cladonia galindezii Ovstedal: Antarctica,
West Graham Land, Galindez Island, 1935, n° 1108 (BM-holotype).
scrubland of Rhododendron ferrugineum
Fig. 1. Location of the 15 study mountains of Andorra.
435
Mountains
1. Pic Cataperdis, 2500-2805 m, UTM: 31TCH 71. Siliceous substratum
(laminated schists).
2. Pic Negre, 2160-2569 m, UTM: 31TCH 71. Calcareous substratum.
3. Coll de Juclar, 2440 m, UTM: 31TCH 91. Siliceous substratum (gneiss).
4. Pic de la Serrera, 2340-2914 m, UTM: 31TCH 81. Siliceous substratum
(micaceous schists).
5. Torre dels Soldats, 2380-2760 m, UTM: 31TCH 80. Siliceous substratum
(black argillaceous schists and laminated schists).
6. Pic de Montmalus, 2400-2781 m, UTM: 31TCH 90. Siliceous substratum
(granodiorite).
7. Pic del Maia, 2614 m, UTM: 31TCH 91. Siliceous substratum (laminated
schists).
8. Pic de Casamanya, 2100-2740 m, UTM: 31TCH 81. Calcareous
substratum.
9. Pic de l’Estany6, 2400-2914 m, UTM: 31TCH 81. Siliceous substratum
(laminated schists).
10. Pic de Tristaina, 2490-2878 m, UTM: 31TCH 72. Siliceous substratum
(micaceous schists).
11. Pic d’Encampadana, 2420-2491 m, UTM: 31TCH 81. Calcareous
substratum.
12. Pic de la Coma Pedrosa, 2300-2942 m., UTM: 31TCH 771. Siliceous
substratum (black argillaceous schists and laminated schists).
13. Pic de la Portelleta, 2320-2910 m, UTM: 31TCH 80. Siliceous substratum
(granodiorite).
14. Pic dels Pessons, 2300-2889 m, UTM: 31TCH 90. Siliceous substratum
(granodiorite).
15. Pic de la Menera, 2700-2774 m, UTM: 31TCH 90. Siliceous substratum
(granodiorite).
List of taxa
Cladonia arbuscula (Wallr.) Flot. ssp. arbuscula (= Cladina arbuscula
(Wallr.) Hale & W.L. Culb. ssp. squarrosa (Wallr.) Burgaz)
Acidophilous, from 2500 to 2650 m.
Specimens examined: 6: Coma Estremera, 2500 m, Azu. 657, 666. 13:
Portella de Setut, 2650 m, Azu. 1704.
Cladonia asahinae J.\W. Thomson
Chemotype | (Brodo & Ahti, 1996). Acidophilous, 2600 m.
Specimens examined: 10: Costa Rodona, 2600 m, Azu. 1386.
Cladonia borealis S. Stenroos
Acidophilous and neutrophilous, from 2420 to 2914 m.
Specimens examined: 3: Coll de Juclar, 2440 m, Azu. 304, 308. 5: Torre dels
Soldats 2760 m, Azu. 526. 6: Coma Estremera 2500 m, Azu. 675. 7: summit
of Pic del Maia, 2614 m, Azu. 684, 722. 9: summit of Pic de |’Estanyé,
436
2914 m, Azu. 860, below the summit of Pic de |’Estanyo, 2900 m, Azu. 1103:
Serra del Roc del Rellotge, 2800 m, Azu. 909; 2750 m, Azu. 1127 d; 2700 m,
Azu. 959; 2510 m, Azu. 1014, 1017, 1189, 1199, 2070. 10: summit of Pic de
Tristaina, 2878 m, Azu. 1302, 1303, 1346; below the summit of Pic de
Tristaina, 2800 m, Azu. 1232: Collet de les Planes, 2700 m, Azu. 1268. 11:
Collet del Cap dels Clots, 2420 m, Azu. 1444. 12: Terregalls de l’Alt, 2700 m,
Azu. 1506. 13: summit of Pic de la Portelleta and Tossa Plana de Llés, 2910
m, Azu. 1545, 1612. Port de Setut, 2700 m, Azu. 1627, 1649, 1689, 1702:
Portella de Setut, 2650 m, Azu. 1717, 2490 m, Azu. 1759. 15: summit of Pic
de la Menera 2774 m, Azu. 2003, 2011, 2037.
Cladonia cariosa (Ach.) Spreng.
Acidophilous, from 2400 to 2780 m.
Specimens examined: 1: Serra del Cap de la Coma, 2780 m, Azu. 61. 10:
Costa Rodona, 2560 m, Azu. 1277, Estany de Més Amunt, 2490 m, Azu.
1396. 13: Basses de Setut, 2400 m, Azu. 1773. 14: Estany de les Fonts, 2500
m, Azu. 1953.
Cladonia chlorophaea (Flérke ex Sommerf.) Spreng.
Acidophilous, from 2340 to 2914 m.
Specimens examined: 1: summit of Pic de Cataperdis, 2805 m, Azu. 60. 4:
Font dels Clots de la Llosa, 2340 m, Azu. 421. 6: summit of Pic de
Montmalus, 2781 m, Azu. 625. 9: summit of Pic de l’Estany6, 2914 m, Azu.
1084: Serra del Roc del Rellotge, 2800 m, Azu. 893; 2600 m, Azu. 981; 2510
m, Azu. 2082, Clots de l'Estany6 2400 m, Azu. 1040, 1046, 2093, 2101, 2105.
13: Port de Setut, 2700 m, Azu. 1682, 1684: Portella de Setut, 2650 m, Azu.
1730; 2490 m, Azu. 1770, Pla d’Ingla, 2350 m, Azu._1782.
Cladonia diversa Asperges
Acidophilous, from 2440 to 2700 m.
Specimens examined: 3: Coll de Juclar, 2440 m, Azu. 294. 9: Serra del Roc
del Rellotge, 2510 m, Azu. 2072. 10: Costa Rodona, 2600 m, Azu. 1393. 12:
Terregalls de l’Alt, 2700 m, Azu. 1503, 1513.
Cladonia ecmocyna Leight. ssp. ecmocyna
Acidophilous, from 2300 to 2600 m.
Specimens examined: 9: Serra del Roc del Rellotge, 2600 m, Azu. 979; Clots
de l'Estany6, 2400 m, Azu. 1037, 1038. 13: Pla d’Ingla, 2350 m, Azu. 1785.
14: Estany Rod6, 2400 m, Azu. 1983, 1989; Estany Forcat, 2300 m, Azu.
1995, 1997.
Cladonia fimbriata (L.) Fr.
Acidophilous, from 2400 to 2942 m.
Specimens examined: 9: Clots de l’Estany6, 2400 m, Azu. 2103. 12: summit
of Pic de Coma Pedrosa, 2942 m, Azu. 1456, 1471. 14: below the Collada
dels Pessons, 2650 m, Azu. 1862.
437
‘Cladonia furcata (Huds.) Schrad.
Acidophilous, from 2500 to 2650 m.
Specimens examined: 6: Coma Estremera, 2500 m, Azu. 656. 13: Portella de
Setut, 2650 m, Azu. 1778.
Cladonia galindezii Ovstedal
Acidophilous, from 2400 to 2910 m.
Specimens examined: 1: Serra del Cap de la Coma, 2780 m, Azu. 110, 2700
m, Azu. 52. 5: La Serra Airosa, 2700 m, Azu. 481, 485. 9: Clots de I’Estany6,
2400 m, Azu. 1048. 10: Costa Rodona, 2560 m, Azu. 1276. 13: summit of Pic
de la Portelleta and Tossa Plana de Llés, 2910 m, Azu. 1552, ridge of Pic de
Setut, 2900 m, Azu. 1673.
Cladonia homosekikaica Nuno
Acidophilous, from 2380 to 2510 m.
Specimens examined: 1: south of Tarteres del Cap de la Coma, 2500 m, Azu.
66. 5: Coll de Finestres, 2380 m, Azu. 589. 9: Serra del Roc del Rellotge,
2510 m, Azu. 2068, Clots de l’/Estany6, 2400 m, Azu. 2100.
Cladonia macroceras (Delise) Hav.
Chemotype | (Fumarprotocetraric acid as major substance and protocetraric,
confumarprotocetraric and convirensic acids as minor substances).
Acidophilous, from 2320 to 2914 m.
Chemotype II (Atranorin and fumarprotocetraric acid as major substances and
protocetraric and confumarprotocetraric acids as minor substances).
Acidophilous, from 2490 to 2600 m.
Specimens examined: Chemotype I: 1: Tarteres del Cap de la Coma, 2690
m, Azu. 67; 2620 m, Azu., 55. 3: Coll de Juclar, 2440 m, Azu. 312. 4: summit
of Pic de la Serrera, 2914 m, Azu. 330, Llac Petit dels Meners de la Coma,
2490 m, Azu. 393, 403, 409. 5: La Serra Airosa, 2700 m, Azu. 466, 507. 6:
Coma Estremera, 2500 m, Azu. 665, 669, 680. 7: summit of Pic del Maia,
2614 m, Azu. 728. 9: summit of Pic de lEstany6, 2914 m, Azu. 875; 2900 m,
Azu. 1118, Serra del Roc del Rellotge, 2800 m, Azu. 925, 928; 2750 m, Azu.
1129; 2700 m, Azu. 955; 2600 m, Azu. 980, 986, 990, 1150, 2510 m, Azu.
1010, 1011, 2073, 2400 m, Azu. 1042. 10: summit of Pic de Tristaina, 2878 m,
Azu. 1318, 1339; Collet de les Planes, 2700 m, Azu. 1248, 1257, 1350, 1375,
over the Estany de Mes Amunt, 2540 m, Azu. 1290; Estany de Més Amunt,
2490 m, Azu. 1394 bis. 13: summit of Pic de la Portelleta and Tossa Plana de
Llés, 2910 m, Azu. 1580; Port de Setut, 2700 m, Azu. 1650, 1665; Clots de la
Portella de Setut, 2490 m, Azu. 1736, 1764; Basses de Setut, 2400 m, Azu.
1774, Pla d'Ingla, 2350 m, Azu. 1784; Pla d'Ingla-Cabana de Setut, 2320 m,
Azu. 1812. 14: under the Collada dels Pessons, 2650 m, Azu. 1885; Estany
del Cap dels Pessons, 2600 m, Azu. 1914; Estany de les Fonts, 2500 m, Azu.
1973, Estany Rod6, 2400 m, Azu. 1980. 15: summit of Pic de la Menera, 2774
‘m, Azu. 2038. Chemotype Il: 9: Serra del Roc del Rellotge, 2600 m, Azu.
1172. Clots de l’Estany6, 2400 m, Azu. 1043. 10: over the Estany de Més
Amunt, 2540 m, Azu. 1281; Estany de Més Amunt, 2490 m, Azu. 1406, 1408,
1394. 13: Clots de la Portella de Setut, 2490 m, Azu. 1756.
438
Cladonia macrophyllodes Ny|.
Acidophilous, from 2400 to 2540 m.
Specimens examined: 9: Clots de l'Estany6, 2400 m, Azu. 2105. 10: over the
Estany de Més Amunt, 2540 m, Azu. 1295, specimen’ without
fumarprotocetraric acid, a possible new chemotype (T. Ahti, pers. comm.).
Cladonia mitis Sandst. (= Cladina arbuscula (Wallr.) Flot. ssp. mitis (Sandst.)
Burgaz)
Acidophilous and neutrophilous, from 2300 to 2914 m.
Specimens examined: 1: Tarteres del Cap de la Coma, 2620 m, Azu. 59;
south of Tarteres del Cap de la Coma, 2500 m, Azu. 58. 3: Coll de Juclar,
2440 m, Azu. 272, 280, 296, 312. 4: summit of Pic de la Serrera 2914 m, Azu.
320, Llac Petit dels Meners de la Coma, 2490 m, Azu. 397. 7: summit of Pic
del Maia, 2614 m, Azu. 683. 9: Serra del Roc del Rellotge, 2800 m, Azu. 908,
927. 2750 m, Azu. 1141; 2600 m, Azu. 1157, 1163, 1165; 2510 m, Azu. 997,
1013, 1184, 1196, 2400 m, Azu. 1044, 2096, 2105. 10: summit of Pic de
Tristaina, 2878 m, Azu. 1321; Collet de les Planes, 2700 m, Azu. 1361, 1370;
over the Estany de Més Amunt, 2540 m, Azu. 1288; Estany de Més Amunt,
2490 m, Azu. 1403. 11: Collet del Cap dels Clots, 2420 m, Azu. 1449. 12:
below the Canals de |’Alt, 2300 m, Azu. 1541. 13: Port de Setut, 2700 m, Azu.
1637. Portella de Setut, 2650 m, Azu. 7692, 1710, Basses de Setut, 2400 m,
Azu. 1737, 1751; Pla d’Ingla-Cabana de Setut, 2320 m, Azu. 1806, 1813. 14:
Estany del Cap dels Pessons, 2600 m, Azu. 1944; Estany de les Fonts, 2500
m, Azu. 1970, 1972. 15: summit of Pic de la Menera, 2774 m, Azu. 1999.
Cladonia pleurota (Flérke) Schaer.
Acidophilous, from 2380 to 2500 m.
Specimens examined: 5: Coll de Finestres, 2380 m, Azu. 592. 6: Coma
Estremera, 2500 m, Azu. 658. 9: Clots de l’Estany6, 2400 m, Azu. 1049. 13:
Basses de Setut, 2400 m, Azu. 1776. 14: Estany Rod6o, 2400 m, Azu. 1986.
Cladonia pocillum (Ach.) Grognot
Basophilous and acidophilous, 2320 to 2914 m.
Specimens examined: 2: over the Coll Petit, 2500 m, Azu. 154. 3: Coll de
Juclar, 2440 m, Azu. 288, 297. 5: Torre dels Soldats, 2760 m, Azu. 563. 6:
Collet de Montmalus, 2700 m, Azu. 639. 8: summit of Pic de Casamanya,
2740 m, Azu. 758. 9: summit of Pic de I’Estany6, 2914 m, Azu. 854, 1086;
Serra del Roc del Rellotge, 2510 m, Azu. 1005. 10: summit of Pic de Tristaina,
2878 m, Azu. 1218. 12: Estany Negre, 2600 m, Azu. 1525. 13: Port de Setut,
2700 m, Azu. 1678, Portella de Setut, 2650 m, Azu. 1705, 1714, Basses de
Setut, 2450 m, Azu. 1767, 1771; Pla d’'Ingla-Cabana de Setut, 2320 m, Azu.
1798. 14: Collada dels Pessons, 2720 m, Azu. 1843; Estany del Cap dels
Pessons, 2600 m, Azu. 1918, 1937, Estany de les Fonts, 2500 m, Azu. 1948.
15: summit of Pic de Ja Menera, 2774 m, Azu. 2020, 2024.
a
439
Cladonia pyxidata (L.) Hoffm.
Chemotype |: Acidophilous and neutrophilous, from 2160 to 2914 m.
Chemotype Il: Acidophilous and neutrophilous, from 2400 to 2510 m.
Specimens examined: Chemotype |: 1: Serra del Cap de la Coma, 2700 m,
Azu. 51. 2: Els Travessers-Costa de les Eroles, 2200 m, Azu. 153; 2160 m,
Azu. 250. 4: Llac Petit dels Meners de la Coma, 2490 m, Azu. 410. 9: summit
of Pic de l’Estany6, 2914 m, Azu. 1166, 1084: below the summit of Pic de
lEstany6, 2900 m, Azu. 1111; summit of Pic de I’Estany6, 2800 m, Azu. 910;
Serra del Roc del Rellotge, 2700 m, Azu. 946; Serra del Roc del Rellotge,
2510 m, Azu. 2067, 2069, 2070, 2072, 2084, 2089, 2090, 2093. Clots de
’Estany6, 2400 m, Azu. 1039, 1040, 2101, 2104, 2105, 2091, 2094, 2095,
2097. 10: summit of Pic de Tristaina, 2878 m, Azu. 1300, 1311, 1339; Collet
de les Planes, 2700 m, Azu. 1365, 1369. 13: Port de Setut, 2700 m, Azu.
1681. Portella de Setut, 2650 m, Azu. 1699, 1722, 1730, Basses de Setut,
2450 m, Azu. 1731, 1766: Pla d'Ingla-Cabana de Setut, 2320 m, Azu. 1807,
1809. 14: below the Collada dels Pessons, 2650 m, Azu. 1854, 1880, 1895:
Estany de les Fonts, 2500 m, Azu. 1952, 1969; Estany Rod6, 2400 m, Azu.
1978, 1980. Chemotype II: 9: Serra del Roc del Rellotge, 2510 m, Azu. 2068:
Clots de I’Estany6, 2400 m, Azu. 2100. 11: Collet del Cap dels Clots, 2420 m,
Azu. 1446, 1447. 14: Estany Rod6, 2400 m, Azu. 1976, 1982, 1984, 1988.
Cladonia rangiferina (L.) F.H. Wigg.
Acidophilous, from 2340 to 2700 m.
Specimens examined: 4: Font dels Clots de la Llosa, 2340 m, Azu. 415. 9:.
Serra del Roc del Rellotge, 2510 m, Azu. 2077. 10: Collet de les Planes, 2700
m, Azu. 1265, 1236.
Cladonia subcariosa Nyl.
Chemotype IV (= C. sobolescens Nyl. ex Vain.)
Acidophilous, 2510 m.
Specimens examined: 9: Serra del Roc del Rellotge, 2510 m, Azu. 2066.
Cladonia subulata (L.) F.H. Wigg.
Acidophilous, from 2490 to 2914 m.
Specimens examined: 4: summit of Pic de la Serrera, 2914 m, Azu. 327, Llac
Petit dels Meners de la Coma, 2490 m, Azu. 401. 13: Clots de la Portella
Setut, 2490 m, Azu. 1730.
Cladonia symphycarpia (Flérke) Fr.
Basophilous and acidophilous, from 2160 to 2910 m.
Specimens examined: 1: Serra del Cap de la Coma, 2780 m, Azu. 111. 2:
over the Coll Petit 2500 m, Azu. 156, 157: Els Travessers-Costa de les
Eroles, 2160 m, Azu. 246. 8: Serra de Casamanya, 2400 m, Azu. 827. 10:
Collet de les Planes, 2700 m, Azu. 1359. 13: summit of Pic de la Portelleta
and Tossa Plana de Llés, 2910 m, Azu. 1585; Clots de la Portella de Setut,
2490 m, Azu. 1745. 14: below the Collada del Pessons, 2650 m, Azu. 1882.
15: summit of Pic de la Menera, 2774 m, Azu. 2001; Collet de la Menera,
2700 m, Azu. 2048, 2050.
440
Cladonia uncialis (L.) F.H. Wigg. ssp. biuncialis (Hoffm.) M. Choisy
Acidophilous, from 2440 to 2914 m.
Specimens examined: 3: Coll de Juclar, 2440 m, Azu. 277, 304, 312. 4:
summit of Pic de la Serrera, 2914 m, Azu. 324: Llac Petit dels Meners de la
Coma, 2490 m, Azu. 389. 9: Serra del Roc del Rellotge, 2850 m, Azu. 1127;
2600 m, Azu. 986, 1165; 2510 m, Azu. 2077, Clots de l'Estany6, 2400 m, Azu.
2096. 10: summit of Pic de Tristaina, 2878 m, Azu. 1321; Collet de les Planes,
2700 m, Azu. 1247, 1373.
Cladonia sp. 1
Acidophilous, from 2650 to 2914 m.
Specimens examined: 4: Bony de I’'Estany Mort, 2650 m, Azu. 440. 6: summit
of Pic de Montmalus, 2781 m, Azu. 597, 622, 629. 9: summit of Pic de
'Estany6, 2914 m, Azu. 868, 1055, 1065; below the summit of Pic de
l'Estany6, 2900 m Azu. 1100, 1109. 13: summit of Pic de la Portelleta and
Tossa Plana de Llés, 2910 m, Azu. 2114, 2118, 2129.
Cladonia sp. 2
Acidophilous, 2650 m.
Specimens examined: 13: Portella de Setut, 2650 m, Azu. 1713.
Discussion
Species
In the meadow region of Andorra 24 taxa have been identified: 19 species, 3
subspecies and 2 unidentified taxa. This region show a relatively high species
richness, compared with Spain (68 taxa of Cladonia were reported by Burgaz
& Ahti, 1998). The studied area has ca. 173 km’? and the altitudinal range is
842 m, in front of ca. 505.000 km? and an altitudinal range of 3478 m of Spain.
The presence in Andorra of C. galindezii (Ovstedal, 1988), considered as an
endemism from the Antarctic region (Stenroos, 1993), is confirmed by eight
specimens collected from five localities, between 2400 and 2910 m. Our
specimens have only the primary thallus with atranorin (M), porphyrilic acid
(M) and methyl porphyrilate (m, occasionally present). Morphologically and
chemically, our specimens are very similar to the holotype of C. galindezii
and, in our opinion, it is only possible to assign them to this taxon (confirmed
by T. Ahti and H. Sipman).
Cladonia asahinae, of the C. chlorophaea group, was originally described and
characterized by the presence of protolichesterinic acid (Thomson, 1976).
Henning (1983) found, in the type specimen, rangiformic and norrangiformic
acid instead protolichesterinic acid. Brodo & Ahti (1996) reported three
chemotypes for C. asahinae. Our specimen contains rangiformic and
fumarprotocetraric acids as major substances, and _ norrangiformic,
protocetraric and confumarprotocetraric acids as minor substances.
Consequently, we can include it in the chemotype | (Brodo & Ahti, op. cit.).
This species has a widespread distribution in the world. The chemotype | is
the most common one and, in Europe, it is known from North and Central
regions (Brodo & Anti, op. cit.). It is here reported for the first time for the
Iberian Peninsula.
44]
C. macroceras, in the SW Europe only known from the West Pyrenees (Anhti,
1980), is abundant in the studied area. We found some specimens with
atranorin, a substance that is reported as present or absent for this species
(Ahti, op. cit.), but in addition, we observed that specimens with atranorin have
not convirensic acid, which is normally present in specimens without atranorin.
We propose the recognition of two chemotypes: I, with fumarprotocetraric acid
as major substance, and protocetraric, confumarprotocetraric and convirensic
acids as minor substances, and Il, with atranorin and fumarprotocetraric acid
as major substances, and protocetraric and confumarprotocetraric acids as
minor substances. The Chemotype | is more frequent (87.3%) and has wider
altitudinal range than the Chemotype Il, which is less frequent (12.7%, n = 55)
and has a small altitudinal range.
Specimens with squamules greenish brown, ascending, (0.28-) 0.50-1.63 (-
3.25) mm wide, grouped in compact cushions, without podetia, and containing
atranorin and homosekikaic acid as major substances, and sekikaic and 4’-O-
methylnorhomosekikaic acids as minor substances, are here named Cladonia
Sp. 1.
The single unidentified specimen here named Cladonia sp. 2, is similar to
Cladonia sp. 2 of Culberson et a/. (1993). Morphologically and chemically, it is
very similar to C. symphycarpia. \ts chemical composition, with atranorin,
norstictic and bourgeanic acids as major substances and connorstictic acid as
minor substance, can be interpreted as a new chemotype of C. symphycarpia
(T. Ahti, pers. comm.).
C. subcariosa is represented, in the study area, by only one specimen, devoid”
of podetia, containing homoheveadride (HHEV) and fumarprotocetraric acids
as major substances, and_ protocetraric, confumarprotocetraric and
convirensic acids as minor substances. This chemical composition, without
convirensic acid, was described by Ahti (2000) as chemotype IV of C.
subcariosa. We have included our specimen in this chemotype, which is
recorded for the first time from Europe. It is frecuent in eastern North America
and eastern Asia, where it is commonly recognized as a distinct species, C.
sobolescens Nyl. ex Vain. (= C. clavulifera Vain.), (Culberson ef a/., 1993).
In C. pyxidata, we found the two chemotypes proposed by Ahti (2000).
Chemotype | is widely distributed in the studied area, and we found
convirensic acid as a minor substance, in addition to the known substances
(Ahti, op. cit.). Chemotype II is poorly represented in the studied area, with
homosekikaic, sekikaic (+t) and fumarprotocetraric acids as major substances
and. protocetraric, | confumarprotocetraric, convirensic and 4’-O-
methylnorhomosekikaic acids as minor substances. Sekikaic acid, is a minor
substance in 5 specimens, and a major substance in 3 specimens. In the
neotropical specimens the sekikaic acid is only present in trace concentrations
(Ahti, op. cit.). One specimen (Azu. 1982), included by us in the same
chemotype, has podetia proliferating from the center of cups not from the
margins of cups (Anti, op. cit.). Chemotype II is a new report for Europe. It was
earlier reported from Guatemala and Honduras (Ahti, 2000).
442
Table 1.-Presence and quantity of lichen substances in genus Cladonia from
phaea
QYOTO
=|3/9
91S|o
ag pS
o | 2
a
C. macroceras (chemotype |)
. pocillum
idata (chemotype |)
idata (chemotype II
C. homosekikaica
C. subcariosa
C. asahinae
C. ecmocyna ssp. ecmocyna
C. macrophyllodes
C. macroceras (chemotype ||
C. rangiferina
CrS0.4
C. symphycarpia
2
C. galindezii
C. cariosa
C. arbuscula ssp. arbuscula
C. mitis
C. borealis
C. uncialis ssp. biuncialis __
C. diversa
C. pleurota
2) QYOPOLOPO
w” OSes
@
SIS
Qc
7] @:
|
Oo
=a
@)
=
(e)
+
Me
me)
(4)
A.- Atranorin DB.- 4-O-Demethylbarbatic acid
B.- Barbatic acid F.- Fumarprotocetraric acid
Bg.- Bourgeanic acid H.- Homosekikaic acid
CF.- Confumarprotocetraric acid (Cph-2) | HHEV.- Homoheveadride
CN.- Connorstictic acid Iso.- Isousnic acid
CV.- Convirensic acid (Cph-1) MPf.- Methyl porphyrilate
443
Andorra (M, major substance; m, minor substance).
BOE SESE PEG eaee
Rg.- Rangiformic acid
S.- Sekikaic acid
Sk.- Skyrin
N.- Norstictic acid
-O-Methylnorhomosekikaic acid
Norrangiformic acid
P.- Protocetraric acid
Pf.- Porphyrilic acid
NH.- 4’
Sq.- Squamatic acid
U.- Usnic acid
Z.- Zeorin
Rd.- Rhodocladonic acid
NRg.-
444
Chemistry
A summary of the chemical compounds is given in Table 1. In this table the
taxa are grouped according to their chemical composition. The abundance of
each substance is given (M = major and m = minor). In all, 24 lichen
substances, belonging to 16 chemosyndromes have been identified in the
present survey. The chemosyndrome most frequent is fumarprotocetraric (M),
protocetraric (m), confumarprotocetraric (m) and convirensic (m) acids. It has
been found by us in C. chlorophaea, C. fimbriata, C. furcata, C. macroceras
(chemotype |), C. pocillum, C. pyxidata (chemotype |) and C. subulata.
In the Cladonia species examined in the surveyed area, the
fumarprotocetraric acid is always a major substance, and is present in most of
the taxa (58,3%, n = 24). The cortical substances atranorin and usnic acid are
present in 6 chemosyndromes and 9 taxa, and in 6 chemosyndromes and 6
taxa repectively.
Substratum and altitudinal distribution
In the calcareous mountains (numbers 2, 8 and 11, represented by 16
stations) only 5 species of C/adonia have been found: C. pocillum and C.
symphycarpia, that are strongly basophilous, and C. borealis, C. mitis and C.
pyxidata (chemotype Il), that are moderately basophilous. The maximum
diversity has been found in the siliceous mountains (24 taxa). We can
conclude that the genus C/adonia is more diversified in the siliceous alpine
region than in the calcareous alpine region in the studied area.
Regarding the abundance and diversity of the genus C/adonia growing in the
siliceous mountains, the substrata most favourable are the schist and the
granodiorite, and the least favourable are the black argillaceous schists
(mountains 5 and 12).
In order to simplify the analysis of the altitudinal data, we selected the
siliceous mountains. The siliceous substratum is the most abundant in the
area of study and is represented in 67 stations from 12 mountains. Its
altitudinal range is from 2300 to 2900 m.
Taking into account the altitudinal distribution, in the alpine region, four groups
of taxa can be observed (Table 2):
Group 1: (2300-2900 m) present in all the elevations. For example, we found
C. chlorophaea in exposed places within the forest of Pinus uncinata, in
higher places we found it under the shrubs of Rhododendron ferrugineum and
Juniperus communis, and in the altitudes, where those shrubs do not reach,
we found it under big blocks. Similarly, C. macroceras (chemotype |), found in
sunny and exposed situations in lower elevations, is found it in cavities under
rocks at the summits.
Group 2: (2300-2700 m) taxa not present in the highest stations.
Group 3: (2400-2700 m) taxa only present in middle stations. |
Group 4: (2400-2900 m) taxa present with preference in the highest stations
and not present in the lower stations.
445
Table 2. Altitudinal distribution of Cladonia taxa in the silicicolous stations.
Presence (@) and absence (-----) in the prospected stations.
2300 2400 2500 2600 2700 2800 2900 _
ie symphycarpia t @
C. pyxidata (chemotype |!) @ @
C. mitis @ ®
C. macroceras (chemotype |) 9 }
C. chlorophaea @ @
C. pocillum @ e
C. fimbriata @
C. rangiferina
@ @ @ ® @ Anite eens) «* pdasel
C. homosekikaica & ® @ pane A IY tec" itantsndes) gpk as
C. pleurota oe) @ @ Beiretad A eprmun he) / Cll eaesl¥ PER seaies
@ @ jf RAE HAS Ht gad Did ey SORT
C. macrophyllodes
C. cariosa is e
6 & 8 dh dene
C. diversa ------ BS ® @ ® i
C. macroceras (chemotype Il) ----—- @ @ co) NEE Si os el Tl RO As
C. arbuscula a ® @ Be SS Ser is See ie
C. furcata eRe py @ Q a Beh CNR Ee
C. pyxidata (chemotype II) oho ® @ SS ee ene
C. subcariosa — ® eee ts See eee ee
C. sp. 2 oe ae os] Seale)" ei ken fesoeaues
C. asahinae
C. borealis wae ae @ @ ®
C. galindezii — @ @ ® @ ® ®
C.subulata ——— @ @ ® ® ® ®
C. uncialis -——- ® i) @ ® 6 @
Acknowledgements
We thank ‘Drs. T. Ahti and H. Sipman for revising critical specimens and the
herbarium BM for providing specimens. The study was financially supported
by grant from the Institut d’Estudis Andorrans (Government of Andorra).
446
Literature cited
Azuaga, |., Barbero, M. & Gomez-Bolea, A. (in preparation) Checklist of
terricolous, humicolous and muscicolous lichens (without genus
Cladonia), and its lichenicolous fungi in the alpine belt of Andorra.
Ahti, T. (1980) Taxonomic revision of Cladonia gracilis and its allies. Ann. Bot.
Fennici 17: 195-243.
Ahti, T. (2000) Cladoniaceae. Flora Neotropica Monograph 78: 1-362.
Brodo, |.M. & Ahti, T. (1996) Lichens and lichenicolous fungi of the Queen
Charlotte Islands, British Columbia, Canada. 2. The Cladoniaceae.
Canadian Journal of Botany 74: 1147-1180.
Burgaz, A.R. & Ahti, T. (1998) Contribution to the study of the genera Cladina
and Cladonia in Spain. Ill. Nova Hedwigia 66: 549-555.
Culberson, W.L., Culberson, C.F. & Johnson, A. (1993) New chemistries in
the Cladonia cariosa complex and homoheveadride in natural thalli and
single-spore cultures of C. polycarpoides and C._ polycarpia.
Bibliotheca Lichenologica 53: 43-52.
Elix, UA. & Ernst-Russell, K.D. (1993) A catalogue of standardized thin layer
chromatographic data and biosynthetic relationships for lichen
substances. Canberra: Australian National University. 163 pp.
Eriksson, O.E. (ed.) (1999) Outline of Ascomycota. Myconet 3: 1-88.
Henning, C. (1983) The Cladonia chlorophaea-C. fimbriata complex in
western Washington. Bryologist 86: 64-73.
Ovstedal, D.O. (1988) Cladonia galindezii, a new Antarctic lichen species.
Cryptogamie, Bryol. Lichénol. 9: 137-1339.
Stenroos, S. (1993) Taxonomy and distribution of the lichen family
Cladoniaceae in the Antarctic and peri-Antarctic regions. Cryptogamic
Botany 3: 310-344.
Thomson, J.W. (1976) Cladonia asahinae sp. nov. from western North
America. Journal of Japanese Botany 51: 360-364.
MY COTAXON
Volume LXXIX, pp. 447-454 July-September 2001
BIOSYSTEMATICS OF THE DIDYMIUM IRIDIS SUPER SPECIES
COMPLEX: ADDITIONAL ISOLATES
JIM CLARK
T. H. Morgan School of Biological Sciences, University of Kentucky, Lexington, KY 40506
STEVEN L. STEPHENSON
Department of Biology, Fairmont State College, Fairmont, WV 26554
JOHN C. LANDOLT
Department of Biology, Shepherd College, Shepherdstown, WV 25443
Abstract: Forty-six isolates referable to the Didymium iridis super species complex were cultured
and their reproductive system determined. Thirty of the isolates were nonheterothallic and
presumptive apomicts, while the remaining 16 isolates were heterothallic and found to belong to
seven biological species: AO or D. ovoideum (one isolates), Al or Caribbean (five isolates), A2 or
Northeastern US (one isolate), A5 or D. megalosporum (five isolates), A8 or Hawaii (one isolate),
A9 or Costa Rican B (two isolates), and A10 or Mexican (one isolate). As such, most of the sexual
isolates of this cosmopolitan complex conformed to the pattern of geographically based sibling
species that are part of a more widely distributed species complex. However, the A5 and AO groups
have worldwide distributions and are primarily the basis of the Didymium megalosporum and D.
ovoideum morphospecies descriptions to which they partially conform. These results suggest that
the long non-calcareous stalked Didymium are an extremely complicated series of species
complexes, each consisting of one or more biological species and countless apomictic lines with
overlapping morphology. While the morphological defined species are, in a few cases, correlated
with a reproductive group, the reproductive groups, in general, are not assignable to a
morphologically based taxon.
Key Words: apomixis, biological species, myxomycetes, heterothallism
INTRODUCTION
Myxomycete taxonomy, at present, is based almost entirely upon sporangial morphology, with most
taxonomists using a typological species concept (i.¢., a species consists of individuals conforming
to a constant morphological form that varies only within narrow boundaries). However, since
myxomycetes are small, widely distributed organisms with a fairly restricted suite of morphological
variations, it is not always easy to find the discrete morphological gaps between groups that are
essential to the typological concept. Also, since little or nothing is known about the underlying
genetic or developmental basis for the variations that do occur, taxonomists are left to make
decisions based upon their own intuitive evaluation of these character variations (Clark 2000).
This problem is compounded by the fact that many species descriptions are based on a limited
number of specimens from a restricted geographical region and thus may not adequately represent
the total range of variations for the population. Therefore, there is a need for experimental and
population studies in this group so that a more natural system of taxonomy can be developed for
the Myxomycetes.
448
A recent biosystematic report (Clark and Mires 1999) on the non-calcareous, long-
stalked species of Didymium suggested that most collections of this group, could be assigned to
three taxa: Didymium iridis (Ditmar) Fries, Didymium ovoideum Nann.-Brem., and Didymium
megalosporum Berk. & Curt. Didymium iridis was considered to be a genetic and morphologically
variable species complex consisting of a number of regionally based sibling species and a large
number of apomictic lines derived from them by the suppression of meiosis. Therefore, this taxon
apparently encompasses several other species whose descriptions indicate that they are
morphological forms of this group. Consequently, Didymium bahiense Gottsberger, Didymium
nigripes (Link) Fries, Didymium verrucosporum Welden and possibly several other rare species
were considered to be members of this complex. Didymium ovoideum, with its slightly prolate
sporangium and red to red brown stalk, can generally be distinguished from members of the D.
iridis complex by its morphological as well as its genetic (non mating and plasmodial color)
differences. However, the distinctive morphology of the D. megalosporum description
(ochraceous, robust, lobate sporangia with a light brown globose collumela and nearly smooth
spores) is seldom found as an entire character suite in any of the isolates and in some cases these
distinctive characters are entirely missing so that the isolates grade morphologically into the D.
iridis complex. Therefore, in an attempt to confirm these earlier observations and produce a better
characterization of these taxa, additional isolates were obtained and studied.
MATERIALS AND METHODS
Spores from a sporangium, derived from either moist chamber cultures (Gilbert and Martin 1933)
or field collections, were crushed on % CM agar (9 g Difco corn meal agar and 10 g plain agar per
L of distilled water), where they germinated to produce amoebal populations and eventually
plasmodia. These plasmodia were then cleaned of all fungal and most bacterial contamination by
allowing them to migrate over 2% water agar (20 g plain agar per L of distilled water). The
purified plasmodia, after being fed sterile rolled oats, grew into large plasmodia that were induced
to sporulate by placing them in a lighted chamber (a 16:8 light:dark cycle) on 4% water agar. The
resulting sporangia were then used as a source of spores to test for reproductive systems (Clark
1995). Sporangia were crushed in a small amount of water and the resulting spore slurry spotted
onto a '%CM plate. After the spores germinate, the resulting amoebae migrated away from the
spots and individual amoeba were sterilely isolated under a dissecting microscope (60 X) with a
fine pointed needle and placed on new 2 CM agar plates. A bacterial food source was then added
to each plate which was then flooded with sterile distilled water to promote the growth of amoebal
clones. If the resulting clones produce plasmodia by themselves, they were classified as
nonheterothallic. However, if they did not produce plasmodia unless crossed with another clone,
they were designated as heterothallic. In either case, some of the resulting plasmodia were induced
to sporulate and a second generation tested for its reproductive system. A minimum of 20 clones
for each generation was tested per isolate. Selected mating type testers, from each heterothallic
isolate, were then crossed in all possible combinations to detect multiple allelism and biological
species (Clark, 1995).
A representative sample of sporangia, for each isolate, was examined with dissecting
and compound microscopes to assess morphological variations. These observations were then
recorded and used to compare the morphological similarities and differences of the various isolates.
RESULTS
Reproductive systems Table | lists the isolates, their origin and reproductive system. Twenty-
one of the Didymium iridis complex isolates (CR 9, CR 10, CR 11, CR 17, Ecu 1, Ecu 2, Ecu 3,
Fr 2, Ha 5, Ha 6, Idn 1, Idn 2, PR 1, PR 2, SC 1, SC 2, SC 3, Tex 3, Thai 1, Thai 4, Thai 5) were
found to be nonheterothallic. The 15 remaining D. iridis complex isolates were heterothallic and
members of six different biological species. Five isolates (CR 12, CR 13, CR 14, CR 15, CR 16)
were in the Al (Caribbean) mating series, although only one mating type was recovered from the
449
TABLE 1. ISOLATE ORIGIN AND REPRODUCTIVE SYSTEMS
Isolate Origin Reproductive system *
Didymium iridis and D. megalosporum
CR 9 Clark, Heliconia litter mc’, Monteverde, Costa Rica Nonheterothallic
CR 10 Stephenson 8195, aerial litter mc, primary forest, Cahuita, CR Nonheterothallic
CR 11 Stephenson 9135, aerial litter mc, primary forest, Cahuita, CR Nonheterothallic
CR 12 Stephenson 9136, aerial litter mc, primary forest, Cahuita, CR ARR
CR 13 Stephenson 9141, aerial litter mc, primary forest, Cahuita, CR AIR
CR 14 Stephenson 9166, aerial litter mc, primary forest, Cahuita, CR Ale
CR 15 Stephenson 9134, aerial litter mc, primary forest, Cahuita, CR Als
CR 16 Stephenson 9144, aerial litter mc, primary forest, Cahuita, CR AL?
CR 17 Stephenson 12128, canopy litter mc, montane forest, Monteverde § Nonheterothallic
CR 18 Stephenson 12129, litter mc, dry coastal forest near Santa Rosa NP AQ!
CR 19 Stephenson 12130, litter mc, dry coastal forest near Santa Rosa NP A9!?
Cur 1 Clark, plant litter mc, Curacao, Netherlands Antilles AS,
Ecu 1 Stephenson 9739, cloud forest Macquipucuna Reserve, Ecuador Nonheterothallic
Ecu 2 Stephenson 9908, cloud forest Macquipucuna Reserve, Ecuador Nonheterothallic
Ecu 3 Stephenson 9902, cloud forest Macquipucuna Reserve, Ecuador Nonheterothallic
Er2 Meyer 16883, Langon ZI, France Nonheterothallic
Ha 2 Landolt, soil mc, Kipuka Puaula Bird Park, Hawaii Volcanoes NP AS”
Ha 3 Landolt, soil mc, Sacred Falls Trail near Hauula, Hawaii AS
Ha 4 Landolt, soil mc, Kipuka Puaula Bird Park, Hawaii Volcanoes NP A8!?
Ha 5 Landolt, soil mc, Manoa Falls Trail Honolulu, Hawaii Nonheterothallic
Ha 6 Stephenson 7984, forest floor litter mc, Hawaii Nonheterothallic
Idn 1 Clark, banana litter mc, Ngampel/Kediri, E. Java, Indonesia Nonheterothallic
Idn 2 Clark, banana litter mc, Donayan/Kediri, E. Java, Indonesia Nonheterothallic
Mex 4 Stephenson 12629, forest floor litter mc, El Eden, Yucatan, Mexico A10!?
PR 1 Stephenson 8033B, forest litter mc, El Verde, Puerto Rico Nonheterothallic
PR 2 Clark, secondary forest litter mc, El Verde, Puerto Rico Nonheterothallic
SC 1 Stephenson 12657, magnolia flower mc, Summerville, S.C. Nonheterothallic
SG Stephenson 12697, old inflorescence mc, James Island, S.C. Nonheterothallic
SC 3 Stephenson 12712, old rose petals mc, Summerville, S. C. Nonheterothallic
EXSS. Stephenson 12257, litter mc, Sotal Grassland Big Bend NP Nonheterothallic
Thai 1 Stephenson 9168, litter mc, Kanchanaburi Falls, Thailand Nonheterothallic
Thai 2 Stephenson 9159, litter mc, Kanchanaburi Falls, Thailand A57'°
Thai 3 Stephenson 9147, litter mc, Kanchanaburi Falls, Thailand AS
Thai 4 Stephenson 9131, litter mc, Kanchanaburi Falls, Thailand Nonheterothallic
Thai 5 Stephenson 9160, litter mc, Kanchanaburi Falls, Thailand Nonheterothallic
WV 1 Stephenson 11273, corn litter mc, north central W. Virginia A2°
Didymium ovoideum
CR 1 Stephenson 8190, aerial litter mc, near Irazu, Costa Rica Nonheterothallic
CR2 Stephenson 12132, ground litter mc, near Santa Rosa NP Nonheterothallic
CRS Stephenson 12131, ground litter mc, near Santa Rosa NP Nonheterothallic
Idn 1 Clark, banana litter mc, Moloroto/Kediri, East Java, Indonesia Nonheterothallic
Idn 2 Clark, banana litter mc, Nqayan/Kediri, East Java, Indonesia Nonheterothallic
Idn 3 Clark, banana litter mc, Semanpit/Kediri, East Java, Indonesia Nonheterothallic
Idn 4 Clark, banana litter mc, Kedaton, Bandor Lampung, Sumatra Nonheterothallic
Idn 5. Clark, banana litter mc, Kedaton, Bandor Lampung, Sumatra Nonheterothallic
Tenn 1 Stephenson 12729, forest floor litter mc, GSMNP, Tennessee Al?
Tenn 2 Schnittler 15835/5, leaf litter, GSMNP, Tennessee Nonheterothallic
* Reproductive systems = nonheterothallic or heterothallic; the mating series of the heterothallic isolates are
indicated with an A and number (i.e., Al, A2, etc.), and the alleles are indicated by superscript numbers.
’mc = moist chamber culture.
450
CR 15 and CR 16 isolates. These highly skewed ratios (the second mating type can generally be
recovered if enough clones are isolated) are fairly common in the myxomycetes, although no
definite explanation for this phenomenon has yet been determined (Clark 1997). All five of these
isolates are from the Cahuita area on the Caribbean coast of Costa Rica and are compatible with
the common biological species (A1) of the Caribbean region (Clark and Landolt 1993). The CR
12 isolate had two new mating type alleles (Al’° and A1'®), CR 13 had one new (A1’’) and one old
(A1°) allele, CR 14 had one new (A1'*) and one old (A1’) allele, and both the CR 15 and CR 16
isolates had a single Al’ allele. The WV 1 isolate was compatible with the A2 mating series of
the Northeastern region of the USA (Clark and Stephenson 1990) and only a single new allele (A2°)
was found in this isolate. Five isolates (Cur 1, Ha 2, Ha 3, Thai 2, Thai 3) were members of the
world wide AS mating series, although again only a single mating type allele was found in the Thai
3 isolate. Two new alleles (A5° and A5’) were recovered from the Ha 2 isolate, one new (A5°) and
one old (A5') allele from the Ha 3 isolate, one new (A5’) and one old (A5°) allele from the Cur 1
isolate, one new (A5"°) and one old (A357 ) allele from the Thai 2 isolate, and a single (A5"') allele
from the Thai 3 isolate. The Ha 4 isolate was found to represent a new biological species (Hawaii),
since it did not mate with any of the known mating series tester clones, and it has two mating types
(A8'and A8’). CR 18 and CR 19 isolates also are members of a new biological species (Costa
Rican B) since they were also genetically isolated from the rest of the complex. Both of these
isolates are derived from litter collected in a dry coastal forest near the Santa Rosa National Park
in Costa Rica and are thus apparently sympatric with the widespread Al (Caribbean) and restricted
A4 (Costa Rica A) biological species. The CR 18 isolate has a single mating type (A9'), while CR
19 has two (A9' and A9*) mating types. The Mex 4 isolate is also a representative of a new
biological species since it was reproductively isolated from all of the other sexual isolates, and it
has two mating types (A10' and Al0’). Nine (CR 1, CR 2, CR 3, Idn 1, Idn 2, Idn 3, Idn 4, Idn
5, Tenn 2) of the Didymium ovoideum isolates were found to be nonheterothallic and the tenth
(Tenn 1) was heterothallic with a single mating type (A0*) compatible with the heterothallic
Virginia/West Virgiia series (Clark and Stephenson 1994).
Morphology The morphology of each of the different reproductive groups is examined separately.
Al (Caribbean) sibling species Isolates CR 12, CR 13, CR 14, CR 15 and CR 16 are
members of the Al sibling species and were all isolated from the Cahuita area of southeastern
Costa Rica. Four of these isolates have an almost identical morphology, with the CR 16 isolate
being somewhat different. They all display slightly depressed globose sporangial heads and long,
light orange-brown stalks, although the CR16 sporangial head was somewhat lobose. The
sporangial heads, in all five isolates, have thin colorless peridial membranes covered with white
stellate calcium carbonate crystals (in the more poorly developed sporangia the lime crystals are
lumpy and grainy). The columellae are white (lime covered), discoid to ovoid in shape, and the
umbilicus is closed in all of the isolates except CR 16. The capillitium consists of a network of
slender branching and anastomosing colorless to pale brown-tinged threads and the 7-8 « diam.
spores are brown and covered with small to minute warts. All five of these isolates have the
standard brown plasmodium of the complex.
A2 (Northeastern US) sibling species The single isolate (WV 1) of this sibling
species has a sightly depressed globose sporangial head and intermediate to long light orange-
brown colored stalks. The thin colorless peridial membrane is covered with white stellate lime
crystals and the white columella is thinly discoid with a closed umbilicus. This isolate has a
capillitial network of fine colorless threads and brown 9 uu diam. spores covered with minute warts.
This isolate also has the standard brown plasmodium.
A5 (D. megalosporum) sibling species These five isolates (Cur 1, Ha 2, Ha 3, Thai
2, Thai 3) are similar in that they all have robust, sightly depressed, globose sporangial heads and
intermediate to long, light to medium orange-brown stalks. The thin colorless peridial membranes
are covered with white stellate (lumpy and grainy in poorly developed sporangia) lime crystals and
the ovoid to globose columellae have a closed umbilicus and are generally white with a yellowish
tinge (most Ha 2 and Ha 3 sporangia generally lack the yellowish tinge). The capillitium consists
of a network of colorless to pale brown-tinged threads and the brown 7-9 « diam. spores have a
45]
varied ornamentation, with the Ha 2, Ha 3, and Cur | isolates having minute warts and the Thai
2 and Thai 3 isolates having small to distinct warts. These isolates differ from previously reported
AS isolates in their lack of lobate sporangial heads and the presence of more distinct spore
ornamentation in the Thai 2 and Thai 3 isolates (Clark and Mires, 1999). Four of these five
isolates have the standard brown plasmodium, but Ha 2 has a light tan (cream) colored plasmodium
that is correlated with its light orange-brown colored stalk.
A8 (Hawaii) sibling species Ha 4 is the single isolate of this new sibling species.
This isolate has a sightly depressed globose sporangial head with an intermediate length light
orange-brown colored stalk. White stellate lime crystals cover the thin colorless peridial membrane
and the white discoid columella, which has a closed umbilicus. The capillitium is a network of
thin colorless threads and the spores are brown, minutely warted and 9 y. in diameter. This isolate
has the standard brown colored plasmodium of the complex.
A9 (Costa Rican B) sibling species These two isolates (CR 18, CR 19) have very
similar morphology, with depressed globose sporangial heads and intermediate length medium
orange-brown colored stalks. White stellate to lumpy lime crystals cover the thin light brown
peridium and the globose to discoid columella has a closed umbilicus. The columella varies from
white to brown depending upon the presence or absence of lime. The capillitial network consists
of thin colorless to light brown-tinged threads and the spores are brown, minutely warted and 7-8
j4in diameter. These isolates also have a brown plasmodium.
A10 (Mexican) sibling species This isolate (Mex 4) has a depressed globose
sporangial head and long to intermediate length medium orange-brown colored stalks. Stellate
white lime crystals cover the thin hyaline peridium and the brownish (little to no lime) discoid
columella has a closed umbilicus. The capillitium is a network of thin hyaline threads and the
brown minutely warted spores are 7-9 « in diameter. The plasmodium is the standard brown
plasmodium of the complex.
Nonheterothallic D. iridis complex isolates This is a more diverse group of isolates;
however, they can still be separated into several fairly coherent morphological units. Ten of the
isolates (CR 10, CR 11, Fr 2, Ha 5, Idn 1, PR 2, SC 1, SC 2, SC 3, Thai 3) form a loose group of
similar sporangia with three subgroups. The first subgroup consists of the CR10, CR 11, PR 2, SC
1, and SC 2 isolates, all of which have sightly depressed globose sporangial heads and intermediate
to long, light (very light in CR 10) orange-brown colored stalks. . They also have thin colorless
peridial membranes covered with white stellate (grainy when poorly developed) lime crystals and
white discoid (nearly globose in SC 1) columellae with open to partially open umbilica. The
capillitium is a network of thin colorless to pale brown-tinged threads and the spores are brown,
7-10 42 diam. and minutely warted. The Ha 5, Idn 1, SC 3, and Thai 5 isolates comprise a second
subgroup that differs from the first subgroup in having dark orange-brown stalks and a closed
umbilicus (Ha S is slightly open). The Fr 2 isolate, which is the sole member of the third subgroup,
also differs from the first subgroup in having a white to brownish yellow (lacking lime) columella
and more prominently warted spores. Six of the isolates of this group have the standard brown
plasmodium, but the plasmodium of CR 10 is cream colored and that of Idn 1 is yellowish tan.
CR 10 has a very light colored stalk that is correlated with its plasmodial color, but the Idn 1 stalk
is not light colored, possibly due to slow sporangial development (Clark and Mires 1999). The SC
1 and SC 2 plasmodia also differed in color (a light brown that correlates with their light colored
stalk) but are most noticeably different in terms of their smaller size and more rapid fruiting.
A second group of isolates was based on a cluster consisting of the CR 17, Ecu 2, Ecu
3, and Idn 2 isolates that have sightly depressed globose sporangial heads and long, dark orange-
brown colored stalks. Their peridial membranes are thin, colorless and covered with white stellate
lime crystals and their dark to yellowish tinged columellae are ovoid to globose and have a closed
umbilicus. The capillitial network consists of colorless to pale brown tinged threads and the
minutely warted spores are brown and 7-10 diam. The Thai | and Thai 4 isolates differ from
this first cluster in having darker brown more distinctly warted spores. The six isolates, of this
group, all have a standard brown plasmodium.
452
Finally, the Ecu | and Tex 3 isolates each have a fairly unique morphology. The Ecu
1 isolate has a depressed to flattened sporangial head and long, dark orange-brown stalks. Its
peridial membrane is thin, colorless and covered with white stellate lime crystals and its white
columella is a thin plate in a wide shallow umbilicus. The capillitial network consists of thin
hyaline threads and the brown 8-9 y diam spores are minutely warted. The brown plasmodium is
standard for the complex. The Tex 3 isolate has a globose to sightly depressed globose sporangial:
head and short to intermediate light orange-brown stalks. The thin, colorless peridial membrane
is covered with white stellate lime crystals and its “columella” consists of a basal plate without an
umbilicus. However, it has a standard capillitial network of colorless threads and brown 9 yz diam.
minutely warted spores. Tex 3 is also unique in that it has a light yellow colored plasmodium that
correlates with its light colored stalk.
Heterothallic D. ovoideum isolate The Tenn 1 isolate sporulated poorly in culture but
produced morphologically standard sporangia. The globose to prolate sporangial heads are
supported by intermediate to long moderate red-brown stalks with a closed umbilicus. The hyaline
peridial membrane is covered with white lime crystals and the capillitium consisted of thin hyaline
to light brown-tinged threads. The columella is globose and light yellow, while the sparsely and
minutely warted 8-12 .. diam spores are light brown in color.
Nonheterothallic D. ovoideum isolates These nine isolates (CR 1, CR 2, CR 3, Idn
1, Idn 2, Idn 3, Idn 4, Idn 5, Tenn 2) are generally similar, with globose (varying from slightly
prolate to slightly sub-globose) sporangia with long to intermediate dark red-brown colored stalks
(Idn 5 stalks can also be light red-brown colored) and a generally closed umbilicus White lime
covers the colorless peridia and the capillitial network consists of colorless to pale brown-tinged
threads, with the Idn 3 isolate having slightly thicker threads. The columellae are globose and light
yellow in isolates CR 1, CR 3 and Tenn 1; globose and white in Idn 1, Idn 3, Idn 4, and Idn 5;
discoid and light brown in Idn 2 and plate like (with an open umbilicus) and light yellow in CR 2.
Isolates CR 2, Idn 3 and Idn 4 also have slightly spiny columellar surfaces. The spores of all
isolates are brown, 8-10 4 diam and minutely warted (CR 2, Idn 2 and Idn 4 are somewhat more
distinctly warted). Seven ofthese D. ovoidium isolates have the bright yellow colored plasmodium
characteristic of this species. However, Idn 5 has a light yellow colored plasmodium that correlates
with its lighter colored stalk, and the Tenn | has an orangish-yellow plasmodium. These are the
first plasmodial color variations reported for this species.
DISCUSSION
The non-calcareous long-stalked Didymium species are a taxonomically difficult group and while
cultural studies have helped sort out natural taxa (Betterley and Collins 1983, Clark and Mires
1999), there is still a problem in delimitating the various groups due to overlapping morphological
characters. This culture study has helped resolve some of these problems, but it has also added
new difficulties in terms of even more overlapping morphological variations among the taxa.
The Didymium iridis species complex, as defined by Clark and Mires (1999), contains
the D. iridis, D. bahiense, D. nigripes (in part) and D. verrucosporum morphospecies. This study
supports this concept of a morphologically variable cosmopolitan species complex consisting of
many biological sibling species, generally allopatrically distributed, and numerous apomictic clonal
lines. The five (CR 12, CR 13, CR 14, CR 15, CR 16) Al (Caribbean) sibling species isolates
wouid be identified as being in the D. iridis or D. bahiense morphospecies on the basis of their
morphology. Also, the A2 (Northeastern USA) sibling species isolate (WV 1) and the new A8
(Hawaii) sibling species isolate (Ha 4) would both be keyed out as D. bahiense. The two isolates
(CR 18, CR 19) of the new A9 (Costa Rican B) sibling species, which is sympatric with the Al
(Caribbean) and A4 (Costa Rican A) sibling species, are quite variable in culture and could be
identified as either D. iridis, D. bahiense or D. nigripes depending upon the sporangium examined.
The new A10 (Mexican) sibling species isolate (Mex 4) would most likely key out as a somewhat
aberrant D. nigripes. The first group of nonheterothallic isolates (CR 10, CR 11, Fr 2, Ha 5, Idn
1, PR 2, SC 1, SC 2, SC 3, Thai 5) generally conform to a D. bahiense or D. iridis morphology,
453
dependent upon their columellar characteristics. However, the sporangia produced in culture by
the Fr 2 isolate, which is derived from a collection identified as D. verrucosporum by Meyer (#
16883), are somewhat outside of the D. bahiense variation due to the fact that the spores are more
heavily warted and the columella is often brownish due to a lack of lime. However, this isolate,
which is the first collection identified as D. verrucosporum to be cultured, no longer conforms to
the D. verrucosporum description in that the heads are not nodding, the stalk is light colored, the
capillitium is colorless and more anastomosing, and the columella is not always white. The second
group of nonheterothallic isolates (CR 17, Ecu 2, Ecu 3, Idn 2, Thai 1, Thai 4) would key out as
D. nigripes (Ecu 2, Ecu 3, Idn 2, Thai 1) or D. megalosporum (Cr 17, Thai 1) if an identification
was forced. However, the remaining two nonheterothallic isolates would not fit any species
descriptions although they are closest to D. iridis (Ecu 1) and D. bahiense (Tex 3).
The Didymium megalosporum species complex as defined by Clark and Mires (1999)
is based on the AS biological species, which has a world wide distribution and contains a number
of isolates having some combination of the key characters of the D. megalosporum morphospecies
description. These characters, which are not all present in any single isolate, are the robust lobate
sporangial head, a light brown-tinged globose to discoid columellae, and nearly smooth spores.
The yellowish sporangial heads and rugose columellae of the morphospecies description are not
found in any cultured isolates. In this study, all of the AS isolates (Cur 1, Ha 2, Ha3, Thai 2, Thai
3) lacked the lobate sporangial head form and nearly smooth spores (they were minutely warted
except for the Thai 2 and Thai 3 isolates, which were moderately warted), but they were robust and
had yellowish brown columellae (sometimes lacking in the Ha 2 and Ha 3 isolates). The Ha 2
isolate had a light tan colored plasmodium (the first plasmodial color variant in the AS biological
species) and a concurrent lighter stalk. The second group of nonheterothallic isolates contained
two isolates (CR 17, Thai 1) that were very similar to the A5 isolates, with the Thai | also having
moderately warted spores. These AS isolates (and associated nonheterothallic isolates), which lack
(except for CR 17) alobate sporangial head and have warted spores, morphologically integrate into
the D. iridis species complex, thus making it even more difficult to separate these two complexes
on the basis of morphology.
The Didymium ovoideum species complex (Clark and Mires 1999) has been defined by
its mating system (sympatric and genetically isolated from the rest of the heterothallic isolates of
the non-calcareous long-stalked complex), bright yellow plasmodium and associated red brown
colored stalk, and prolate sporangial head. The columella is also white to yellowish, globose and
sometimes having a spiny surface to which the capillitium is attached. The single heterothallic
isolate (Tenn 2) has the standard morphology of this morphospecies and is compatible with the
West Virginia/Virginia sibling species, with which it shares the characteristic of highly skewed
mating type ratios. The nine nonheterothallic isolates (CR 1, CR 2, CR 3, Idn 1, Idn 2, Idn 3, Idn
4, Idn 5, Tenn 1) in this study generally have the bright yellow plasmodium (Idn 5 has a light
yellow plasmodium and that of Tenn 1 is orangish-yellow), associated red brown stalk and the
generally prolate sporangial head shape of this complex. However, their columellae varied in
shape from globose or discoid to a flattened basal plate and in color from white to yellowish or
brownish tinged. Thus, these nonheterothallic isolates, the first reported for this species, are less
distinctive than the previously reported heterothallic isolates (Clark and Stephenson 1994, Clark
and Mires 1999).
The Tex 3 nonheterothallic isolate, with its lack of a columella and light yellow colored
plasmodium, is fairly unique and does not fit into any of the species complexes. Therefore,
pending further similar collections, it is considered to be a nonheterothallic clonal line that has
accumulated some distinctive characteristics and is thus an unnamed micro-population outlier of
this group.
The nonheterothallic SC1 and SC 2 isolates, which were isolated from inflorescence
moist chambers, both had small rapidly sporulating plasmodia. Apparently, these clonal isolates,
of the Didymium iridis species complex, are adapted to the ephemeral nature of this microhabitat,
which supports the contention that the clonal lines in these complexes are local populations adapted
to local conditions.
454
The results of this study support the idea that the Didymium iridis species complex 1s
a morphologically variable worldwide cosmopolitan taxon consisting of many sexual sibling
species and numerous non-sexual clonal lines. The sibling species are generally geographically
based allopatric populations (Clark and Stephenson 1990), although there are at least three
sympatric sibling species in Costa Rica. The non-sexual clonal lines are present in all areas and
are apparently restricted, in most cases, to small local populations. Also, all of these genetically
isolated sibling species and clonal populations share a rather limited suite of morphological
variations and thus can not be separated on morphological grounds (Clark and Mires 1999). Thus,
a number of morphospecies - Didymium bahiense, D. iridis, D. megalosporum, D. nigripes, D.
verrucosporum , and to a lesser extent D. ovoideum - morphologically integrate into each other.
In fact, D. bahiense, D. iridis and D. verrucosporum sporangia can be found in different sibling
species and clonal lines and are, therefore, forms of the D. iridis complex and are not separate taxa.
Also, a number of rare taxa such as the recently described (Ing 2000) Didymium canariense Ing
are almost certainly clonal biotypes of the D. iridis complex that display a limited morphological
distinctness. The sexual isolates of the Didymium megalosporum species complex, however, are
genetically isolated and sympatric with the D. iridis complex sibling species and also has some
morphological distinctions. Therefore, it is a separate, but closely related species complex.
Sporangia of the D. nigripes morphospecies, when cultured, have been found to be forms (often
displaying poor development) of the D. iridis complex. However, this taxon is very difficult to
grow in culture (a few sporangia produce a red-brown plasmodia that have not yet sporulated) and
there remains the possibility that D. nigripes will (in part) turn out to be a separate taxon similar
to D. magalosporum. Didymium ovoideum, on the other hand, is morphologically as well as
genetically divergent from the D. iridis complex, although the morphological separation is
sometimes rather minor and a close examination is required in order for the differences to be
detected. These overlapping species complexes (each consisting of one or more biological species
and numerous apomictic lines), thus produce an extremely complicated super species complex in
which there is an apparent complete morphological integration.
Acknowledgments: We wish to thank Ms. D. Black, Ms. N. El Hage, Mr. B. Irawan, Ms. M.
Meyer and Dr. M. Schnittler for some of the material from which cultures were isolated. This
work was supported, in part, by the National Science Foundation (grant DEB-9705464 to SLS).
LITERATURE CITED
Betterley, D. and O. R. Collins. 1983. Reproductive systems, morphology, and genetic diversity
in Didymium iridis (Myxomycetes). Mycologia 75: 1044-1063.
Clark, J. 1995. Myxomycete reproductive systems: additional information. Mycologia 87:
779-786.
Clark, J. 1997. Myxomycete reproductive systems: Stemonitis species. Mycologia 89: 241-
243.
Clark, J. 2000. The species problem in the Myxomycetes. Stapfia 73: 39-53.
Clark, J. and J. Landolt. 1993. Didymium iridis reproductive systems: additions and meiotic
drive. Mycologia 85: 764-768.
Clark, J, and A. Mires. 1999. Biosystematics of Didymium: the non-calcareous, long-stalked
species. Mycotaxon 71: 369-382.
Clark, J. and S. L. Stephenson. 1990. Didymium iridis reproductive ystems new additions.
Mycologia 82: 274-276.
Clark, J. and S. L. Stephenson. 1994. Didymium ovoideum culture and mating system.
Mycologia 86: 392-396.
Gilbert, H. and G.W. Martin. 1933. Myxomycetes found on the bark of living trees. Univ.
Iowa Stud. Nat. Hist. 15: 3-8.
Ing, B. 2000. Two new species of Didymium (Myxomycetes) from Spanish territories. Stapfia 73:
93-96.
a a ee
MYCOTAXON
Volume LXXIX, pp. 455-465 July-September 2001
Developmental morphology and ultrastructure of
Pestalotiopsis maculans
M. Murugan and J.Muthumary
Centre for Advanced Studies in Botany,
University of Madras, Guindy campus
Chennai, 600 025, India.
E.Mail: botany @ vsnl.com
Abstract
The development of conidiomata in Pestalotiopsis maculans (Corda) Nag Raj
was studied using light and transmission electron microscopy. Light microscopic studies
showed the presence of pycnidial conidiomata in culture whereas the fungus is known
to produce only acervular conidiomata on host leaves. One of the interesting
observations is the ultrastructure of the conidial wall in the coloured cells as well as the
basal and apical hyaline cells with the appendages. This investigation, which has
included ultrastructural details, has thrown new light on the development of the
conidiomata of P.maculans.
Key words: Coelomycetes, Conidiomata, conidium ontogeny, structure, appendages.
Introduction
In view of the variability and diversity in the form of the Coelomycete conidiomata
it is no easy task to accommodate them satisfactorily in a system of classification based
on conidiomata. One finds acervular, stromatic and pycnidial conidiomata in the species
of Colletotrichum in culture. Similarly, conidiogenous cells are formed directly from the
mycelium in culture though such fungi are known to produce pycnidial conidiomata in
nature (Subramanian and Reddy 1974; Baxter 1981; Baxter et al., 1985). Therefore, as
more and more data to this effect becomes available, the distinction between
Hyphomycetes and Coelomycetes may be abandoned because of the presence of
intermediary stages between Hyphomycetes, acervular, stromatic and cupulate
conidiomata. In the present investigation, it was observed that P. maculans produced
pycnidial conidiomata in culture and acervular conidiomata on its natural host. The
various stages of development of the conidiomata were investigated in culture and they
also resembled that of a typical pycnidial conidioma which are already studied. The
developmental morphology of the conidiomata in P. maculans is described here.
Pestalotiopsis maculans was reported on Custard apple from India (Rao, 1968).
In the present study, the fungus was isolated from fallen leaves of Cinnammomum
wightii.
456
Fig. 1. Mature conidium. Bar = 12.5 ym. 2. Germinating conidia producing germ-tube
from the lowermost Median Cell. Bar = 50um. 3&4. Symphogenous method of
primordial formation. 3 Bar = 25 pm. 4 = 100 pm. 5-8 Sections of the primordia
showing pseudoparenchymatous tissue. Bar = 50 um
457
Materials and methods
Pestalotiopsis maculans (Corda) Nag Raj was isolated from leaf of
Cinnammomum wightii collected in Kodaikanal, Tamil Nadu, India. Cultures of
P. maculans were grown on Oat meal agar (OMA) and Potato dextrose agar (PDA) in
petri dishes at room temperature (28°C). The initial stages of the development of
conidiomatal primordia were studied by slide cultures (Riddell, 1950). For germination
studies, conidia were collected aseptically from the teased out conidiomata in 1%
glucose solution and allowed to germinate in cavity slides. Slides were kept at room
temperature (28°C) and were examined every 5 h for 36 h to study germination.
To study the development of conidiomata, selected conidiomata with agar were
trimmed into 2mm square blocks and fixed in 2% glutaraldehyde in 0.1 M phosphate
buffer (pH 7.2) for 2h at room temperature (27°C) and 1h at 4°C and post fixed for 12h
in 1% Osmium tetroxide. The specimen was washed in series of acetone solutions
followed by 2-3 changes in fresh Spurr (4-Vinylcyclohexane dioxide (VCD) 10 mL,
Resin 736 (Der) 4 mL, 2-Nonen-l- Y1 Succnic Anhydride (NSA) 26 mL, 2-
Dimethylamino ethanal (DMAE) 0.4 mL. (In the ratio of 3:1 (Acetone:Spurr) for 6h,
followed by two changes with absolute Spurr mixture for 24h) each lasting for 8h and
polymerised in fresh Spurr at 70°C for 8 h. The samples infiltrated with the resins were
transferred to a vacuum chamber for 1h for complete removal of any air bubbles. Thin
sections (0.5 fm) were cut from these blocks and stained with 1% aqueous toluidine
blue to study the development of conidiomata and conidiogenesis under _ light
microscopy. Ultrathin sections were collected on copper grids (400 mesh). The eXCess
water in the grids was removed by a filter paper. Photomicrographs were taken by using
Nikon “ Labophot” (model HFX 11) carl zeiss microscope. TEM photographs were
taken in a Philips CM 10 TEM.
Results
Description of the fungus in culture
Conidiomatal pustules, punctate, subglobose, black, 100-120 pm diam.
conidia 5-celled, fusiform to clavate, versicoloured, upper two median cells dark brown
and lower median cell light brown, tapering, 19-25 (24) x 6-8 (7.2) pm. Apical cells
conic to cylindric, hyaline,with two to three appendages, 16-17 um long. Median cells
10-15.5 (14.5) pm long. Basal cells long conic, hyaline, with a basal appendage, 4.2-5
(4.2) um long (Fig. 1).
Germination of conidia
Conidial germination occurred after 12 h in 1 % sucrose solution. The conidia
became swollen, resulting in the breakage of outer wall in the lower most median cell,
and the germ tube emerged. The germtubes arises mainly from the lower most median
cells and rarely from the basal hyaline cells also. Only one germtubes arises from each
cell ( Fig. 2 ).
458
Fig. 9. Section through young primordium showing the formation of central cavity by
dissolution of cells at the centre. Bar = 50 um. 10. Section through young primordium
showing the formation of central cavity. Bar = 50 um. 11. Section of young conidioma
showing the initially formed conidia. Bar = 50 um. 12. Section through young
primordium showing gelatinization of central cells. Bar = SOum. 13-14. Sections
through young primordia showing formation of central cavity.Bar = 50 um Vertical
section of mature pycnidium. Bar = 100 pm 16. Vertical section of conidioma
showing temporary conidiogenous cells.Bar= 50 um
459
Development of conidiomatal initial
The conidiomatal initials were first evident as small knots of fungal hyphae. The
pycnidial primordium is initiated by the interweaving of young hyphal branches to form
a network, which is at first loosely interwoven but later became compact knot-like.
During further development, the primordial initial undergoes repeated divisions which
results in the formation of a spherical mass of pycnidial primordium (Figs. 3 and 4).
This type of pycnidial initial is named as “symphogenous”. Initially the cells
constituting the primordium are spherical to subspherical and are hyaline which stain
deeply when compared to the cells of the surrounding hyphae. Shortly after the
formation of somewhat spherical to subspherical primordium, which is made up of
loosely arranged pseudoparenchymatous cells, the formation of the central cavity was
observed.
The earliest stage of conidiomatal development seen in sectioned material
consists of small pseudoparenchymatous mass of tissue. The primordium is almost
spherical comprising a compact cluster of thick - walled cells (Fig.5). During further
development the primordium continuously increased in size by continued transverse and
longitudinal divisions of the cells. As the primordial development progresses, the
several layers of the primordium are differentiated into morphologically distinct layers.
The outermost two or three layers were pseudoparenchymatous with thick, lightly
pigmented walls, which form the outer wall layer of the conidiomata. Inside this outer
wall three to four compact layers of cells were present (Figs. 6-8).
Formation of sporogenous tissue
The central cells in the primorditum showed signs of schizogenous and
lysigenous activity to form the central cavity (Figs. 6-8). The remnants of the
disorganised cells at the centre of the primordium were visible in many transverse
sections of the pycnidial conidiomata (Figs. 9-12). The remaining portions of the cells
often gelatinize and fill up the cavity with the mucilagenous matrix. (Fig. 12). Further
developmental stages showed the formation of the conidium simultaneously with the
cavity formation. As the conidia mature they are released from the conidiogenous cells
and fill up the cavity (Figs. 13 and 14). The formation of conidiogenous cells inside the
cavity of the conidiomata is another interesting feature studied in the species of
Pestalotiopsis. It was the pioneering work of Punithalingam (1979) who studied in
detail, the process of conidiation in Ascochyta species in culture, which produced both
temporary and permanent conidiogenous cells inside the pycnidium. The earlier workers
who studied the development of pycnidia in culture examined only mature pycnidia but
the processes of conidial formation during the initial stages of pycnidium development
were not given due consideration. It was Punithalingam (1979) who made a thorough
investigation on the various stages of conidiation inside a pycnidial conidioma.
According to him, the cells lining the pycnidial cavity produce conidia initially only to
get sloughed off as soon as their function is over. Once a layer of conidiogenous cells
lining the pycnidial cavity is completely dislodged, a new layer of cells lining the cavity
functions as conidiogenous cells. Thus, the processes of conidiation and dislodgement
are repeated continuously. These are the two main processes by which the pycnidial
cavity gradually increases in size and becomes filled with conidia and sloughed off
conidiogenous cells. This is another way adopted by nature to produce a greater number
of conidia inside a pycnidium where the space is very limited.
460
Fig. 17. Section of the conidioma showing gelatinization of temporary conidiogenous _
cells. Bar = 50 pm. 18. TEM. Section showing young conidia and conidiogenous ~
cells. Bar = 1 pm. 19. TEM. Longitudinal section of a mature conidium. Bar=2 pm ~
20. TEM. Section of a young conidium showing the formation of a transverse septum
(arrow). Bar = 2 ym 21. Section through young conidium showing the annellides. Note
annellations (arrows). Bar = 2 um
a
461
It is very interesting to note that similar processes were observed in the present
investigation on Pestalotiopsis species. In P. maculans the cells lining the pycnidial
cavity commence conidial formation. Although initially indistinguishable from the cells
lining the cavity, the conidiogenous cells differed in remaining thin walled and hyaline
whereas, the wall cells become pigmented and thick - walled (Figs. 15 -17). The
processes of conidiation and dislodgement of conidiogenous cells continued till the
cavity is filled up (Fig. 16) The temporary conidiogenous cells resemble more or less
the pycnidial wall cells in size and shape (Fig.18). Subsequently, these temporary
conidiogenous cells were replaced by the formation of permanent conidiogenous cells
which were easily distinguished by their size and shape from the temporary
conidiogenous cells. The permanent conidiogenous cells are cylindrical and annellidic
with one or two annellations. The later formed conidiogenous cells are typically
cylindrical in shape showing 1-3 annellations . The conidioma becomes flattened in
shape during the later stages of development. The mature conidioma produces
conidiogenous cells which line only the flattened basal region but not the sides and
upper region of the conidioma.
Dehiscence of conidioma to release the conidia
There is no regularly formed ostiole found in this species. After maturity the
upper layers of the conidioma open quite irregularly to release the conidia.
Electron Microscopical Studies
Electron microscopy of conidiogenous cell
The primary conidium arises as a protrusion of the apex of the conidiogenous
cell and develops holoblastically. Cell organelles migrate into the developing conidium
until a delimiting septum is formed more or less near the base of the conidium initial.
As the conidium enlarges, the conidium wall forms an electron-opaque outer layer
which starts from the base of the conidium. The inner transparent layer appears
continuous with the wall of the conidiogenous cell. The conidiogenous cell itself does
not develop an electron-opaque outer wall. Successive conidium develops from a point
just at or below the level at which the preceding conidium was delimited. At least 3-4
annellations were observed in each conidiogenous cell (Fig.19). Sections through the
young conidiomata showed that the conidia arise from spherical to subspherical
conidiogenous cells lining their cavity (Fig.18). Prior to septation, the conidium initial
is enclosed by a thin electron transparent wall. During septation the wall increases in
thickness. Usually the first septum is laid near the tip of the initial. Gradually the
peripheral region of the conidial wall becomes electron dense by the deposition of the
melanin in the wall matrix.
The conidia consist of three thick-walled median cells capped by hyaline end
cells (Fig. 20). In the distilled water mounts of the conidia the wall of the three median
cells appears granular and pale brown. During germination the germtubes arise
exclusively from the lowermost median cells. The hyaline basal cell bears an
unbranched appendage. Appendages (4-5) also arise from the hyaline apical cell.
462
Median coloured cells
Transconidial septa arise as outgrowths of the conidial wall and new wall
material is deposited external to the invaginations. During the growth of membrane
across the conidium, wall material is continuously produced through the cell wall
developed by each membrane. The septal pore formed as a result of cessation of wall
deposition at the junction where the plasma membranes from either side fuse to form the
trans-septal membrane. Simultaneously in the septal formation, wall deposition occurs
over the entire inner surface of the conidium. The peripheral walls and the septa of the
conidia become distinctly electron dense (Fig. 20). The thickness is more in the upper
two median cells when compared to lower median cell. The lower median cell is
structurally different from the other median cells of the conidium in that it showed
pronounced wrinkling of the outer pigmented wall. Probably because of this difference
in the nature of the wall it appears pale brown in colour under the light microscope.
Apical and basal cells
The apical and basal cells are morphologically indistinguishable from the
median cells during the early stages of development of the conidium. At maturity the
end cells showed cytolysis and the cytoplasmic content completely disappears from
these cells. The thicknesses of the electron-dense layer of the apical and basal cells
gradually decrease. |
Basal appendage
The conidia were produced from the annellides and more than 3 annellations
were observed in some conidiogenous cells (Fig.19). Occasionally the basal appendage
of the developing conidium was observed within the annellation which shows that the
basal appendage is endogenously produced.
Apical appendage
Apical appendage originated from the apex of the conidium as a simple
elongation of a small bud produced at an early stage of the development of the
conidium.
Discussion
Species of Pestalotiopsis have not been studied with reference to the
development of conidiomata. The present study reports for the first time the various
stages of development of conidiomata in Pestalotiopsis maculans with interesting
observations. The developmental morphology of the conidiomata in the species has
shown ‘interesting features. The fungus produces conidia only inside mature
conidiomata. As the primordium increases in size, the central cavity is to be formed
because the primordium is a compactly packed psedoparenchymatous tissue. In
P. maculans the central cells in the primordium shows signs of schizogenous and
lysigenous activity to form the central cavity. The remaining portions of the cells often
gelatinize and fill up cavity with the mucilagenous matrix. Probably, the matrix
provides nutrition to the developing conidiogenous cells and conidia. Nag Raj (1981)
suggested that the slime, which originates though lysis occurring during cavity
463
formation, play a important role in conidium dispersal. The presence of mucilagenous
matrix during the formation of the pycnidial conidiomata was reported in certain other
pycnidial Coelomycetes also (Masilamani & Muthumary 1994, 1995 &1996). The
formation of conidiogenous cells inside the cavity of the conidioma is another
interesting feature studied in this species. The pioneering work of Punithalingam (1979)
who studied in detail the process of conidiation in Ascochyta species in culture, revealed
a similar process on this fungus.
The production of temporary and permanent conidiogenous cells in Ascochyta is
construed as a general feature of Ascochyta species in culture (Punithalingam, 1979).
Similarly, the dual conidiation process was also observed in species of Pestalotiopsis in
the present investigation. The dual conidiation process was observed in Phyllosticta
caryota in culture. Punithalingam (1979) reported that some of the observations made
with Ascochyta in culture were in conformity with the interpretations of Archer (1926)
during his investigation on cavity formation and ostiole development in some members
of Sphaeropsidales. This suggests that probably these fungi which produce pycnidial
conidiomata in culture follow some specific regularity in their conidiomatal
development. It is not possible to conclude that these stages of developmental processes
occur during the formation of the pycnidia in nature.
Fine structure of the conidia were demonstrated in four Coelomycete species
(Campell 1968), Sutton and Sandhu,1969; Griffiths and Swart,1974 a,b).Generally,
these studies were intended to extend light microscopic observations. Longitudinal
sections through the conidia of Pestalotiopsis maculans showed massive and pigmented
conidial wall. The conidial wall is characterized by the deposition of electron dense
material in the outer layers of the septa. The transconidial septa arise as outgrowths of
the conidial wall and new wall material is deposited external to the invagination of the
plasmamembrane. The basal and apical cells have partly pigmented and partly
unpigmented wall, which are clearly distinct from the central cell. During germination
the germ tubes arise exclusively from the lowermost median cells. The hyaline basal
cell bears an unbranched appendage. Apical appendages also arise from the hyaline
apical cell. The conidia are produce from annellides and upto three annellations were
observed. The basal appendage of the developing conidium was sometimes observed
within the annellide. The basal cell along with the appendage remained viable long after
the cytolysis of the apical cell.
Sutton (1961) Observed that versicoloured conidia in Pestalotiopsis species
produced germtubes only from the inferior coloured cell. His observations are
confirmed in the present investigation that the germtube is produced only from the
lower most median colored cell. The upper two coloured cells do not possess any germ
pore in their cells, which might have prevented them from germinating. Electron
microscopical studies showed that the lowermost median cell is morphologically as well
as structurally different from the other two cells in that it is slightly larger than the other
cells In thickness also it differs from the other two cells. In some of the sections, this
cell showed more shrinkage when compared with the other two cells. Also during
germination, there is a breakage in both the layers of the wall so that the cytoplasm
emerges out to form the germtube. Therefore, as evidenced by electron microscopic
studies, the lower most median cell is morphologically and structurally different from
the other two cells. As suggested by Sutton (1961) the upper two cells provide
464
mechanical support by being thicker than the lower most cell to facilitate the
emergence of the germtube.
According to Steyaert (1949,1953 a,b, 1954, 1955, 1961) Pestalotiopsis has
4-septate conidia, a view accepted by Sutton (1969a,1980). Nag Raj (1985a,
1986c,1989a ) however, included 3-septate forms as well in the genus. The studies by
Guba (1961), Steyaert (1949) and others on this genus have been based mainly on dried
herbarium material. As suggested by Sutton (1980), when these fungi are grown in
artificial culture media, they showed different characters especially with reference to
fructification and conidium ontogeny. The developmental morphology of conidioma in
Pestalotiopsis resembles that of Ascochyta which is a well-known pycnidial fungus.
This suggests that the distinction between Hyphomycetes and Coelomycetes may have
to be abandoned, as more data becomes available.
Acknowledgements
The authors thank Prof. D. Lalithakumari, Director, Centre for Advanced
Studies in Botany, University of Madras, Chennai for encouragement and to the U.G.C
for financial assistance. The authors are grateful to Professor R. D. Goos for reviewing
the manuscript and for helpful comments.
Literature cited
Campbell, R. 1968. An electron microscope study of spore structure and development in
Alternaria brassicicola. J. Gen. Microbiol. 54: 381-392.
Baxter, A.P.1981.A study of the morphology and taxonomy of certain South African
Species of Colletotrichum Corda. M.Sc. Thesis, University of Pretoria, Pretoria,
South Africa.
Baxter, A.P., G.C.A. Van Der Westhuizen and A. Eicker. 1985. A review of literature
on the taxonomy, morphology and biology of the fungal genus Colletotrichum.
Phytophylactica.17: 15-18.
Griffiths, D.A and H.J. Swart.1974a. Conidial structure in two species of
Pestalotiopsis. Trans. Br. Mycol. Soc. 62(2): 295-304.
Griffiths, D.A and H.J. Swart.1974b. Conidial structure in Pestalatia pezizoides. Trans.
Br. Mycol. Soc. 63(1): 169-173.
Guba, E.F. 1961. Monograph of Monochaetia and Pestalotia. Harvard University
Press, Cambridge, Mass., U.S.A., 342 pp.
Masilamani, S. and J.Muthumary. 1994. Development of Conidiomata in
Ciliochorella mangiferae (Coelomycetes). Mycol. Res. 98(8): 857-861.
Masilamani, S. and J.Muthumary. 1995. Pycnidium ontogeny in Coleophoma
cylindrospora. Mycol. Res. 99(6): 693-696.
Masilamani, S. and J.Muthumary. 1996. Development of conidiomata in
Botryodiplodia theobromae. Mycol. Res. 100 (11): 1383-1387.
Nag Raj,T.R. 1981. Coelomycete Systematics. In Biology of conidial Fungi I(ed. G.T.
Cole and B.Kendrick). pp.43-79. Academic Press. New York.
Nag Raj, T.R. 1985a. Redisposals and redescriptions in the Monochaetia-Seiridium,
Pestalotia-Pestalotiopsis complexes. I. The correct name for the type species of
Pestalotiopsis. Mycotaxon 22: 43-51.
465
Nag Raj, T.R.!986c. Redisposals and redescriptions in the Monochaetia-Seiridium,
Pestalotia-Pestalotiopsis complexes. VII. Pestalotia citrina, P.maura and
Pestalotiopsis uvicola. Mycotaxon 26:211-222.
Nag Raj,T.R. 1989a. Redisposals and redescriptions in the Monochaetia- Seiridium,
Pestalotia- Pestalotiopsis complexes. [X. On the status of Pestalotia eupyrena,
P.gastrolobi and Pestalotia veneta. Mycotaxon 35: 287-296.
Nag Raj.T.R (1993)Coelomycetous anamorphs with appendage—bearing conidia.
Mycologue publications 331 Daleview PI. Wateloo, Ontario, Canada N2L 5M5
Punithalingam, E.1979. Graminicolous Ascochyta species. Commonwealth Mycological
Institute. Mycol. Pap. No.142.
Rao, V.G. 1968. A new storage disease of custard apple from India. Phytopath. 61:
52-56.
Riddell, R.B. 1950. Permanent stained mycological preparations obtained by slide
cultures. Mycologia. 42: 265-270.
Steyaert, R.L. 1949. Contribution a 1|’etude monographique de Pestalotia de Not. et
Monochaetia Sacc. (Truncatella gen. nov. et Pestalotiopsis gen. nov.). Bull.
Jard. Bot. Brux.19:285-354.
Steyaert, R.L. 1953a. New and old species of Pestalotiopsis. Trans. Br..Mycol.Soc.36:
81-89
Steyaert, R.L. 1953b. Pestalotiopsis from Gold Coast and Togoland. Trans.
Br.mycol.Soc.36: 235-242.
Steyaert, R.L. 1954. Concerning some South African Pestalotiopsis Steyaert. Bothalia
6: 379- 383.
Steyaert, R.L. 1955. Pestalotia, Pestalotiopsis et Truncatella. Bull. Jard. Bot. Brux. 25:
191-199
Steyaert, R.L. 1961. Type specimens of Spegazzini’s collections in the Pestalotiopsis
and related genera (Fungi Imperfectii: Melanconiales). Darwiniana, B. Aires 12:
157-175.
Subramanian, C.V. and K.R.C.Reddy.1974.The genus Discosia 1.Taxonomy. Kavaka
_ 2:57-89
Sutton, B.C. 1961. Coelomycetes I. Mycol. Pap. No. 80: 1-16.
Sutton, B.C.1969a. Forest microfungi.III]. The heterogeneity of Pestalotia de Not.
section sexloculatae Klebahn sensu Guba. Can. J .Bot. 47 (12):2083-2094.
Sutton, B.C. 1980. The Coelomycetes Fungi imperfecti with pycnidia, acervuli and
stromata. Commonwealth Mycological Institute, England. 696pp.
Sutton, B.C. and D.K. Sandhu. 1969. Electron Microscopy of conidium development
and secession in Cryptosporiopsis sp., Phoma fumosa, Melanconium
bicolour and M. apiocarpum. Can. J. Bot. 47: 745-749.
Swart, H.J. and D.A. Griffiths.1974a. Australian leaf inhabiting fungi. IV.Two
Coelomycetes on Acacia pycnantha.Trans.Br. Mycol.Soc. 62 (1):151- 161.
ea a , Po
ie uy nae es
. ai
Me apa
ae OND i
‘a nen Ay, a
ibs ne Hh) btn CP atele A et ah on ead ri ah ie
} ‘leg at hi » “i h (ae ESTATE gee > ; aye, Si eee rf we
elt ey
a
iy apa " phe)
' oa te aah Bi
baat iitey it aoe ia ‘al
Da teaen my
ape en i ah
i 8 a bi + Np I ri Ms ain 7 a
a
v i
Va i“
Ki ear 7”
i) a As IDE Br ey
Nia th tady
audi Rh 7.
Y sohth die tinh Le Oe a) WX }
aig, Mis ae
a PLE , ice’ sant 4
Ae yl iat ai ee hb A!
r '
u, i)
0
Roe hen ey ral
, a hy A sh Ae
ut a
ba Art
‘ A ci, aes
wat Mite datas iat ve
okey FOL yj “
Wh, . on hier Wi
PE ANI R pra MU, NR bay iy NES A TOP ing ; 9 : ine te
Sadat Ge ‘- vm v rs wlan , “ ASA y, ‘ "i a Nit Wee ae eS ty
7 ‘ 7 en uy , alt we, . 2 ; ‘iy Mie ' oh Bh a j Taint ; oe 5
ai { 7, i‘ ia) Mats i Ba 7 a, ine oo v
anne , My eee bade ee mG ee ts
ats é, ah ‘ae " fy Wie vy i Vi ; a Ré ie
PAG 3 K
tule she ec | a ag 1 ese ae
MYCOTAXON
Volume LXXIX, pp. 467-479 July-September 2001
MORPHOLOGICAL CLADISTIC ANALYSIS OF TROPICAL
HYMENOCHAETALES (BASIDOMYCOTA)
ARISTOTELES GOES-NETO’', CLARICE LOGUERCIO-LEITE?, ROSA
TRINIDAD GUERRERO®
1. Laboratério de Pesquisa em Microbiologia, LAPEM, Departamento de Ciéncias Bioldgicas,
UEFS, km 03, BR-116 (norte), Feira de Santana, BA, Brasil. C.E.P.:44.031-460
e-mail: goesneto@svn.com.br (corresponding author)
2. Laboratério de Micologia/BOT/CCB/UFSC Trindade, C.E.P.: 88040 900, Florianépolis, SC,
Brasil. e-mail: clleite@ccb.ufsc.br
3. Dep. Botanica, Instituto de Biociéncias, UFRGS, Porto Alegre, RS, Brasil
ABSTRACT
A cladistic analysis of some tropical Hymenochaetales, based in
basidiome morphology, was carried out. The ingroup encompasses 11 tropical
hymenochaetalean species, including those of the most diverse genus
(Phellinus) and also of three other genera: Aunficaria, Hymenochaete and
Phylloporia. Three outgroups were selected: Trichaptum byssogenum, Datronia
caperata and Auricularia polytricha. Cladistic analysis using parsimony was
performed with NONA 2.0, implemented by WINCLADA 0.9.99. Cladograms
were produced using heuristics search with random taxon addition sequences,
tree-bisection-+reconnection branch swapping. A total of 17 characters were
used in the cladistic analysis and treated as non-additive. One most
parsimonious cladogram was produced with 30 steps in length, Cl! = 0.70 and RI
_ = 0.78. Ten putative monophyletic groups were identified. Ingroup monophyly
and polyphyletism of the genus Phellinus were supported. Basidiospore wall
thickness and basidiospore color exhibited high phylogenetic signal.
KEY WORDS: Basidiome morphology, phylogeny, Hymenochaetaceae
INTRODUCTION
The order Hymenochaetales Oberwinkler (Fungi-Basidiomycota-
Homobasidomycetes), according to Pegler & Young (1993), is characterized by
the presence of setoid structures, euhymenial development, permanent positive
xanthochroic reaction and generative hyphae without clamp-connections,
comprising two families: Asterostromataceae (Donk) Pouzar and
Hymenochaetaceae Donk.
The family Hymenochaetaceae is constituted of 12 genera exhibiting
distinct hymenophore configurations: Aunficaria, Clavariachaete, Coltricia,
Coltriciella, Cyclomyces, Hydnochaete, Hymenochaete, Inonotus, Phellinus,
Phylloporia, Pyrrhoderma and Stiptochaete. Only two genera are assigned to
Asterostromataceae: Asterostroma and Asterodon. Except for Coltricia
468
perennis, which is facultatively ectomycorrhizal, all species are white-rot wood-
decay fungi, saprobes or facultative parasites of trees and most of taxa are of
tropical distribution (Hawksworth et al., 1995; Ryvarden 1991, 1993).
Many authors (Parmasto, 1970; Oberwinkler, 1977; Hallenberg, 1985),
however, considered Asterostroma as a member of Lachnocladiaceae (Reid,
1965) but assigned Asterodon to Hymenochaetaceae. Thus the taxonomic
position of Asterostroma is debatable.
Although Asterostromataceae (sensu Pegler and Young) exhibit at least
one distinctive morphological feature (presence of asterosetae),
Hymenochaetaceae is generally negatively defined as comprising all
Hymenochaetales without asterosetae. Furthermore the circumscription of
hymenochaetacean genera is rather imprecise even in the realms of traditional
systematics (Corner, 1991). The same situation occurs at the generic level,
notably in Phellinus, which accounts for more than half of total number of
species of Hymenochaetales. That genus inciudes several species complexes
and it is generally regarded as polyphyletic (Ryvarden, 1991; Fischer, 1996).
Thus the great taxonomic challenge is to delimit potentially monophyletic groups
inside Phellinus and in Hymenochaetaceae as a whole.
Phylogenetic studies concerning Hymenochaetales include those of
Fiasson & Niemela (1984) and Bondarceva et al. (1992). The former work
comprised a phenetic and cladistic analysis of European poroid taxa based in
morphology, biochemical and protein-based molecular methods. In order to
determine the polarity of characters, Fiasson & Niemela (1984) used a likely
ingroup terminal (Hymenochaete) as outgroup and, for some characters, the
incorrect criteria of commonness in outgroup analysis (Forey et al., 1992).
Bondarceva et al. (1992) carried out a strictly phenetic analysis based in
morphological and chemical characters of Cuban polyporoid Hymenochaetales.
This work intends to carry out a cladistic analysis of some tropical
hymenochaetalean fungi based mainly in basidiome morphology and some
ecological characters as well as to test ingroup monophyly and to evaluate
postulated evolutionary hypotheses of ingroup relationships (Fiasson &
Niemela, 1984: Corner, 1991; Ryvarden, 1991).
MATERIALS AND METHODS
Terminal taxa and choice of outgroup
Both outgroup and ingroup taxa were collected during field trips in the
State of Bahia, Brazil, and studied specimens were deposited in HUEFS
herbarium. Macroscopic features were analyzed in a stereomicroscope and
freehand sections were made for the study of microscopic characteristics. Slide
preparations were stained with 1% phloxine, 5% KOH, and Melzer’s reagent
was used to test iodine reaction as in Common (1991).
The ingroup encompasses 11 tropical hymenochaetacean species. Eight
taxa are species of Phellinus; the other three taxa are species of three other
genera: Aurificaria, Hymenochaete and Phylloporia
Three outgroups were selected: (a) Trichaptum byssogenum, since the
genus Trichaptum is likely to be the sister group of Hymenochaetales according
to molecular studies of 18S r-DNA gene (Ko, Hong & Jung, 1997) and
469
morphological hypothesis (Corner, 1987); (b) Datronia caperata was selected
as a possible functional outgroup for 7. byssogenum because it corresponds to
a level of higher generality, representing the Homobasidiomycetes as a whole:
and (c) Auricularia polytricha, which is a Heterobasidiomycete, as a functional
outgroup of the other two taxa, comprising the highest level of generality, for
Auriculariales is presumed to be the sister group of Homobasidiomycetes
(Lipscomb et al., 1998). Thus outgroups were selected in order to represent
different levels of hierarchically nested groups. All the terminals used in this
study and their geographical distribution patterns are listed in Table I.
Table |: Terminal taxa studied.
Taxon Voucher Geographical
specimen distribution
HUEFS pattern
Auricularia polytricha (Mont.) Sacc. Pantropical
| 41497), (41500
Datronia caperata (Berk.) Ryv. Pantropical
Trichaptum byssogenum (Jungh.) Ryv. Pantropical
Aunificaria luteo-umbrina (Rom.) Reid (41401), Pantropical
41417), (41459
Hymenochaete sallei Berk. & Curt. Pantropical
Phellinus apihaynus (Speg.) Rajch. & Neotropical
Wright
Phellinus extensus (Lév.) Pat. (41425), Neotropical
(41426),
41427), (41469
Phellinus gilvus (Schw.) Pat. (41428), Pantropical
41429), (41465
Phellinus grenadensis (Murr.) Ryv. Neotropical
Phellinus melleoporus (Murr.) Ryv. Neotropical
Phellinus membranaceus Wright & (41452), (41499) | Neotropical
Blumenf.
Phellinus palmicola (Berk. & Curt.) Ryv. Neotropical
Phellinus rimosus (Berk.) Pil. (41419), Pantropical
(41420),
41421), (41468
Phylloporia pectinata (KI.) Ryv. Pantropical
Phylogenetic Analysis
Cladistic analysis using parsimony was performed with NONA
Version 2.0 (Golloboff, 1993), implemented by WINCLADA Version 0.9.99
(Nixon, 1999). Cladograms were produced using heuristics search with random
taxon addition sequences, tree-bisection-reconnection branch swapping.
WINCLADA was also used to examine character distribution.
470
RESULTS
A total of 17 characters were used in the cladistic analysis (Table
li). Thirteen characters were binary and four were multistate. All characters are
treated as non-additive since there is no discernable basis for coding any
transformation series a priori (Hauser & Presch, 1991). Five characters are
parsimony uninformative, for they constitute autapomorphies. The character
states distributions for taxa included in the analysis are shown in Table Ill.
Consistency (Cl) and retention (Rl) indexes for each character are listed in
Table IV.
Phylogenetic analysis conducted in NONA resulted in 1 most
parsimonious cladogram of 30 steps in length with Cl = 0.70, RI = 0.78 and RC
= 0.55 (fig.1). Ten clades were identified (designated as groups 1-10).
Table Il: Character and Character states used in the analysis
Character Character State
Number
0 0) Pileate (1) Resupinate
1 0) Seasonal (1) Perennial
me Hymenial configuration (0) Smooth (1) Poroid
type
2) Yellowish to reddish brown
4 Hyphal system (0) Monomitic (1) Eudimitic
Uren aie eater 2) Intermediate Dimitic
5 0) Absent (1) Present
6 0) Absent (1) Present
7 Beret eaaeorale Oe Cylindric (1) Ellipsoid
2) Globose
8 freee oe is) ane) Thin (1) Thickened
thickness
9 0) Hyaline (1) Colored
10 0) Saprobe (1) Parasite
11 0) Unchanged (1) Olivaceous
AZ 0) Present (1) Absent
13 0) Negative (1) Positive
14 eet prec TOT enet yeaa O) Absent (1) Present
cystidia (metuloids
15 Basidium shape (0) Cylindric (1) Clavate
2) Subglobose
IKI reaction of spores (0) Negative (1) Positive (dextrinoid
=x
O?)
471
Table Ill: Character state matrix (outgroups marked with an asterisk)
Characters
Taxa 0} 41/2/3/4/5/6/7 [8] 9 |10)11|12| 13/14/15] 16
Ae, Se BRR RRP RR ER GSE REE
oolytricha*
fe a
byssogenum*
Datronia caperata* ee eye eee LOL :
Hymenochaete sallei |1|0|0|2|0[1/0/0]0|0/ 0.
ole a
umbrina
2
Phylloporia pectinata|0|1}1/2/2}/0;/0/1/1/1/0/0}1/1{/0]2]/0
Phellinus rimosus |0/1/1/2/1/0}0/2/1/1/1/011/1/0]2]/0
Phellinus gilvus Oo; OA 2) tat 1 Opo}o} ol 17 ol4] 0
Phelinus palmicola_ |1|0|1|2/1|1/0/0/0/0|0/0/1|1/o/0/0
Phellinus apiahynus |0{1|1}/2{[1/0/0/2]1/o}o/0/1]/1/0] 1] 1
Phellinus extensus |0}1/1/2/1/1/012]/1/1/0]0/1/1]/0]2]/0
Bae ee reer
grenadensis
‘ fs [te ee Wal aoc ee
membranaceus
Eiodeo Doe ee ee ee j
melleoporus
Table IV: Cl and RI of each character in most parsimonious cladogram
uninformative characters are in italic
rs — ae
Number of steps
Mie 3 Basidiome type aw 200M
| __Basidiome longevity =| 3 |
np Context colors dala 20a |
Hyphal system
he ee Hymenial Sctacsmmans Melia,
ieee Grystakhyphae iimin | eneat Gil
| __Basidiosporeshape || 4
| _Basidiospore wallthickness | 1 __—
i eiBasidiospore color sia] at WN
RUT ACh
ethedtet Gah
Hore
0. oo 0.66
O}O|}O
lala}
O1W)O
©
€ | CO] Ni} Oy} 09} | Go; Nh] =| ©
2)
>lan}—
i)
(eo)
ba |
—s
10
11
12
13
14 Incrusted hymenial cystidia
metuloids
15
16 IKI reaction of spores
2
o
2
1
4
1
1
1
1
1
1
472
Aurpol
14
Tribys
Datcap
Gir
oa Phegil
1 8
ee, 3 i O Hymsal
©
og
O Phepal
Si2 eels
16
Zara hh) 2 Pheapi
Phegre
1 Zao U
© 1
ase sla Bhcad é : Phemem
©)
1
‘ Phemel
' 6 10
Pherim
5
15 Pheext
longs A
1 11
; O Aurlut
. ; , Zach C47
Fig.1: The most parsimonious cladogram O Phypec
(synapomorphies/autapomorphies = full circles)
(homoplasies = empty circles)
(upper numbers = characters)
(lower numbers = character states)
(big numbers = clades)
473
DISCUSSION
Clades
Clade 1 includes the ingroup and one of the outgroups. It is
supported by one synapomorphy, 15(1), suggesting that, at least in the light of
morphological characters, Datronia caparata is more closely related to
Hymenochaetaceae than Trichaptum byssogenum. Studying the molecular
phylogenetic relationships of Trichaptum, Ko, Hong & Jung (1997) showed that
Trichaptum species were closer to Inonotus (Hymenochaetaceae) than to the
31 different species of Aphyllophorales. Unfortunately none of the studied
species was of the genus Dafronia and there was no /nonotus species in our
own analysis. 7ichaptum and Hymenochaetaceae species (with the exception
of Coltricia perennis) present imperforate parenthosomes, a rare condition in
Holobasidiomycetes (Moore, 1985). At this time there is no data in literature
about septal ultrastructure in Datronia caperata but, if the clade 1 is, in fact,
natural, this taxon may possess imperforate parenthosomes.
Clade 2 includes all the ingroup and is supported by three
synapomorphies: 3(2), 12(1), and 13(1). It is one of two most supported clades
in terms of synapomorphies and represents all terminal taxa only pertaining to
Hymenochaetales. All studied hymenochaetalean taxa exhibit permanent
xanthocroic reaction, clampless hyphae and yellowish to reddish brown context.
Thus it is assumed that the ingroup is monophyletic, as it has been long
advocated (Donk, 1948, Oberwinkler, 1977).
Clade 3 is supported by one convergence 5(1) and comprises a
group formed by the taxa Phellinus gilvus, Phellinus palmicola and
Hymenochaete sallei. This clade suggests the polyphyletism of Phellinus
(Fiasson & Niemela 1984; Ryvarden, 1991; Hibbett & Donoughe 1995; Fisher,
1996). Nevertheless it is not in accordance with the proposed suborder
Hymenochaetinae Fiasson & Niemela (Fiasson & Niemela, 1984) or
Hymenochaetaceae sensu Boidin (Boidin, Mugnier & Canales 1998) since it
grouped Hymenochaete and Phellinus species together. All three taxa in this
clade possess hymenial setae, and hyaline, thin-walled spores. These
characters are also found in Hymenochaete, Stiptochaete and Hydnochaete
(Job, 1990, Ryvarden, 1982, 1985), which suggests that they are closer related
to each other than to other Hymenochaetaceae. According to Fisher (1996),
Phellinus torulosus, a temperate species closely related to Phellinus gilvus, is
more closely linked to Phellinus ferreus group (Fuscoporia Murr.).
Clade 4 is supported by one reversal 15(0), and includes Phellinus
palmicola and Hymenochaete sallei. These two taxa are unique among the
ingroup taxa in their possession of long subulate hymenial setae. Phellinus
palmicola falls into the definition of Fuscoporia Murr. emend. Fiasson et
Niemela (Bondacerva et al., 1992), which comprises Phellinus species with
extremely thin-walled, acyanophilous spores, mostly cylindric in shape, features
that also occur in Hymenochaete and Hydnochaete species (Job, 1990;
Ryvarden, 1982). This suggests a close relationship between Fuscoporia,
Hymenochaete and Hydnochaete. All studied Fuscoporia species are
binucleate, homothallic and putative haploid (Fisher, 1996). Therefore these
character states are also expected to occur in representatives of this clade.
474
Clade 5 is supported by three synapomorphies 1(1), 7(2) and 8(1).
It includes all the ingroup taxa with the exclusion of Phellinus gilvus, Phellinus
palmicola and Hymenochaete sallei. All the taxa in this group exhibit spores
with thickened walls, which is in sharp contrast with the aforementioned
Hymenochaetaceae bearing thin-walled spores. The subglobose, dextrinoid
spores, and the presence of ampullaceous cystidioles in the hymenium indicate
that Phellinus apiahynus probably belongs to Phellinus robustus group
(Fomitiporia Murr.), as defined by Fiasson & Niemela (1984). Thus, with regard
to karyology, sexuality and DNA content of nuclei, it is expected that this taxon
is oligonucleate, homothallic and putative diploid (Fischer, 1996).
Clade 6 is supported by one synapomorphy 9(1) and comprises all
the species of clade 5 but Phellinus apiahynus. All the hymenochaetacean taxa
with colored and thick-walled spores grouped in this clade, which also includes,
besides Phellinus, species of the genera Aurificaria and Phyllopona, reinforcing
the supposed polyphyletism of the genus Phellinus.
Clade 7 is supported by one reversal 7(1) and encompasses three
eudimitic Neotropical Phellinus with colored, thick-walled, ellipsoid spores and
without hymenial setae.
Clade 8 is supported by one convergence 0(1) and consists of
resupinate species of the clade 7.
Clade 9 is supported by one synapomorphy 15 (2) and comprises
pantropical Pheilinus, Aurificaria and Phylloporia species with subglobose
basidia. Except for Phellinus extensus, which has hymenial setae, all
representatives of clade 7 can be considered as part of the so called Phellinus
rimosus complex (Kotlaba & Pouzar, 1978), corresponding to Fulvifomes Murr.
This complex comprises species with colored, thick-walled spores and without
setae such as Aurificaria and Phylloporia terminals included in our study,
Clade 10 is supported by one synapomorphy 4(2). It groups
together ail the intermediate dimitic species of the ingroup. The term
"intermediate dimitic’ was proposed by Pegler (1995) in order to group ail the
types of hyphal system that are clearly distinct from the typical Basidiomycota
monomitic system but do not fit well in the definition of the eudimitic hyphal
system. Intermediate dimitic system corresponds to “type d1" and "type d2" of
Cormer's classification (Corner, 1991).
Parsimony informative Characters
Basidiome Type
The basidiomes of Hymenochaetales, in special, and
Basidiomycota, as a whole, generally fall into three broad categories: (a)
resupinate, (b) pileate, and (c) stipitate. There are, of course, transitions
between these categories and it is quite impossible to make sharp distinctions
among all of them (Ryvarden, 1991). Furthermore depending on the position of
the basidiome on the substrate (on horizontal or vertical surfaces), one species
could, for example, develop basidiomes of distinct types even along the same
trunk. Both stipitate and pileate or pileate and resupinate basidiomes could
occur in the same species, and it is frequently recommended to check the
basidiomes of each species under different conditions (Corner, 1991). This
ee
475
character was moderately homoplastic with a Cl of 0.50. The interpretation of
the cladogram suggests that resupinate basidiome is an apomorphic condition
in Hymenochaetales and it may have arisen at least twice since it occurs in two
different lineages. This hypothesis is in accordance with Corner’s (1991) and
Fiasson & Niemela's (1984) ideas.
Basidiome longevity
It is not always practical to distinguish between seasonal (annual)
and perennial basidiomes, especially if the studied basidiome corresponds to
the first season's growth of a perennial species (Corner, 1991). Basidiome
longevity was the most homoplastic character (Cl=0.33). According to our
analysis, perenniality is the apomorphic condition in the ingroup. Corner (1991)
and Fiasson & Niemela (1984) also shared this hypothesis. Reversals to
seasonality occurred at least twice during the evolution of Hymenochaetales
Hymenial configuration type
As well as basidiome shape, hymenial configuration forms the basis
of the final version of the Friesian system. Owing to limited taxon sampling, little
(if anything) could be said about the evolution of this character since we did not
include Hymenochaetales with hydnoid (Hydnochaete) and concentric lamellate
(Cyclomyces) hymenophores in our analysis. A reversal to the smooth condition
(present in the Heterobasidiomycete outgroup representative) occurs in only.
one lineage among studied taxa.
Context color
One of the most distinctive features of Hymenochaetaceae is the
color of the basidiome (upper surface, context, trama and hymenial surface).
The context is distinctly yellowish (to reddish) brown. This color is due to the
presence of hyphae with yellowish brown walls (Pinto-Lopes, 1952; Snell &
Dick, 1957;). All Known species of Hymenochaetales exhibit a yellowish (to
reddish) brown context. This character appears as one of the synapomorphies
of the ingroup.
Hyphal system
The circumscription of the three basic categories of hyphal system
(monomitic and dimitic, no typical trimitic hyphal system occurs in
Hymenochaetales) followed Corner (1991). A strictly monomitic system, with no
difference in the direction, form and branching of the hyphae was only found in
the Heterobasidiomycete outgroup representative (Auricularia polytricha) and in
the ingroup representative, Hymenochaete sallei, indicating a reversal to that
condition.
There is considerable variation among dimitic systems in
Hymenochaetales (Corner, 1991). We were able to distinguish two broad
categories from the studied terminals: (a) a system comprising typical
generative hyphae and sparingly branched, septate, slightly thick to thick-walled
476
skeletal hyphae, which corresponds to types d1 and d2 in Corner’s classification
(1991), and to the intermediate dimitic type in Pegler’s review (1995); (b) a
system comprising the typical unbranched skeletal hyphae corresponding to
type d3 of Corner (1991), which is called "eudimitic" in this work. According to
our analysis, the intermediate dimitic system is the apomorphic condition in
Hymenochaetales.
Hymenial setae
Based in the presence of hymenial setae, Patouilliard (1900)
erected his Série des Ignaires, which comprised genera with varied basidiome
shapes and hymenial configurations, united by the presence of setae. This
group represented the core of the family of Hymenochaetaceae (Donk, 1948).
The presence of hymenial setae is a synapomorphy of Hymenochaetales. The
absence of hymenial setae in hymenochaetalean taxa is clearly a reversal, for
the exclusive common ancestral of the group must possess hymenial setae.
Basidiospore shape
As well as in the other characters, there are transitions between the
three broad categories of basidiospore shape and the following circumscriptions
were adopted: (a) globose = globose to subglobose spores, (b) ellipsoid =
oblong to broadly ellipsoid, (c) cylindric = subcylindric to cylindric (Ryvarden,
1991). Ellipsoid and globose basidiospores are the apomorphic conditions in
Hymenochaetales. Although only one step is enough to explain the origin of
globose basidiospores, the ellipsoidal shape of basidiospores might have arisen
at least three times in the group.
Basidiospore wall thickness
Basidiospores with thickened walls, which is the apomorphic
condition, might have appeared only once in the evolution of Hymenochaetales.
This hypothesis is in accordance with Fiasson & Niemela (1984) but not with
Corner (1991), who believed this condition was plesiomorphic.
Basidiospore color
As well as basidiospore wall thickness, no homoplastic event is
necessary to be evoked to explain the evolution of basidiospore color. Colored
basidiospore is the apomorphic condition in Hymenochaetales. Again, our
hypothesis is shared by Fiasson & Niemela (1984) and it is the fe aU of what
Corner (1991) supported.
Clamp-connections
All Known hymenochaetalean taxa are clampless (Kiihner, 1950,
Oberwinkler, 1977, Corner, 1991, Ryvarden, 1991). Although there has been
demonstrated several times that many aphyllophoroid species, which bear
clampless generative hyphae in their basidiomes, were capable of producing
477
clamped hyphae in culture (Stalpers, 1978), there is only one (and probably
doubtful) report of clamped hyphae in cultures of two _ species of
Hymenochaetales (Nobles, 1965). The absence of clamp-connection is thus a
synapomorphy of the group.
Permanent KOH reaction
As well as in the case of the absence of clamp-connections, all
known Hymenochaetales show a positive and, most important, permanent
xanthocroic reaction, that is, when the basidiome permanently and noticeably
darkens in an alkaline solution, usually KOH (Pegler, 1973). The permanent
xanthocroic reaction is due to the presence of a typical group of secondary
metabolites, styrylpyrones, which are found, among Basidiomycota, in
Hymenochaetales (Fiasson, 1982). Basidiomes of one of the outgroup taxa,
Datronia caperata, also darken in the presence of KOH as many other
basidiomes of aphyllophoroid taxa do (Parmasto & Parmasto, 1979) but the
darkening reaction is not permanent. The permanent KOH reaction is one of the
synapomorphies of Hymenochaetales.
Basidium shape
Subglobose basidium is the apomorphic’ condition in
Hymenochaetales. The cylindric basidia found in terminals of the clade 4
(Hymenochaete sallei and Phellinus palmicola) could be regarded as a reversal.
because the exclusive common ancestor of Hymenochaetales probably
possessed clavate basidia according to our analysis.
CONCLUSIONS
The monophyly of the ingroup (Hymenochaetales) and the
polyphyletism of Phellinus are supported in our morphological cladistic analysis.
The non-poroid Hymenochaetales representative grouped together with poroid
representatives, indicating that a reevaluation of proposed classification
schemes in this order, which group non-poroid species separately (Fiasson &
Niemela, 1984; Boidin, Mugnier & Canales, 1998), is needed.
Our results also suggest that the evolution of Hymenochaetales has
been marked by homoplasy events, not only in macromorphological characters,
as expected, but also in micromorphological ones. On the other hand some
micromorphological characters, such as basidiospore wall thickness and
basidiospore color, exhibited high phylogenetic signal, clearly indicating some of
the ingroup relationships.
These features, combined with a more complete sampling of the
Hymenochaetales including all major lineages such as hydnoid, cyclomycoid
and asterosetal representatives, may provide better clues to understand
pathways of morphological evolution in this group of Homobasidiomycetes.
478
ACKNOWLEDGEMENTS
We thank Prof. Luciano Paganucci de Queiroz (UEFS) for technical
assistance in phylogenetic software and, especially, Dr. James Ginns, for his critical
review. This research was supported by CADCT (Research Council for the
Development of Science and Technology of the State of Bahia, Brazil) as well as by a
PICDT UEFS/CAPES grant for the first author. This paper is part of a thesis submitted
by the first author in partial fulfillment of the Ph.D. degree in Botany at Federal
University of Rio Grande do Sul (UFRGS), Brazil.
LITERATURE CITED
Boidin, J., Mugnier, J. & Canales, R. 1998. Taxonomie moleculaire des
Aphyliophorales. Mycotaxon 64:445-4971,
Bondarceva, M.A., Herrera, S., Sandoval, D. E Cejas, F. 1992. Taxonomical problems
of Cuban Hymenochaetaceous fungi. Mikol. Fitopatol. 26(1): 3-14 (in Russian).
Common, R. S. 1991. The distribution and taxonomic significance of Lichenan and
Isolichenan in the Parmeliaceae (Lichenized Ascomycotina) as determined by iodine
reactions. |. Introduction and methods. Il. The Genus Alectonia and associated taxa.
Mycotaxon, 51: 67-112.
Corner, E. J. H. 1987. Ad Polyporaceas IV. Beih. Nova Hedw. 86: 1-286.
Comer, E.J.H. 1991. Ad Polyporaceas VII, The Xanthocroic Polypores. Beih. Nova
Hedw. 101: 1-177.
Donk, M. 1948. Notes on Malesian fungi 1. Bull. Bot. Gard. Buitenzorg Ill, 17: 473-
482.
Fiasson, J-L. 1982. Distribution of styrylpyrones in the basidiocarp of various
Hymenochaetaceae. Biochem. Syst. Ecol. 10(4): 289-296
Fiasson, J-L & Niemela, T. 1984. The Hymenochaetales: A revision of the European
poroid taxa. Karstenia, 24: 14-28.
Fischer, M. 1996. On the species complexes within Phellinus: Fomitiporia Revisited.
Mycol. Res. 100(12): 1459-1467.
Forey, P. L., Humphries, C. J., Kitching, |. L., Scotland, R. W., Siebert, D. J. E Williams,
D. M. (Eds.). 1992. Cladistics, A Practical Course On Systematics. The
Systematics Assoociation Publication n.10, Oxford: Claredon Press. 191p.
Gollobof, P. 1993. NONA Version 2.0.
Hauser, D. L. & Presch, W. 1991. The effect of ordered characters on phylogenetic
reconstruction. Cladistics 7: 243-266.
Hallenberg, N. 1985. The Lachnocladiaceae and Coniophoraceae of North Europe
Oslo: Fungiflora. 96p.
Hawksworth, D. L., Kirk, B. C., Sutton, B. C., & Pegler, D. N. 1995. Ainsworth &
Bisby’s Dictionary of the Fungi. 8" ed. Wallingford: CAB International. 616p.
Hibbett, D. S. & Donoughe, M. J. 1995. Progress toward a phylogenetic classification of
the Polyporaceae through parsimony analysis of mitochondrial ribosomal DNA
sequences. Can. J. Bot. 73 (Suppl. 1): $853-S861
Job, D. J. 1990. Le genre Hymenochaete dans les zones tempérées de I'hémisphére
sud. Mycol. Helv. 4:1-51.
Ko, K.S., Hong, S.G. E Jung, H. S. 1997. Phylogenetic analysis of Trichaptum based
on nuclear 18S, 5.8S and ITS ribosomal DNA sequences. Mycologia, 89(5): 727-
734.
Kotlaba, F. & Pouzar, Z. 1978. Notes on Phellinus rimosus complex. Acta Bot. Croat.
37: 171-182.
479
Kihner, R. 1950. Absence de boucles chez les Basidiomycetes de la série des
Ignaires et comportement nucléaire dans le mycelium des Hymenochaete Lév.
Compt.-Rendus Acad. Sci. Paris 230D: 1606-1608.
Lipscomb, D. L., Farris, J. S., Kallersjo & Tehler, A. 1998. Support, ribosomal
sequences and phylogeny of the Eukaryotes. Cladistics 14: 303-338.
Oberwinkler, F. 1977. Das Neue System der Basidiomyceten. /n: Frey, W., Hurka, H. E
Oberwinkler, F. (Eds.) Beitrage zur Biologie der niederen Pflanzen, p. 59-105.
Moore, R. T. 1985. The challenge of dolipore/parenthosome septum. /n: Moore, D.
Casselton, L. A., Wood, D. A. & Frankland, J. C. Developmental biology of higher
fungi. Cambridge: Cambridge University Press, p.175-212.
Nixon, K. 1999. WINCLADA Version 0.9.99.
Nobles, M. 1965. Identification of cultures of inhabiting Hymenomycetes. Can. J. Bot.
43: 1097-1139.
Parmasto, E. 1970. The Lachnocladiaceae of the Soviet Union with a key to boreal
species. Scr. Mycol. 2. Tartu: Institute of Zoology and Botany. 168p.
Parmasto, E. & Parmasto, |. 1979. The xanthochroic reaction in Aphyllophorales.
Mycotaxon, 8: 201-232.
Patouillard, N. Essai taxinomique sur les familles et les genres des
Hyménomyceétes. Thesis. Université de Paris. 184p.
Pegler, D. N. 1973. The Polypores. Suppl. Bull. Br. Mycol. Soc. 7(1): 1-43.
Pegler, D. N. 1995. Hyphal analysis of basidiomata. Mycol. Res. 100(2):129-142.
Pegler, D. N. & Young, T. W. K. 1993. Basidiome structure in Lachnocladiales sensu
lato. Kew Bull. 48(1): 37-52.
Pinto-Lopes, J. 1952. Polyporaceae, contribuig¢ao para a sua bio-taxonomia. Mem.
Soc. Broter. 8: 1-195.
Reid, D. A. 1965. A Monograph of the stipitate stereoid Fungi. Beih. Nova Hedw. 18:1-
382
Ryvarden, L. 1982. The genus Hydnochaete Bres. (Hymenochaetaceae). Mycotaxon
15:425-447
Ryvarden, L. 1985. Stiptochaete Gen. Nov. (Hymenochaetaceae, Basidiomycotina)
Trans. Br. Mycol. Soc. 85(3): 535-539.
Ryvarden, L. 1991. Genera of Polypores: Nomenclature and Taxonomy. Synopsis
Fung. 5. Oslo: Fungiflora. 363p.
Ryvarden, L. 1993. Tropical Polypores. /n: Isaac, S., Frankland, J. C., Watling, R. &
Whalley, A. J. S. Aspects of Tropical Mycology. Cambridge: Cambridge University
Press, p.149-170. 325p.
Snell W. H. & Dick, E. A. 1957. A glossary of Mycology. Cambridge: Harvard
University Press. 171p.
Stalpers, J. A. 1978. Identification of wood-inhabiting Aphyllophorales in pure culture.
Stud. Mycol. 16. Baam: CBS. 248p.
vv
MYCOTAXON
Volume LXXIX, pp. 481-496 July-September 2001
THE GENUS KRETZSCHMARIA FROM TUCUMAN, ARGENTINA
A. I. HLADKI ! AND A. I. ROMERO ”
1 Fundacion Miguel Lillo. Miguel Lillo 251. S.M. de Tucuman, 4000, Argentina. e-mail:
hladki@csnat.unt.edu.ar
2 PHHIDEB-CONICET, Depto. Cs. Bioldgicas, Facultad de Cs. Exactas y Naturales
(UBA), Ciudad Universitaria, Pabellon II, 4to. Piso, Cl428EHA Buenos Aires,
Argentina. e-mail: romero@bg.fcen.uba.ar, Fax 0054-11-4787-2706.
ABSTRACT Six taxa of Kretzschmaria -including those taxa formerly
considered as Ustulina- from Argentina are described and included in keys.
Two new species, Kretzschmaria argentinensis and K. sigmoidirima, are
proposed. K deusta, K. sandvicensis and K. pavimentosa are first records
from Argentina. The distribution area in Argentina of K. clavus is enlarged.
Keywords: Xylariaceae, new species, Kreizschmaria argentinensis, K.
sigmoidirima, Ustulina.
INTRODUCTION
During a survey of species belonging to the family Xylariaceae in Tucuman
Province in NW Argentina, species of the genus Kretzschmaria were studied. K. clavus
(Fr.: Fr.) Sacc. is the only record from Argentina made by Spegazzini (1909). Neither in
other papers by Spegazzini (1880, 1881) on the group nor in the works of Dennis
(1956, 1957, 1958) on South American material have any species of this genus been
recorded from Argentina.
The purpose of this paper is to present the results of the study of 74 specimens
collected during several years. These results include the proposal of two new species, the
report of three first records for Argentina, and a key to these six Argentine
Kretzschmaria species.
MATERIALS AND METHODS
During 1999 four samplings were carried out, one per season in summer, autumn,
winter and spring, in the montane forest of Tucumén, specifically in “The Yungas
Phythogeografic Province” or “Tucumano-Bolivian Forest” (Cabrera, 1971, Hueck
1978). In total 74 samples were collected The materials were air-dried and brought into
culture. Teleomorphic specimens were preserved in LIL and BAFC. Previous
collections (1988/89/95/97/98), kept at LIL and 54 specimens from BAFC, BPI, FH,
482
GZU, ITCV, K, LIL, LPS, NY, S, W, WSP were also studied (herbarium
abbreviations follow Holmgren et al., 1990).
Observations and measurements were taken from fresh material squash-mounted in
distilled water, 5¥o KOH and phloxine for optical microscopy and in Melzer ‘s reagent
for the amyloid reaction (IK). Drawings were made with a camera lucida.
Cultures were made from teleomorphic stromata as follows. The upper part of a
perithecium-bearing stroma was removed with a sterile razor blade. The contents of the
exposed perithectum were rehydrated with sterile distilled water, scooped out with a
sterile needle and transferred to a Petri plate containing 2% Oatmeal agar in 9 cm diam.
Petri plates and incubated under laboratory conditions at approximately 12 hr per day
fluorescent light at 20 ° C.
RESULTS
From the 74 collections, 39 specimens were identified as K. clavus (Fr: Fr) Sacc.,
18 as K. deusta (Hoffm.: Fr.) P. Martin, 3 as K. pavimentosa (Ces.) P. Martin, 5 as K.
sandvicensis (Reichardt) J. D. Rogers & Y.-M. Ju, 6 as the new species, K.
argentinensis A.1.Hladki & A.I.Romero, and 2 as another new species K. sigmoidirima
A.I.Hladki & A.I.Romero.
Key to species of Kretzschmaria from Argentina
1. Stromata stipitate or sessile, the fertile parts and/or stipes often fused; individual parts
seldomexceeding: (em diam: 40/5 ny. cesk ee ee 2
1. Stromata more or less sessile, but often attached by rhizoid-like processes or narrow
connectives; fertile parts usually exceeding 1 cm diam...................00...cccceeeeeeeeeeeeeee 4
2. Ascospores with a conspicuously sigmoid to spiral germ slit................0......0..02.. me
a al tay cele ed sel aac ans tah pie Aa ack coe iris Ale Romer lS cad K. sigmoidirima sp. nov
2. Ascospores with a straight germ slit shorter than spore length. ..........00..0000.ccceseeeee 3
3. Ascospores 35-40.5 x 10.5-12 um, stromata usually stipitate, the fertile part 1-3 mm
diam, strongly roughened by scales...............0...00.cccceee K. argentinensis sp. nov.
3. Ascospores 25-30 x 6.5-9 uum , stromata stipitate, the fertile part 2-5.5 mm diam,
SMOOUI rac sth Pe tienen een oe en oe eae ee K. clavus
4. Ascospores mostly longer than 40 pim..........o occ eee eeceeeeeceeeeceeeeeens K. pavimentosa
4. Ascospores mostly shorter than 40 pum... oo... cece cc eeeeeeeeeeeeeeee bik niger ee 5
5. Ascospores 26-31.3 x 6.5-7.8 um, with a germ slit shorter than spore length............
5. Ascospores 32.5-40.3 x 9.1-12 tm, with a germ slit slightly shorter than spore
length oF Pe eRe ne hs ne ene: K. sandvicensis
— a a
483
DESCRIPTIONS
Kretzschmaria argentinensis A.1. Hladki & A.I. Romero, sp. nov.
(Fig. I: 1-5; Fig. IIT: 3)
Etym.: after Argentina
A Kretzschmaria clavus differt in ascosporis (35.1-40.3 x 10.4-11.7 ym) dimensionis, et
in stromatibus per parvos clavos cum superficiebus rimosis compositis. Holotypus LIL:
Argentina: Tucuman: Depto. Chicligasta, Parque Provincial El Cochuna, ad viam prov.
331, Camping Samay, 1300 m asl., in ligno indet., 17-X1I-1999, Hladki 2303. Isotypus
BAFC 50.692 et BPI 747.563.
Stromata with convex, turbinate or obconical fertile parts 1-3 mm diam., usually
densely aggregated or fused into a small crust, tapering downwards into radiating,
infrequently branched, cylindrical stipes, or sessile; surface dull blackish brown, cracked
into small scales (corky, reticulate, fragmentary crust); carbonaceous immediately
beneath surface; tissue between and beneath perithecia coriaceous, yellowish or brown,
becoming dark brown and disintegrating. Perithecia spherical, 0.4-0.8 mm, 1-4 per club.
Ostioles minutely conical (hardly visible among the fragments of the clubs). Asci 8-
spored, cylindrical, stipitate, fugacious, 246-315 um total length x 12 ym, spore-bearing
parts 168-267 um long, stipes 36-78 jum long, apical ring IK *, urn-shaped, 9-12 x 6.5-8
uum. Ascospores brown to dark brown, unicellular, fusoid, inequilateral, with narrowly
rounded ends, often pinched, smooth, 35-40.5 (-44) x 10.5-12 (-13) um, with a ana
germ slit shorter than spore length.
It was not possible to obtain a culture after several attempts.
Specimens examined: The holotype LIL. Isotype BAFC, BPI. Argentina:
Tucuman: Depto. Chicligasta, Parque Provincial El Cochuna, ruta prov. 331, Camping
Samay, 1300 m asl., 28-III-95, Catania 381, BPI; ibid 14-VI-97, Hladki, 496, 494b LIL;
ibid 14-VIII-99, Hladki 2314 LIL ; ibid. 12-XI-99, Hladki 2336 LIL.
Substratum: on remains of bark from large semi-rotten trunks of a dicotyledon.
Notes: It is interesting to point out that this new species was only found in the type
locality in 1995, 1997 and 1999. The new taxon seems to be close to K. micropus (Fr.:
Fr.) Sacc. and to K. clavus (Fr.: Fr.) Sacc. The lectotype of K. micropus (NY!) was also
studied. The clubs of K. micropus and K. argentinensis are similar in size and shape, but
the clubs of the latter have a strongly roughened surface and the diagnostic feature of the
conical or spine-like processes or umbos on the fertile parts of K. micropus is absent.
The stalk can be present or not in the Argentine species but, when present, it is
cylindrical and generally short, whereas in K. micropus it is strap-like. The apical ring of
K. argentinensis is larger than in K. micropus (9-12 x 6.5-8 um and 7-8 x 5 um,
respectively). Both species have similar ascospores in shape and colour and size but, in
this new species, the germ slit is short whereas in K. micropus it is almost as long as the
total length of the spore. Another difference is the number of perithecia per stroma: in K.
argentinensis there are many, but in K. micropus, generally, there is only one. With
respect to K. clavus, the main differences are: a) K. argentinensis has small clubs (1-3
mm diam.) and a convex and very rugose surface (never plane). Stromata are sessile or
with short, cylindrical or subcylindrical, rarely branched stipes. It lacks the dull reddish
484
att thm tty yatta!
dst ere
485
brown tomentum at the base of stipes which is generally present in K. clavus. b)
Perithecia are spherical and smaller in size (0.4-0.8 mm) than K. clavus. c) The apical
ring (9-12 x 6.5-8 jum) is larger than in K. clavus. d) Ascospore size range 35-40.5 (-44)
x 10.5-12 (-13) um is close to the maximum values of the size of the ascospores of K.
clavus.
K. clavus is very abundant in all the localities where we have collected and no
specimen with intermediate features was found. The differences warrant the new species.
Additional material: Angola: Welwitsch, on wood, type of Hypoxylon
aggregatum (=K. micropus), K. Brazil: Rick, J., on wood, as Kretzschmaria
lichenoides (=K. micropus) GZU-Petrak 2084; Sao Paulo, 5.1V.1947, Fogg, H., on
wood, as K. spinifera (=K. micropus) GZU-Petrak. Mexico: 1895, Smith, C.L., on
wood, lectotype of K. micropus, NY.
Kretzschmaria clavus (Fr.: Fr.) Sacc., Syll. Fung. 0, p. XXIX, 1883
(Fig. I: 11-14; Fig. III:7)
= Sphaeria clavus Fr., Linnaea 5: 543, 1830; Fr.: Fr., Syst. Mycol. Index, p. 162.,1832
For list of synonyms and description see Rogers & Ju (1998)
Cultures were obtained (Cult. Collections LIL 702, 854. 807, 906). Macroscopical
features of the colonies are the same as of those given by Rogers & Ju (1998). Coiled:
hyphae of the mycelium were observed as those described in several cultures of Xylaria
species (Van der Gucht, 1996). Anamorph was not produced.
Specimens examined: Argentina: Buenos Aires: Santa Catalina, 23-IX-1969,
Gamundi, Dring & Martinez BAFC 50076. Misiones: Parque Nacional Cataratas del
Iguazu, Camping Nandu , Reserva, 28-X-1973, Wright, Deschamps & Del Busto M-
2426, on the base of a semirotten palm (Syagrus sp.) BAFC 50077. Ibid. Macuco, 23-
IX-1984, Job M-3814 BAFC 30407. Tucumadn: Depto. Chicligasta, Parque Provincial El
Cochuna, Prov Route 331, Camping Samay, 1300 m asl, 10-XI-89, Hladki 228 LIL
BAFC cult. XXXX; ibid 14-VI-97, Hladki 495 LIL, ibid. 14-X-97, Hladki 529 LIL;
ibid. 23-IV-98, Hladki 756 LIL; ibid 29-V-98, Hladki 847 LIL; ibid 15-II-99 Hladki
2159 LIL; ibid 17-V-99 Hladki 2304 LIL; 14-VIII-99 Hladki 2312 LIL; ibid. 12-XI-99
Hladki 2333 LIL. Depto: Lules, Quebrada de Lules, on a pathway next to the camping,
21-III-88, Hladki 159 LIL; ibid. Prov. Route 380 facing the river, 5-IV-88, Hladki 175
Fig. I. 1-5: Kretzschmaria argentinensis 1. Macroscopic morphology of stromata. 2-3.
Macroscopic morphology of infrequently branched and unbranched, cylindrical stipes.4. Ascus
with apical ring, I *. 5. Ascospores with germ slit. 6-10. Kretzschmaria sigmoidirima 6.
Macroscopic morphology of stromata densely aggregated or fused into small crust. 7.
Macroscopic morphology of cylindrical, irregular and short stipes.8. Stromatal surface with
strongly mammiform ostioles (arrow). 9. Ascus with apical ring, I *. 10. Ascospores with
sigmoid to spiral germ slit. 11-14: Kretzschmaria clavus 11. Macroscopic morphology of
stromata. 12. Macroscopic morphology of erect, cylindrical, unbranched stipes. Stipes branches
fusionate at the base, radiating from a common centre as small bunchs, with “apophyisis”
(arrow).13. Ascus with apical ring, I+. 14. Ascospores with germ slit.
486
LIL; Depto. Yerba Buena, Sierra de San Javier, Quebrada de Cainzo, on Phoebe
porphyria (Griseb.) Lillo, Vervoost, as K. puiggarii (Speg.)Sacc. LIL; ibid, Rio Los
Sosas, El Indio, 1200 m asl, 19-VII-1974, Deschamps & Del Busto 2578, on semirotten
trunk of Phoebe porphyria BAFC 50075, ibid, Parque Bioldgico Sierra de San Javier,
Horco Molle, 800 m asl, near University residence, crossing Muerto river, 6-IV-98,
Hladki 702 LIL, road parallel to dispensary, 14-V-99 Hladki 2286 LIL, ibid. 18-VIII-99
Hladki 2317 LIL, ibid. 17-XI-99 Hladki 2334 LIL; Depto: Monteros, Reserva
Provincial La Florida, Prov route. 325, 700 m asl, 3-VII-98, Hladki 883 on trunk of
Phoebe porphyria LIL, ibid. 17-II-99 Hladki 2170 LIL, ibid. 11-IV-99 Hladki 2309
LIL, ibid 25-VIII-99 Hladki 2325 LIL. Depto: Trancas, La Higuera, Cerro Alto de La
Totora, crossing river La Higuera, 1500 m asl, 21-V-99 Hladki 2305 LIL, 23-VIII-99
Hladki 2324 LIL. Depto: Tafi Viejo, Parque Bioldgico Sierra de San Javier, road to top
of Taficillo near Nina Velardez site, El Balcon, 1300 m asl, 25-II-99 Hladki 2253 LIL,
24-V-99 Hladki 2308 LIL, 20-VII-99 Hladki 2319, on semirotten trunk of “Horco
cebil” (Piptadenia macrocarpa) LIL. Depto: Burruyacu, Sierra de Medina, Prov. route
310, Km 31 from Villa Padre Monti, Aguas Negras, Finca Mansilla, 1600 m asl, 30-X-
98 Hladki 2001 LIL.
Additional material: Africa: Lloyd, C.G., as K. puiggarii BPI 716922 [Lloyd
herb. 11995. Brazil: Rio Grande do Sul, I. 1922, Rick, J. 20380, on wood, as K.
divergens BPI 594482; Mato Grosso, Serra da Chapada, Buriti, 6.1V.1894, Malme
G.O., on wood, BPI 594483. isotype of K. divergens, S holotype; Rio Grande do Sul ,
Sao Leopoldo, 1906, Rick, J, on wood, as K. divergens BPI 594484; Apiahy, Sao Paulo,
Puiggari J., on wood, ex Spegazzini BPI 716921 [Lloyd Herb. 12004], type of K.
puiggarii LPS 27236; Itatiaia, 19.X.1969, Dring, D.M. 117, on wood, as K. clavus K
62682. Nicaragua: Castillo Viejo, Rio San Juan, II-III.1893, Smith, C.L., on wood, BPI
716923 [Lloyd herb. 11993], BPI 716925 [Lloyd herb. 11995], GZU-Petrak 2089 [ex
Lloyd herb] type of K. pusilla. Zaire “Belgian Congo”, Vanderyst, H., on wood, as K.
pusilla by Lloyd, C.G. BPI 716924 [Lloyd herb. 12813].
Substratum: Stromata are generally on big, fallen, rotten trunks of dicotyledon
covered by mosses; however a note in the collection BAFC 50 077 reads “on
monocotyledon”. Most of the time, because of the condition of the substratum, it was
difficult to identify the host. Some specimens were found on living trees of Phoebe
porphyria (Griseb.) Lillo, Piptadenia excelsa (Horco cebil) (Griseb.) Lillo, as well as on
semi-rotten palm Arecastrum sp., BAFC 50077).
In the “Fiscal Reserve Parque La Florida” there is a large number of living trees
attacked by this species and stumps are so completely covered by black stromata that
they seem to be burnt. It is worth mentioning that in a pure forest of Podocarpus
parlatorei Pilg. it is not present on this tree although it occurs on other hosts in the same
area.
Geographic distribution: Brazil, Ecuador, French Guiana, Grenada, Mauritius,
Nicaragua, Papua New Guinea, Paraguay, Puerto Rico, Uganda, U.S.A., Zaire (Rogers
& Ju 1998), Mexico (San Martin & Rogers, 1993), Venezuela (Dennis, 1970), Guyana,
St. Vincent, Colombia, Cuba (Dennis, 1957), Bolivia (Dennis, 1958).
487
Notes: The Argentine specimens coincide with the description given by Rogers &
Ju. (1998) except for: a) Dull reddish brown tomentum at the base of the stipe in fresh
and young specimens that is lacking in old ones. b) A small eccentric sterile umbo in
some specimens (LIL 847, 703, 906, 883, 495, 529, 2170, 2253, 2317, BAFC 50077)
and in some clubs, as was also observed by San Martin & Rogers (1993) in Mexican
specimens. It is worth saying that in the original description of this species the umbo is
not mentioned and according to Rogers & Ju (1998) is an important character which
they use in the key to separate species into two groups. c) Thick stipe just at the point of
union to the club, which we call apophysis. d) Asci with longer pedicels. e) rather shorter
ascospores.
The specimens show large morphological variation, sometimes appearing as loose,
light to dark brown crusts of aggregations of clubs, poorly branched, with erect stipes,
and with the appearance a nail (identical to Dennis (1957) ‘drawing of this species), but
at other times they appear as a large, compact crust of fused clubs with a smooth, black,
plane surface identical to Dennis ‘ drawing (1957) to illustrate K. coenopus (Fr.:Fr.)
Sacc., on highly branched stipes, sometimes erect, sometimes parallel to the substratum
but not losing their individuality nor their cylindrinc shape.
According to Rogers & Ju (1998) Kretzschmaria clavus is undoubtedly a pathogen
of roots and/or butts. It was reported by Ko ef¢ al. (1977) to cause root rot of
Macadamia integrifolia Maiden & Betche, the most serious disease of this tree in
Hawai. It is very common to observe large fallen trunks with almost 70 % of their
surface covered by K. clavus, in addition to effuse Kretzschmaria ustulinoid type
stromata such as K. deusta (Hoffm.: Fr.) P. Martin, or K. sandvicensis (Reichardt) J. D.
Rogers & Y.-M- Ju..
Although the stromata persist during the different seasons the best time to find
young grey coloured stromata with the anamorph in the Tucuman “Yungas’”, is between
the end of spring and the beginning of summer. It is very important to take into account
the presence of this pathogenic species because of its destructive effects (Ko et al. 1977,
1982, 1986).
Kretzschmaria deusta (Hoffm.: Fr.) P. Martin, J. S. African Bot. 36: 80. 1970
(Fig. I: 1-5; Fig IIT: 5)
= Sphaeria deusta Hoffm., Veg. Crypt. I, p: 3. 1787; Hoffm.: Fr., Syst. Mycol. II, p.
345. 1823; non Wahlenberg, 1812.
For list of synonyms see Rogers & Ju (1998)
Stromata pulvinate to effused pulvinate, rarely orbicular, discrete, densely
aggregated or fused, 10-28 x 1-4 mm, attached to substrate with narrow connectives,
usually with crenate, sloped margins; surface dark brown to blackish brown, especially
towards the margin of the stromata, often with reticulate major cracks; carbonaceous
- immediately beneath the surface; tissue between and beneath perithecia coriaceous to
woody, white to gray, becoming dark brown and disintegrating; with a hairy brown
coppery mat in the abaxial face of the stroma. Perithecia obovoid to tubular, 0.4-1.3 x
0.6-1.4 mm. Ostioles conic papillate, minute, darker than the surface of the stroma. Asci
246-276 um total length x 10-14 um, spore-bearing parts 171-189 pm long, stipes 66-
488 |
489
114 pm long, apical ring IK *, urn-shaped, 4-5 x 4-5 um. Ascospores brown to dark
brown, unicellular, fusoid- inequilateral, with acute ends sometimes pinched, smooth, 26-
31 (-34) x 6.5-8 (-9) um, with a straight germ slit less than 2/3 of spore length.
Cultures were obtained (Cult. Collections LIL 2287, 2301, 2306). The features of
the colonies are the same as of those given by Jong and Rogers (1972) and Petrini and
Miieller (1986) except for anamorph was not produced.
Specimens examined: Argentina: Tucuman: Depto. Chicligasta, Parque Provincial
El Cochuna, prov. route 331, Camping Samay, 1300 m asl., 29-V-98, Hladki 838 LIL;
ibid 17-V-99, Hladki 2301 LIL; ibid. 12-XI-99, Hladki 2338 LIL; Depto. Yerba Buena,
Parque Bioldgico Sierra de San Javier, Horco Molle, 800 m asl, near University
residence, crossing Muerto river, 6-IV-98, Hladki 714 LIL; ibid road parallel to
dispensary, 18-VIII-99 Hladki 2316 LIL, ibid. 17-XI-99 Hladki 2341 LIL; Depto:
Monteros, Reserva Provincial La Florida, ruta prov. 325, 700 m asl, 17-II-99 Hladki
2202 LIL, ibid. 11-VI-99 Hladki 2310 LIL, ibid 25-VIII-99 Hladki 2327 LIL , ibid. 24-
XI-99 Hladki 2344 LIL. Depto: Trancas, La Higuera , Cerro Alto de La Totora,
crossing river La Higuera, 1500 m asl, 19-II-99 Hladki 2216 LIL, ibid. 21-V-99 Hladki
2306 LIL, 23-VII-99 Hladki 2322 LIL, ibid. 15-XI-99 Hladki 2339 LIL; Depto:
Burruyacu, Sierra de Medina, prov route 310, Km 31 from Villa Padre Monti, Aguas
Negras, Finca Mansilla, 1600 m asl, 19-V-99 Hladki 2302 LIL, on living Podocarpus
parlatorei Pilg.. Depto: Tafi Viejo, Parque Bioldgico Sierra de San Javier, road to the
top of Taficillo near Nina Velardez site, El Balcon, 1300 m asl, 1-XII-99 Hladki 2345
LIL.
Additional material: Cuba: Central Trinidad, Iznaga, Prov. Santa Clara,
21.X1.1924, Weir, J. R., on wood of Cailliea glomerata, as Ustulina zonata by Weir, J.
R. BPI 586819; GZU-Petrak 1075. Czech Republic: Mahren (now Moravia), Olspitz
bei Mahr.- WeiBkirchen, X.1931, Petrak, F., Mycoth. General. 1886, on wood, as
Ustulina deusta by Petrak, F. WSP 19263. French Guiana: Saul, Circuit Grand Fosse,
elev. 300-350 m, 10.11.1986, Samuels, GJ. 3633, bark NY. Germany: Bavaria,
Mittelfranken, Kr. Hersbruck, Kukensborg, 23.1X.1946, Starcs, K. 2732, on wood of
Fagus silvatica, as Ustulina vulgaris WSP 15763. Mexico: José Maria Morales
Municipality, Quintana Roo, 6.X1.1986, San Martin 733, on living Citrus tree ITCV.
Puerto Rico: Mayaguez, Earle, F. S. 247, on wood, as Ustulina zonata by Diehl, W. W.
Fig. II. 1-5 Kretzschmaria deusta. 1. Macroscopic morphology of stromata. 2. Longitudinal
sections of a stroma with a hairy brown coppery mat in abaxial face (m). 3. Stromata attached to
substrate with narrow connectives (c). 4 Ascus with apical ring, I ~. 5. Ascospores with germ slit.
6-9. Kretzschmaria pavimentosa 6. Macroscopic morphology of a stroma. 7. Stromatal surface
with ostioles coarsely papillate, conical (arrow). 8. Ascospores with germ slit. 9. Apical ring I *.
10-13. Kretzschmaria sandvicensis 10. Macroscopic morphology of a stroma. 11. Stromatal
surface with ostioles papillate ostiolar openings (arrow). 12. Apical ring I*. 13. Ascospores with
germ slit.
490
BPI 587147. U.S.A. : Kentucky, Fort Thomas, [V.1912, Weir, J. R. 2716, on wood of
Fagus americana , as Ustulina linearis BP 587139; New Jersey, 31.VII.1920, Sterling,
E. B., on wood GZU- Petrak 2023, isotype of Hypoxylon magnosporum, Ohio,
Hamilton Co., Cincinnati, Stanberry Park, 2.X.1956, Cooke, W.B. 30434, on wood of
Fagus grandifolia, as Ustulina vulgaris WSP 45000. U.K.: Scotland, Midlothian, South
Queensferry, 16.X.1965, Watling, R. 926, on wood of Fagus sylvatica, as Ustulina
deusta E 00046128; Cooke, M. C., Fungi Britannici Exsiccati, Ed. II, no. 465, on wood,
as Ustulina vulgaris E 00046132; ex herb. Cooke, on wood, as Ustulina vulgaris E
00046133; Hants, Lyndhurst, X. 1879, Baker, J. G., beech on wood, as Ustulina
vulgaris E 00046129.
Substratum: Specimens were generally found on large branches or fallen decaying
trunks of dicotyledon, with bark or decorticated, along with fern rhizomes and mosses.
They were also detected at the base of stumps along with of K. clavus. Only once they
were found on a living tree of Podocarpus parlatorei Pilg.
Geographic distribution: Czech Republic, Germany, U.K., U.S.A. Mexico.
According to Rogers & Ju (1998) this species is most commonly encountered in
the North Temperate Zone. San Martin & Lavin (1997) has reported it from Mexico.
Notes: Rogers & Ju (1998) point out that there are reports of this species from
tropical and subtropical zones, but they believe these records are misidentifications and
correspond to the tropical species K. pavimentosa (Ces.) P. Martin, K. sandvicensis
(Reichardt) J. D. Rogers & Y.-M. Ju and K. zonata (Lév.) P. Martin. However, K.
deusta is present in Tucuman province, “ The Yungas Phythogeographic Province’, a
subtropical zone of the Amazonic Domain, Neotropical Region, following Cabrera, 1971
and Hueck, 1978. Its identification was confirmed by examination of the holotypes of K.
pavimentosa and K. sandvicensis and specimens determined as K. zonata by Rogers &
Ju (1998). ;
K. deusta is the first record from Argentina. These Argentine specimens coincide
with their description except for: a) Presence of a hairy brown coppery mat in the reverse
of fresh stromata (LIL 2202). b) Some specimens have effuse-pulvinate stromata
without stipes or with very long, strap-like (LIL 2327) stipes immersed in cracks of the
wood. This was also observed by Martin (1970).
K. deusta and K. sandvicensis are similar. The main differences between them are
the features and size of the ascospores: in K.deusta they are: 26-31 (32.5) x 6.5-8 (-9)
um, with narrow round ends and with a short, straight germ slit whereas, in K.
sandvicensis they are 32.5-40.5 x 9.1-12 um, with broadly round ends and with a long
germ slit occupying 80 % of the total length of the ascospore. It is very important to
state that Schwarze et al. (1995) have shown soft-rot cavity formation in the S2 layer of
secondary cell walls caused by K. deusta.
Ecological observations: The best period for collecting is between late summer
and autumn and at the end of spring and early the summer anamorphic stromata are
found with a grayish surface due to mass of conidia.
|
49]
Kretzschmaria pavimentosa (Ces.) P. Martin, J. S. African Bot. 42: 74. 1976
(Fig. II: 6-9; Fig III: 4)
=Hypoxylon pavimentosum Ces., Atti Accad. Sci. Fis. 8: 18.1879
For list of synonyms see Rogers & Ju (1998)
Stromata discoid, restricted-pulvinate, or effused pulvinate, discrete or densely
ageregated, 8-30 x 2-3 mm, usually with crenate, steep margins; surface greyish brown,
smooth or with major cracks; carbonaceous immediately beneath the surface; tissue
between and beneath perithecia coriaceous to woody, white to gray, becoming dark
brown and disintegrating. In the abaxial face of the stromata a coppery brown hairy mat
is present. Perithecia obovoid to obclavate, 0.8-1.3 x 1.1-1.2 mm. Ostioles papilllate,
minute, dark brown. Asci 264-288 um total length x 10-12 pm broad, spore-bearing
parts 150-170 um long, stipes 99-120 rm long, apical ring IK* , urn-shaped, 5-6.5 x 4-5
um. Ascospores brown to dark brown, unicellular, fusoid-inequilateral, with acute ends
sometimes pinched, smooth, 42-55 x (-8) 9-13 ym, with a straight germ slit shorter than
the spore length (19.5-22 um length).
Cultures were obtained (Cult. Collections LIL 514, 515). The features of the
colonies are the same as of those given by Rogers & Ju (1998). Anamorph was not
produced.
Specimens examined: Argentina: Tucuman: Depto. Chicligasta, Parque Provincial
El Cochuna, prov. route 331, Camping Samay, 1300 m asl., 14-X-97, Hladki 514 LIL. .
Additional materials: Brazil: Ule, H. E., Holotype of Kretzschmaria bulgarioides
S; Ule, H. on wood Para, Municipio Oriximina, Rio Trombetas, 19.VI.80, Dunn P.
80PHD-16 NY. French Guiana: Piste de Saint-Elie, Km 16 on road between Sinnamary
and St. Elie, ECEREX, ORSTOM research area, II-III. 1986, Samuels, G. J. 4037, bark
NY; Paul Isnard Area, ca. 150 Km S of St. Laurent du Moroni, Citron, Mt. Decou
Decou, 11, 12.11.1986, Samuels, G.J. & Searwar, P. 4237 & 4246, bark of liana NY;
Upper Marouini River: between Roche Koutou and unnamed granitic, 19,20-VIII-87,
Samuels, G.J. et al. 5920 NY Guyana: Cuyuni-Mazaruni Region, Mazaruni Subregion,
along Koatse R., II, I-87, Samuels, G. J. et al. 4927, on log NY. Malaysia: Borneo,
Sarawak, Beccari, O. 206, on wood K _ 52691. lectotype of Kretzschmaria
pavimentosum. Mexico: Chiapas State, Ocosingo Municipality, Boca de Chajul,
29.V.1988, San Martin, F. 838 ITCV. Puerto Rico: Mayaguez, Las Marias Road, Earle,
F. S. 246, on rotten stump, as Ustulina zonata by Diehl, W. W. BPI 587146. Sudafrica:
Krysna, Garden of Eden, I. 1958, as Ustulina deusta, Martin, P. 52 BAFC.
Substratum: on decaying trunk of a dicotyledon.
Geographic distribution: Brazil, Ecuador, French Guiana, Guyana, Grenada,
Honduras, Malaysia, Mexico, New Zealand, Puerto Rico, Taiwan (Rogers & Ju, 1998);
Dennis, 1970).
This fungus is one of the most frequently encountered Kretzschmaria species in the
tropics and subtropics (Rogers & Ju, 1998).
492
493
Notes: Our material coincides with the description given by Rogers & Ju (1998)
except for: a) thinner and more sloped margins and b) the presence of a hairy mat in the
inferior part of the stromata.
Ecological observations: It was only found once in the en Rio Cochuna area in
October 1997 although almost all the province was explored in the different seasons
during several years.
Kretzschmaria sandvicensis (Reichardt) J. D. Rogers & Y.-M. Ju. Mycotaxon LXVIII:
366. 1998
(Fig. Il: 10-13; Fig. IIT: 6)
=Hypoxylon sandvicense Reichardt, Sitzungsber. Kaiserl. Akac. Wiss., Math.-
Naturwiss. Cl. , Abt. I , 75: 6. 1877
For list of synonyms see Rogers & Ju (1998)
Stromata pulvinate to effused pulvinate, discrete, orbicular to densely aggregated
or fused, 18-85 x 1-4 mm, attached to substrate with narrow connectives, usually with
crenate, sloped margins; surface dark brown to blackish brown specially at the margins,
often with reticulate major cracks; carbonaceous immediately beneath the surface; tissue
between and beneath perithecia coriaceous to woody, white to gray, becoming dark
brown and disintegrating; in the inferior face a hairy cuprous brown mat is present.
Perithecia rectangular to ovoid, 0.6-1.2 x 0.4-0.8 mm. Ostioles finely papillate. Asci
261-330 um total length x 10-12 um broad, spore-bearing parts 141-189 um long, stipes
120-180 um long, apical ring IK *, urn-shaped, 5-6.5 x 5-6.5 um. Ascospores dark
brown, unicellular, fusoid to ellipsoid, inequilateral, with broadly rounded ends, smooth,
32.5-40.5 x 9-12 um, with a straight germ slit slightly shorter than the spore length (80
% of the total length of the ascospore).
Cultures were obtained (Cult. Collections LIL 2311, 2106). The features of the
colonies are the same as of those given by Rogers & Ju (1998). Anamorph was not
produced.
Specimens examined: Argentina: Tucuman: Depto. Chicligasta, Parque Provincial
El Cochuna, prov. route 331, Camping Samay, 1300 m asl., 10-XI-89, Hladki 234
BAFC; ibid 15-II-99 Hladki 2160 LIL; 14-VIII-99 Hladki 2311 LIL; ibid. 12-XI-99
Hladki 2325 LIL; Depto: Tafi Viejo, Parque Bioldgico Sierra de San Javier, road to the
top of Taficillo near of Nina Velardez site, El Balcén, 1300 m asl, 20-VIII-99 Hladki
2320 LIL.
Additional materials: Colombia: near Tumaco, XII. 1940, Skutch & Stryker,
Stakman 245, on wood, as Ustulina zonata by Diehl, W.W. BPI 587044. French
Fig. Ill. General Aspects: 1-2. Kretzschmaria sigmoidirima (LIL 715). 3 Kretzschmaria
argentinensis (LIL 494b). 4 Kretzschmaria pavimentosa (LIL 521). 5 Kretzschmaria deusta
(LIL 2327). 6 Kretzschmaria sandvicensis. (LIL 2160). 7 Kretzschmaria clavus (LIL 2309).
494
Guiana: Piste de Saint-Elie, Km 16 on road between Sinnamary and St. Elie, ECEREX,
ORSTOM research area, II-III. 1986, Samuels, G. J. 3861, on bark NY. India: Bombay,
1882, Carter, H. J., on wood, K 52689, holotype of Kretzschmaria tessulata. Java:
Tjibodas, 1907-1908, Hohnel, F., Weese’s Eumycetes Selecti Exs. 431, on rotten wood,
as U. zonata BPI 587148. U.S.A.: Hawaii, Wailuku, 1868-71, Wawra 1831&1832, on
corticated wood W1831,W1832: holotype of Hypoxylon sandvicense. |
Substratum: on semi-rotten trunk of a dicotyledon.
Geographic distribution: Colombia, French Guiana, Guyana, India, Mexico, New
Caledonia, Papua New Guinea, Philippines, Puerto Rico (Rogers & Ju, 1998); Dennis,
1970).This fungus is one of the most frequently encountered Kretzschmaria species in
the tropics and subtropics (Rogers & Ju, 1998).
Notes: see notes on K. deusta.
Kretzschmaria sigmoidirima A.J. Hladki & A.J. Romero, sp. nov.
(Fig. I: 6-10; Fig. II: 1-2)
Etym.: sigmoid= curved like the letter S, rima = slit
A Kretzschmaria curvirima differt in ascosporis ((26)30-32.5 x (8-)9-10.5 jum)
dimensionis, et in annulo apicali 8 x 5-6.5 um. Holotypus: LIL. Argentina: Tucuman:
Depto. Yerba Buena, Parque Bioldgico Sierra de San Javier, Horco Molle, 800 m asl, ad
viam prope dispensarium, 17-XI-99, Hladki 2340. Isotypus BAFC 50.694 et BPI
747.564.
Stromata with convex or flattened fertile parts 1.5-3.5 mm diam., usually
containing one or two perithecia, densely aggregated or fused into a small crusts,
frequently sessile or tapering downwards into cylyndrical, irregular and short stipes,
surface dull brown, irregular by cracked into diminute scales; carbonaceous immeditely
beneath the surface; tissue between and beneath perithecia coriaceous, yellowish or
brown, becoming dark brown and disintegrating. Perithecia ovoid to spherical, 0.5-0.7 x
0.5-0.9 mm. Ostioles strongly mammiform papillate. Asci eight-spored, cylindrical,
stipitate, fugacious, 195-297 um x 10-12 um, spore-bearing parts 165-207 um long,
stipes 80-91 um long, apical ring IK *, urn-shaped, 8 x 5-6.5 tum. Ascospores dark
brown, unicellular, ellipsoid or fusoid, inequilateral, with narrowly rounded ends,
smooth, (26-) 30-32.5 x (8-) 9-10.5 um, with a sigmoid to spiral germ slit slightly
shorter than the spore length.
Unfortunatly, several attempts to culture it proved unsuccessful.
Specimens examined: Holotype: LOL. Isotype BAFC 50694, BPI 747564. Same
data as holotype, 06-IV-98, Hladki 715.
Additional material: Guyana: Cuyuni-Mazaruni Subregion, vic. Chinoweing
Village, elev. 650-750m, 20-23.II.1987, Leg.: Samuels, G.J. et al. 46427, Det.: Rogers,
on wood, holotype of K. curvirima J.D. Rogers & Y.-M. Ju, NY. Isotype of K.
495
curvirima WSP 69722.
Substratum: on remains of bark from semi-rotten large trunks of a dicotyledon.
Notes: It is worth mentioning that although almost all the province was explored,
this new taxon was only found in this locality in autumn and spring.
It was compared with the holotype (NY!) of K. curvirima Rogers & Ju (1998) since this
was the only species recorded with a sigmoid germ slit. This feature is almost the same in
both species but they differ because: a) K.curvirima has conic spines on almost all the
clubs, whereas in K. sigmoidrima they are absent b) the perithecia in K. sigmoidrima are
ovoid to spherical and c) perithecia, apical apparatus and ascospores are smaller than in
K. curvirima
ACKNOWLEDGMENTS
We would like to express our gratitude to the Curators of the following herbaria
for the loan of specimens: BAFC, BPI, FH, GZU, ITCV, K, LIL, LPS, NY, S, W, WSP.
Specially the authors thank to Dr. Jorge E. Wright for reading this manuscript and
to Dra. Graciela Kohen for the Latin diagnosis, as well as to Dr. Rogers and Dr. San
Martin for their valuable comments.
We thank the authorities of CIUNT for financial support and of the Parque
Bioldgico Sierra San Javier for allowing the visit and to the forest keepers for guiding us.
Thanks are also due to Inés Jaume for the ink drawings and to Miguel Almazan for the
photographs.
We gratefully acknowledge the gift of specimens given by Dr. San Martin.
This is publication N° 142 of the PRHIDEB, partially financed by the Argentine
National Research Council.
LITERATURE CITED
Cabrera, A.L. (1971). Fitogeografia de la Republica Argentina. Bol. Soc. Argent. Bot.:
14: No. 1-2.
Dennis, R.W.G. (1956). Some Xylarias of Tropical America. Kew. Bull. 3: 401-444.
Dennis, R.W.G. (1957). Further Notes on Tropical American Xylariaceae. Kew. Bull. 2:
297-331.
Dennis, R.W.G. (1958). Ascomycetes collected by Dr. R.Singer in Bolivia and North
Argentina. Kew. Bull. 13: 51-154.
Dennis, R.W.G. (1970). Fungus flora of Venezuela and adjacent countries. Kew Bull,
add. Ser., 3: 1-531.
Holmgren, P. K., N. H. Holmgren & L. C. Barnett. (1990). Index Herbariorum. Part I:
The Herbaria of the World. New York Botanical Garden: New York ,
U.S.A. 693 pp.
Hueck, K. (1978). Los bosques de Sudamérica. Soc. Alemana Coo. Técnica. 476 pp.
Jong, S. C. and J. D. Rogers (1972). Illustrations and descriptions of conidial states of
some Hypoxylon species. Wash. State Agric. Exp. Sta. Tech. Bull. 71: 1-51.
Ko, W. H. , W. C. Ho, & R. K. Kunimoto. (1982). Relation of Kretzschmaria clavus to
496
hypoxyloid stromata on diseased macadamia tissues. Phytopathology 72:
1357-1358.
Ko, W. H., R. K. Kunimoto, & I. Maedo. (1977). Root decay caused by Kretzschmaria
clavus : its relation to macadamia decline. Phytopathology 67: 18-21.
Ko, W. H., J. Tomita, and R. L. Short. (1986). Two natural hosts of Kretzschmaria
clavus in Hawaiian forests. Plant Pathology 35: 254-255
Martin, P. (1970). Studies in the Xylariaceae: VIII. Xylaria and its allies. Jl. S. Afr. Bot.
36 (2): 73-138.
Petrini, L. E., and E. Mueller. (1986). Haupt- und nebenfruchtformen europaischer
Hypoxylon -Arten (Xylariaceae, Sphaeriales) und verwandter pilze.
Mycologia Helv. 1: 501-627.
Rogers, J.D. & Yu-Ming Ju. (1998). The genus Kretzschmaria. Mycotaxon 68: 345-
393.
San Martin, F and J. D. Rogers. (1993). Kretzschmaria, Leprieuria, and Poronia in
Mexico. Mycotaxon 48: 179-191.
San Martin , F. E. y P.A. Lavin. (1997). Datos sobre los géneros Entonaema y Ustulina
(Pyrenomycetes, Xylariaceae). Acta Bot. Mex. 40: 25-35.
Spegazzini, C. (1880). Fungi Argentini. Pugillus Primus. An. Soc. Cient. Arg. 9: 158-
192.
Spegazzim, C. (1881). Fungi Argentini. Additis Nonnullis Brasiliensibus
Montevideensibusque. Pugillus IV. An. Soc. Cient. Arg. 12: 97-117.
Spegazzini, C. (1909). Mycetes Argentinenses (serie IV). An. Mus. Nac. Bs. As. 12 (ser
3): 257-458.
Schwarze, F. W. M. R., Lonsdale, D. & Mattheck, C. (1995). Detectability of wood
decay caused by Ustulina deusta in comparison with other tree-decay fungi.
Eur. J. For. Path. 25: 327-341.
Van der Gucht, K.1996. Xylaria species from Papua New Guinea: cultural and
anamorphic studies. Mycotaxon 60: 327-360.
MYCOTAXON
Volume LXXIX, pp. 497-498 July-September 2001
ONLINE RESOURCES
FOR FUNGAL TAXONOMY & NOMENCLATURE:
Web design
KATHIE T. HODGE
Department of Plant Pathology, Cornell University, Ithaca, NY, U.S. A.
Maintainer, WWW Virtual Library: Mycology
http://mycology.cornell.edu/
Now that it’s more than just trendy to have a web page, here are some thoughts on
developing a site, and one the factors that impact your site’s usability. Basic web pages
are written in hypertext mark-up language (HTML). They consist simply of a text file
with embedded instructions called tags. The tags that tell a browser (Netscape or
Explorer) how to display the text and where image files are to be inserted.
Generating HTML
Any text editor or word processor can be used to create web pages, but a dedicated
HTML editor will save you having to learn HTML tags. Macromedia Dreamweaver and
Microsoft Frontpage are excellent examples of this genre; various freeware and
shareware editors are also available. An excellent way to learn HTML tricks is to peek at
the code behind your favorite pages by selecting “View source” from your browser’s
menus. Like the ICBN, HTML is an evolving standard. The WC3 site below is the
official guide to current specifications.
Dreamweaver http://macromedia.com/software/dreamweaver/
Frontpage http://www. microsoft.com/frontpage/
Virtual Library of WWW Development http://www.stars.com/Vlib/
Beginner’s Guide to HTML http://archive.ncsa.uiuc.edu/General/Internet/W WW/HTMLPrimer. html
Bare Bones Guide to HTML (in many languages) http://werbach.com/barebones/
WC3 HTML standards http://www.w3.org/MarkUp/
Be kind to your users
Once you’ve figured out how to generate the code, it’s tempting to install lots of fancy
features like blinking alerts, animated arrows, your musical compositions, and dizzying
background images. Please try to resist.
A first-time user might be willing to read a lot of text before encountering the
information they’re looking for. Repeat users want to get to the “meat” of things quickly,
so give them several ways to navigate your site. Provide an abbreviated Table of
Contents at the top and bottom of pages, or use a sidebar with a site map. Put your
search box in a left-hand, non-scrolling frame so it’s always handy. Don’t make users
return to the home page to get to a different part of the site. A nice short page that is to
the point and provides a clear map of the rest of your site makes an excellent home page.
498
Your users have different monitor sizes, and browsers that deal with newer tags in
different ways. Try to preview your site on several machines of varying vintage. For
background and text colors, stick with “web safe” colors—others are rendered
approximately on some computers through dithering, and appear as a distracting
sprinkling of colored snow. Consider, too, that some users are viewing your page from
home using a slow modem, and might not appreciate all those gratuitously animated
images you made one night after drinking too much coffee. Most graphics programs (and
the website below) will help you save an image in a reduced size optimized for the web,
which can save long load times without sacrificing image quality.
Web-safe colors from Lynda.com http://www. lynda.com/hex. html
Optimize It Here http://optimizeithere.com/
Site indexing
The old-fashioned method of indexing is to provide a table of contents. As your site
begins to grow you will regret this, as it requires you to personally keep track of the
relationships amongst all your pages. Computers are better at this. You might use a
database such as Access or Filemaker to allow highly-customizable searches—Oracle
represents the pinnacle of achievement here. Alternatively, Javascripts embedded in your
pages can search your site when run through your users’ browsers (transferring the load
from your server to their personal computers). Remote search services are run by
companies like Webinator that “crawl” your site and create an index on their own server.
This method releases you from having to learn how to program a search tool, and is
extremely useful for those who maintain many pages but aren’t interested in becoming a
web server geek. These services also reduce your control—the remote index may not be
updated as frequently as you might like, or you might be obliged to display another
company’s advertisement on your site.
Search Tools http://www.searchtools.com/
Cut and Paste Javascript http://www.infohiway.com/javascript/
Webinator Site Search http://www.thunderstone.com/webinator/
Let others know about your site
Many of the major search engines will find your site whether you want them to or not.
When your site is brand new, you can give them a head start by submitting your site’s
address to a few major search engines, including the WWW VL: Mycology. Also try the
MSA Bulletin board and mailing groups related to your topic.
499
-NOMENCLATURAL NOVELTIES PROPOSED IN MYCOTAXON VOLUME 79
Amanita circinata O.K. Mill. & Lodge, p. 294
Amanita cruzii O.K. Mill. & Lodge. p. 297
Amanita occidentalis O.K. Mill. & Lodge, p. 291
Amanita sinocitrina Zhu L. Yang, Zuo H. Chen, & Z.G. Zhang, p. 275
Antrodia sandaliae Bernicchia & Ryvarden, p. 58
Aspidothelium gemmiferum Sérus. & Liicking, p. 44
Athelopsis colombiensis Hjortstam & Ryvarden, p. 190
Brevicellicium flavovirens Hjortstam, p. 173
Brevicellicium udinum Hjortstam, p. 185
Caloplaca nashii Nav.-Ros., Gaya, & Hladun, p. 31
Ceriporiopsis cystidiata Loguercio-Leite, G.V. de C. Gong., & Ryvarden, p. 286
Doassansiopsis euryalis Vanky, p. 231
Histeridiomyces tishechkinii A. Weir, p. 82
Hyaloseta A.W. Ramaley, p. 269
Hyaloseta nolinae A.W. Ramaley, p. 269
Hymenoscyphus adlasiopodium Zheng Wang, p. 308
Hypogymnia flavida McCune & Obermayer. p. 24
Kretzschmaria argentinensis Hladki & A.I. Romero, p. 483
Kretzschmaria sigmoidirima Hladki & A.I. Romero, p. 494
Lentinula raphanica (Murrill) Mata & R.H. Petersen, p. 228
Macowanites vinaceodorus Calonge & J.P. Vidal, p. 2
Minostroscyta Hjortstam & Ryvarden, p. 194
Minostroscyta discoidalis Hjortstam & Ryvarden, p. 194
Monocillium nolinae A.W. Ramaley, p. 270
Muscodor Worapong, Strobel, & W.M. Hess, p. 71
Muscodor albus Worapong, Strobel, & W.M. Hess, p. 71
Myelochroa sikkimensis Divakar, Upreti, G.P. Sinha, & Elix, p. 248
Niesslia agavacearum A.W. Ramaley, p. 272
Parmotrema negrosorientalum Elix & Schumm, p. 253
Peronosclerospora eriochloae Ryley & Langdon, p. 89
Pseudotrichoconis W.A. Baker & Morgan-Jones, p. 367
Pseudotrichoconis echinophila (C. Massal.) W.A. Baker & Morgan-Jones, p. 368
Pulvinella A.W. Ramaley, p. 52
Pulvinella nolinae A.W. Ramaley, p. 52
Radulomyces subsigmoideus Hjortstam & Ryvarden, p. 197
Reimnitzia Kalb, p. 325
Reimnitzia santensis (Tuck.) Kalb, p. 325
Rhexodenticula W.A. Baker & Morgan-Jones, p. 363
Rhexodenticula cylindrospora (R.F. Castafieda, Saikawa, & Hennebert) W.A. Baker & Morgan-
Jones, p. 363
Rhizopogon buenoi Calonge & M.P. Martin, p. 102
Topeliopsis acutispora Kalb, p. 320
Topeliopsis corticola Kalb, p. 322
Topeliopsis muscigena (Stizenb.) Kalb, p. 322
500
Topeliopsis vezdae Kalb, p. 323
Trichophaea donglingensis Zheng Wang, p. 312
Ustilago deyeuxicola Vanky & L. Guo, p. 262
Wenyingia Zheng Wang & Pfister, p. 397
Wenyingia sichuanensis Zheng Wang & Pfister, p. 397
Xylaria albisquamula F. San Martin, J.D. Rogers, & P. Lavin, p. 340
Xylaria duranii F. San Martin & Vanoye, p. 342
Xylaria michoacana F. San Martin, J.D. Rogers, & P. Lavin, p. 348
Xylaria quercinophila F. San Martin, J .D. Rogers, & P. Lavin, p. 349
Xylaria subcoccophora F. San Martin & P. Lavin, p. 355
Xylaria tumulosa F. San Martin, J.D. Rogers, & P. Lavin, p. 358
501
Author Index, Volume Seventy-Nine
Athanassiou, Zacharias, & loanna Theochari. Compléments 4 l'inventaire des
Basidiomycétes de Gréce, 79: 401-415, 2001.
Azuaga, Teresa, Mercedes Barbero, & Antonio Gémez-Bolea. Additions to the
knowledge of the genus Cladonia (Cladoniaceae, lichenized Ascomycotina) in the
alpine belt of the Pyrenees in Andorra, 79: 433-446, 2001.
Baird, Gary, see Worapong & al.
Baker, William A., E. Christopher Partridge, & Gareth Morgan-Jones. Notes on
Hyphomycetes. LXXXIV. Pseudotrichoconis and Rhexodenticula, two new
monotypic genera with rhexolytically disarticulating conidial separating cells, 79: 361-
393 2001°
Barbero, Mercedes, see Azuaga & al.
Bernicchia, Annarosa, & Leif Ryvarden. A new Antrodia species (Coriolaceae,
Basidiomycetes), 79: 57-66, 2001.
Calonge, Franscisco D., see Martin & Calonge
Calonge, Francisco D., & Josep Maria Vidal. Macowanites vinaceodorus sp. nov.
(Russulales) a new gasteroid fungus from coastal dunes of Spain, 79: 1-6, 2001.
Chen, Zuo-Hong, Zhu-Liang Yang, & Zhi-Guang Zhang. Three noteworthy
Amanitae of subgenus Lepidella from China, 79: 275-284, 2001.
Clark, Jim, Steven L. Stephenson, & John C. Landolt. Biosystematics of the
Didymium iridis super species complex: additional isolates, 79: 447-454, 2001.
Currah, Randolph S., see Rice & Currah
Divakar, P. K., D. K. Upreti, G. P. Sinha, & John A. Elix. A new species of
Myelochroa and new records in the lichen family Parmeliaceae (Ascomycotina)
from Sikkim, India, 79: 247-251, 2001.
Flix, John A., see Divakar & al.
Elix, John A., & Felix Schumm. A new species and new records in the lichen family
Parmeliaceae (Ascomycotina) from the Philippines, 79: 253-260, 2001.
Ford, Eugene J., see Worapong & al.
Gaya, E., see Navarro-Rosinés & al.
Glejdura, Stanislav. Scutellinia sinensis in Europe, 79: 177-179, 2001.
Goes-Neto, Aristételes, Clarice Loguercio-Leite, & Rosa Trinidad Guerrero.
Morphological cladistic analysis of tropical Hymenochaetales (Basidiomycota), 79:
467-479, 2001.
Gomez-Bolea, Antonio, see Azuaga & al.
Goncalves, Gustavo Vernet de Costa, see Loguercio-Leite & al
Gradni, Rosely Ana Piccolo, see Gusmao & al.
Guerrero, Rosa Trinidad, see Gées-Neto & al.
Guo, Lin, see Vanky & Guo
Gusmao, Luis Fernando Pascholati, Rosely Ana Piccolo Grandi, & Adauto Ivo
Milanez. Hyphomycetes from leaf litter of Miconia cabussu in a Brazilian Atlantic
rain forest, 79: 201-213, 2001.
Hawksworth. David L. Book reviews and notices, 79: 499-?, 2001.
Hess, W. M., see Worapong & al.
502
Hjorstam, Kurt. Two new species of Brevicellicium and a survey of tropical and
subtropical species in the genus (Basidiomycotina, Aphyllophorales), 79: 181-187,
2001.
Hjorstam, Kurt, & Leif Ryvarden. Corticioid species (Basidiomycotina,
Aphyllophorales) from Colombia III, 79: 189-200, 2001.
Hladki, A. I., & A. I. Romero. The genus Kretzschmaria from Tucuman, Argentina,
79: 481-496, 2001.
Hladun, N. L., see Navarro-Rosinés & al.
Hodge, Kathie T. Online resources for fungal taxonomy & nomenclature: Web design,
79: 497-498, 2001.
Hsueh, I-Chen, Clifford M. Wetmore, & Ming-Jou Lai. A neglected calicioid lichen
new to Taiwan, 79: 215-216, 2001.
Hughes, Karen W., see Jin & al.
Jin, Jiankang, Karen W. Hughes, & Ronald H. Petersen. Phylogenetic relationships
of Panellus (Agaricales) and related species based on morphology and ribosomal
large subunit DNA sequences, 79: 7-21, 2001.
Kalb, Klaus. The lichen genus Topeliopsis in Australia and remarks on Australian
Thelotremataceae, 79: 319-328, 2001.
Lai, Ming-Jou, see Hsueh & al.
Landolt, John C., see Clark & al.
Langdon, R. F. N., see Ryley & Langdon
Lavin, Pablo, see San Martin & al.
Li, J. Y., see Worapong & al.
Lodge, D. Jean, see Miller & Lodge
Loguercio-Leite, Clarice, see Gdes-Neto & al.
Loguercio-Leite, Clarice, Gustavo Vernet de Costa Goncalves, & Leif Ryvarden.
Studies in Neotropical polypores 13. Ceriporiopsis cystidiata sp. nov., 79: 285-288,
2001.
Liicking, Robert, see Sérusiaux & Licking
Martin, Maria P., & Francisco D. Calonge. Rhizopogon buenoi (Boletales,
Basidiomycota) a new species from Spain, 79: 101-105, 2001.
Mata, Juan L, & Ronald H. Petersen. Type specimen studies in New World
Lentinula, 79: 217-229, 2001.
McCune, Bruce, & Walter Obermayer. Typification of Hypogymnia hypotrypa and
H. sinica, 79: 23-27, 2001.
Milanez, Adauto Ivo, see Gusmao & al.
Miller, Orson K., Jr., & D. Jean Lodge. New species of Amanita from the Dominican
Republic, Greater Antilles, 79: 289-306, 2001.
Morgan-Jones, Gareth, see Baker & al.
Murugan, M., & J. Muthumary. Developmental morphology and ultrastructure of
Pestalotiopsis maculans, 79: 455-465, 2001.
Muthumary, J., see Murugan & Muthumary
Navarro-Rosinés, P., E. Gaya, & N. L. Hladun. Caloplaca nashii sp. nov.
(Teloschistaceae, Lichenes), a North American species of the C. lactea-group
growing in caliche, 79: 29-41, 2001.
Obermayer, Walter, see McCune & Obermayer
503
Pant, D. C. Galiella celebica from India, 79: 315-318, 2001.
Parmasto, Erast. Hymenochaetoid fungi (Basidiomycota) of North America, 79: 107-
176, 2001.
Partridge, E. Christopher, see Baker & al.
Pei, Ke-quan, see Wang & Pei
Pennycook, S. R. An index to Batsch's Elenchus Fungorum, 1783-89, 79: 417-432,
2001.
Petersen, Ronald H., see Jin & al.
Petersen, Ronald H., see Mata & Petersen
Pfister, Donald H., see Wang & Pfister
Ramaley, Annette W. Hyaloseta nolinae, its anamorph Monocillium nolinae, and
Niesslia agavacearum, new members of the Niessliaceae, Hypocreales, from leaves
of Agavaceae, 79: 267-274, 2001.
Ramaley, Annette W. Pulvinella, a new genus with prosenchymatous propagules, 79:
51-56, 2001.
Rice, Adrianne V., & Randolph S. Currah. Physiological and morphological
variations in Oidodendron maius, 79: 383-396, 2001.
Rogers, Jack, D., see San Martin & al.
Romero, A. I., see Hladki & Romero
Rydarden, Leif, see Bernicchia & Ryvarden
Ryley, M. J., & R. F. N. Langdon. Perenosclerospora eriochloae sp. nov. and other
downy mildews on native grasses in Queensland, Australia, 79: 87-99, 2001.
Ryvarden, Leif, see Bernicchia & Ryvarden
Ryvarden, Leif, see Hjorstam & Ryvarden
Ryvarden, Leif, see Loguercio-Leite & al.
San Martin, Felipe, Pablo Lavin, & Jack D. Rogers. Some species of Xylaria
(Hymenoascomycetes, Xylariaceae) associated with oaks in Mexico, 79: 337-360,
2001.
Schumm, Felix, see Elix & Schumm
Sérusiaux, Emmanuél, & Robert Liicking. Aspidothelium gemmiferum sp. nov. from
Papua New Guinea (lichenized Ascomycetes), 79: 43-49, 2001.
Sinha, G. P., see Divakar & al.
Stephenson, Steven L., see Clark & al.
Strobel, Gary, see Worapong & al.
Theochari, Ioanna, see Athanassiou & Theochari
Upreti, D. K., see Divakar & al.
Vanky, Kalman. Doassansiopsis euryalis sp. nov. (Ustilaginomycetes), 79: 231-233,
2001.
Vanky, Kalman & Lin Guo. Ustilago deyeuxicola sp. nov. from China, 79: 261-265,
2001..
Vidal, Josep Maria, see Calonge & Vidal
Wagner, Tobias. Phylogenetic relationships of Asterodon and Asterostroma
(Basidiomycetes), two genera with asterosetae, 79: 235-246
Wang, Yei-Zeng. Discomycetes of the Sarcoscyphaceae in Taiwan, 79: 329-336, 2001.
Wang, Zheng, & Ke-quan Pei. Notes on discomycetes in Dongling Mountains
(Beijing), 79: 307-313, 2001.
504
Wang, Zheng, & Donald H. Pfister. Wenyingia, a new genus in the Pezizales
(Otideaceae), 79: 397-399, 2001.
Weir, Alex. Histeridomyces tishechkinii sp. nov., anew species of Laboulbeniales
(Ascomycetes) from New Zealand, 79: 81-86, 2001.
Wetmore, Clifford M., see Hsueh & al.
Worapong, Jeerapun, Gary Strobel, Eugene J. Ford, J. Y. Li, Gary Baird, & W.
M. Hess. Muscodor albus anam. gen. et sp. nov., an endophyte from Cinnamomum
zeylanicum, 79: 67-79, 2001.
Yang, Zhu-Liang, see Chen & al.
Zhang, Zhi-Guang, see Chen & al.
Zhuang, Wen- Ying. A list of discomycetes in China. Supplement I, 79: 375-381, 2001.
505
INDEX TO FUNGOUS AND LICHEN TAXA,
VOLUME SIXTY-NINE
This index includes names of genera, infrageneric taxa, species, and infraspecific taxa,
as well new names of suprageneric taxa. All new names are in Ca The page
number on which a new name is proposed is followed by an asterisk (*).
Acervus
flavidus 375
xishuangbannicus 375
Acrothecium
purpurella 370
Agaricus 417
abietis 421
adiposus 421
adustus 421
aethiops 421
alneus 421
alutaceus 421
amanitae 421
angulatus 421
antiquatus 421
applicatus 421
aquamarinus 421
aqueus 421
aspersus 421
asserculorum 421
atricapillus 421
atrocyaneus 421
atrosquamosus 421
atrotomentosus 421
aurantius 421
var. alpha 421
var. beta 421
var. gamma 421
aureus 421
auricomus 421
aurivellus 422
aurivenius 422
aurora 422
var. alpha 422
var. beta 422
balanus 422
barbatus 422
beryllus 422
bicolor 422
bitorquis 404
boryanus 218-220, 222-224, 226-228
buccinalis 422
bulbularis 422
caesius 422
campanella 422
candidus 419, 422
canescens 422
canobrunneus 422
cantharellus 422
carbonarius 422
var. alpha 422
var. beta 422
var. gamma 422
var. delta 422
carneolus 422
carneotomentosus 422
var. alpha 422
var. beta 422
caryophyllatus 423
castaneus 423
ceraceus 423
chamaeleo 423
chrysodon 423
chrysolithus 423
cimicarius 423
cinctus 423
cinerascens 423
cinereorimosus 423
cinereus 423
circumseptus 423
clavatus 423
clavularis 423
clavus 423
coriaceus 423
crenulatus 424
crispus 424
cristatus 419
crocatus 424
cyanophallus 424
cyprinus 424
dealbatus 424
defossus 424
delicatus 424
var. alpha 424
var. beta 424
var. gamma 424
deliciosus 424
var. alpha 424
506
[Agaricus deliciosus] var. beta 424
var. gamma 424
var. delta 424
var. epsilon 424
var. zeta 424
var. eta 424
denudatus 424
depluens 424
diffusus 424
digitalis 419, 424
digitellus 419
discors 424
dispar 424
elatus 424
essettei 404
fastibilis 419
ferruginascens 425
ferruginatus 425
ferrugineus 425
fibrillosus 425
fimbriatus 425
flammans 425
flavens 425
flavofloccosus 425
floccosus 425
flurstedtiensis 425
fragilis 425
fritillarius 419, 425
frittilarius 419
fuliginarius 425
fuliginatus 425
fulvens 420, 425
fungites 425
var. alpha 425
var. beta 425
var. gamma 425
furnus 425
var. alpha 425
var. beta 425
fuscescens 425
fuscus 425
fusiformis 425
fusus 425
geophyllus
rank? beta candidus 419
glandifer 425
glaucus 426
glutinosus
var. alpha 426
var. beta 426
var. gamma 426
granulosus 426
griseus 426
hepaticus 419, 426
var. alpha 426
var. beta 426
var. gamma.426
hispidus 426
hyacinthus 426
hypni 419, 426
hypnorum 419
ichoratus 426
imbricatus 426
imperialis 426
var. alpha 426
var. beta 426
impuber 426
incarnatus 426 |
involutus 426
ixodes 219-220, 224, 226, 228
janthinus 426
var. alpha 426
var. beta 426
var. gamma 426
jenensis 426
laceratus 427
lacrimalis 427
lacteus 427
laterinus 419, 427
lateritius 419, 427
libertatis 427
livescens 427
lividorubescens 427
luridus 427
luteolus 427
luteus 427
luxurians 427
maculatus 427
madreporeus 427
mappa 427
margaritiferus 427
var. alpha 427
var. beta 427
marginatus 427
mesentericus 427
var. alpha 427
var. beta 427
var. gamma 427
miniatus 427
mitella 427
var. alpha 427
var. beta 427
var. gamma 427
modestus 427
mollis 427
mucor 428
multifidus 428
murinus 428
mutabilis 428
narcoticus 428
nebularis 428
neptuneus 428
[Agaricus] nimbatus 428
nitens 428
niveobrunneus 428
niveoflavens 428
niveolutescens 404
nivosus 428
obesus 428
obsolescens 428
obsoletus 428
occultans 428
ochraceus 419, 428
olivaceus 428
olivascens 428
orichalceus 429
ovum 429
pallescens 429
pallor 429
pampeanus 404
papillatus 429
patella 429
pauperatus 429
pellitus 429
peltigerus 429
pileatus 429
pilosus 429
pineti 429
var. alpha 429
var. beta 429
piperatus 429
pistillaris 429
placenta 429
plicatus 429
pluteus 429
pratensis 429
pruinatus 429
pseudodeliciosus 429
pseudounctuosus 429
pterigenus
rank? beta saccharinus 419
puella 429
pullus 429
var. alpha 429
var. beta 429
var. gamma 429
purpurascens 430
pusillus 430
quercinus 430
radians 430
raphanica 222
risigallinus 430
rosellus 430
rostratus 430
rubellus 430
ruderatus 430
rudolphii 430
rufolivescens 430
var. alpha 430
var. beta 430
saccharinus 419, 430
sanguinalis 430
sanguineus 430
var. alpha 430
var. beta 430
var. gamma 430
semiglobatus 430
senescens 430
sericeus 430
serotinus 18
serpentiformis 419, 430
simulans 430
spadiceus 430
sphinx 419, 430
squamula 43 1
squamulosus 43 |
squarrosus 43 1
stellatus 431
striatellus 431
subalutaceus 43 1
subannulatus 431
subantiquatus 419, 431
subatratus 431
subcarneus 431
subcoriaceus 43 1
subcorneus 431
subcyanus 431
subferrugineus 43 1
subgracilis 431
subgranulatus 431
subhepaticus 419, 431
subinvolutus 43 1
submaculatus 431
var. alpha 431
var. beta 431
subpurpurascens 431
subsquamulosus 431
subtestaceus 419, 431
subulatus 431
subviolascens 431
succineus 43 1
sulphuratus 431
tenellus 432
testaceus 419
tintinnabulum 432
tortus 432
tremulans 432
tremulus 432
tristis 432
tubiformis 432
umbilicata 222
umbraculum 432
unctus 432
variabilis 432
507
508
[Agaricus] vellus 432 rufoferrunginea 301
velutipes SINOCITRINA 275*-276, 278
rank? beta sphinx 419 spissa 405
ventricosus 432 strangulata 405
violaceofulvens 419, 432 submembranacea 405
violaceofulvus 419 verna 282, 405
violaceus 432 vittadinii 405
virgineus 432 volvata 294
vitellinus 432 Amphisphaeria 76-78
vulneratus 432 Antrodia 57-58, 62
Agrocybe albida 63
aegerita 2 albobrunnea 65
Albotricha alpina 65
acutipila 379 crassa 64
albotestacea 375 crustulinus 65
changbaiensis 375 flavescens 65
guangxiensis 375 hippophaes 64
kurilensis 375 infirma 59, 61-62
minuta 375 juniperina 63
Amanita 275, 284, 289, 300-301, 420 lindbladii 64-65
Subg. Amanita 282, 289, 296, 300-301 macra 63
Subg. Lepidella 275, 278, 282, 289 macrospora 63
Sect. Amanita 289, 296 malicola 62
Sect. Amidella 289, 293 mellita 62, 64
Sect. Caesareae 282 primaeva 59-61, 63
Sect. Lepidella 282 pseudosinuosa 62, 65
Sect. Phalloideae 282 pulvinascens 64
Sect. Validae 278 radiculosa 64
Subsect. Amidellae 293 ramentacea 63
Subsect. Solitariae 282 SANDALIAE 57, 58*-62
aestivalis 279 serialis 61-62
asteropus 279 sinuosa 65
aureofloccosa 301 sitchensis 64
battarae 405 sordida 65
brunnescens 279 variiformis 63
var. brunnescens 278 xantha 64-65
var. pallida 278-279 Arachnopeziza
f. straminea 279 aurata 375
caesarea Arctoparmelia 247
var. alba 282 separata 249
ceciliae 405 subcentrifuga 249
CIRCINATA 294*-295, 302, 304 Armillaria
citrina 275, 278 boryana 218, 221
var. grisea 278-279 boryanus 221
f. lavendula 278-279 raphanica 217, 220-221, 224-225, 228
CRUZII 297*, 299, 301, 303, 305 umbilicata 221, 224, 228.
gymnopus 275, 282-284 Armillariella
inaurata 405 umbilicata 221
kotohiraensis 275, 279-282 Arthrobotrys 372
microlepis 282 oligospora 209
muscaria 296 Ascobolus
OCCIDENTALIS 291 *-292, 294, 302, 304 amoenus 375
ochraceobulbosa 283-284 fushanus 375
ochrophylla 283-284 Ascochyta 459, 463-464
ochrophylloides 283-284 Ascocomye
porphyria 278 cylichnium 308
[Ascocoryne] sarcoides 308
Aspergillus
roseus 420, 430
versicolor 75
Aspidothelium 43-44, 47
arachnoideum 47
cinerascens 48
fugiens 44, 46, 48
geminicarpum 47
GEMMIFERUM 43, 44*-47
mirabile 48
ornatum 47
papillicarpum 47
scutellicarpum 44, 47
trichothelioides 48
verruculosum 48
Asterina 373
Asterodon 107-108, 111-112, 118-120, 235-
236, 239, 243-244, 467-468
ferruginosus 108, 112, 114, 117, 121, 123,
125, 128-129, 235, 237, 239-244
Asterostroma 235-236, 239, 243-244, 467-468
Subg. Asterostroma 236, 244
Subg. Austroasterostroma 236, 244
Sect. Asterstroma 236, 244
Sect. Laevispora 236, 244
medium 237, 239, 241-243
ochroleucum 237, 239-243
ochrostroma 108, 128
Athelia
septentrionalis 192
Athelopsis
COLOMBIENSIS 189, 190*-191
glaucina 191
Aureoboletus
gentilis 408
Auricularia
polytricha 467, 469, 471, 475
tabacina 166, 169
Aurificaria 467-468, 474
luteo-umbrina 469, 471
Aurophora
dochmia 375
Bacidina
scutellifera 46
Balladyna 373
Basidiophora 96
butleri 96
entospora 96
kellermanii 96
Beltrania 203
africana 203
malaiensis 201-203
rhombica 209
Beltraniella
japonica 209
portoricensis 209
Beltraniopsis
miconiae 209
ramosa 209
Benua 96
kellermanii 96
Bifusella
camelliae 375
Bisporella
claroflava 379
Boedijnopeziza 330
Boletus 417
albidus 408
arcularius 421
bovinus 422
canus 422
var. alpha 422
var. beta 422
coriaceus 423
crispus 424
elvela 424
favus 425
fechtneri 408
ferruginatus 425
floribundus 425
hirsutus 426
igniarius 426
var. alpha 426
var. beta 426
var. gamma 426
var. delta 426
infundibuliformis 426
lacteus 427
var. alpha 427
var. beta 427
var. gamma 427
var. delta 427
legalliae 408
lipsiensis 427
luteocupreus 408
luteus 427
membrana 427
var. alpha 427
var. beta 427
mutabilis 428
var. alpha 428
var. beta 428
var. gamma 428
var. delta 428
var. epsilon 428
var. zeta 428
nitens 428
var. alpha 428
var. beta 428
var. gamma 428
509
510
[Boletus nitens] var. delta 428
var. epsilon 428
var. zeta crocatus 424, 428
officinalis 428
perennis 429
pseudoregius 408
radicans 408
rhodoxanthus 408
satanoides 408
splendidus 408
suaveolens 431
suberosus 43 1
var. alpha flabelliformis 425, 431
var. beta conchiformis 423, 431
subsquamosus 431
versicolor 432
var. alpha 432
var. beta 432
var. gamma 432
var. delta 432
volvatus 432
zonatus 432
var. alpha 432
var. beta 432
Bondarzewia 243-244
montana 237-238, 241-242
Botryobasidium
botryoideum 189, 192
Bovista 419
plumbea 419
Brachysporium 366
Brevicellicium 181, 185
allantosporum 182
exile 182-184
FLAVOVIRENS 181-183*, 186
mellinum 184
molle 182, 184
olivascens 182, 184
permodicum 182, 185
UDINUM 181-182, 185*-186
uncinatum 182, 187
Buellia
sequax 35
Byssoloma
album 46
gahavisukanum 43
Caeoma
hypodytes 262
Calicium
chrysocephala 215
Caloplaca 29-31, 35, 38
holocarpa 29, 38-39
lactea 29-30, 32, 35, 37-38
var. americana 29-30, 36, 38-39
lacteoides 35, 37
marmorata 35, 37
NASHI 29-3 1*, 32-37
navasiana 35
velana 35
Camposporium 366
antennatum 209
Ceraceomyces
borealis 192
simulans 192
Ceriporiopsis 285-287
balaenae 287
cerrusata 287
CYSTIDIATA 285, 286*-287
flavilutea 287
gilvescens 287
latemarginata 287
loweli 287
mucida 287
myceliosa 287
obscurus 285
resinascens 287
rivulosus 287
umbrinescens 287
Cerrenella
tabacina 132
Chaenotheca
chrysocephala 215
Chaetendophragmia 203
triangularia 201, 203
Chaetopsina
fulva 209
splendida 209
Chalara
alabamensis 209
austriaca 204
cylindrosperma 201, 203
microspora 201, 204
Cheilymenia
elaphorum 376
Cheimonophyllum 8, 17
Chlorencoelia
torta 308
Chlorociboria
aeruginascens 308
Chroodiscus 326
mirificus 46
Ciboria
batschiana 308
Circinotrichum
olivaceum 209
Cistella
geelmuydenii 376
Cladina
arbuscula
ssp. mitis 438
ssp. squarrosa 435
ee os a ee Oe oe ee ae
511
Cladosporium michelii 427
cladosporioides 209 militaris 427
oxysporum 209 ophioglossoides 428
Cladonia 433, 440, 442, 444-445 var. alpha 428
arbuscula 445 var. beta 428
ssp. arbuscula 435, 442 var. delta 428
asahinae 433, 435, 440, 442, 445
borealis 435, 442, 444-445
var. gamma 429
var. epsilon 429
cariosa 436, 442, 445 pedunculata 429
chlorophaea 436, 440, 442, 444-445 pistillaris 429
clavulifera 441 var. alpha 429
diversa 436, 442, 445 var. beta 429
ecmocyna 445 var. gamma 429
ssp. ecmocyna 436, 442 puccinia 429
fimbriata 436, 442, 444-445 resinosorum 430
furcata 437, 442, 444-445 vermicularis 432
galindezii 433-434, 437, 440, 442, 445 Clavariachaete 112, 118-120, 131, 148, 467
homosekikaica 437, 442, 445 Clitocybe
macroceras 433, 437, 441-442, 444-445 catinus 406
macrophyllodes 438, 442, 445 costata 406
mitis 438, 442, 444-445 geotropa 406
pleurota 438, 442, 445 langei 406
pocillum 438, 442, 444-445 umbilicata 406
pyxidata 433, 439, 441-442, 444-445 Coccomyces
rangiferina 439, 442, 445 circinatus 376
sobolescens 441 crateriformis 376
"sp. 1" 440, 442, 445 cyclobalanopsis 376
"sp. 2" 440-442, 445 dimorphus 376
subcariosa 433, 439, 441-442, 445 fujianensis 376
subulata 439, 442, 444-445 huangshanensis 376
symphycarpia 439, 441-442, 444-445 leptideus 376
uncialis 445 limitatus 376
ssp. biuncialis 440, 442 magnus 376
Clathrus 417 multangularis 376
adnatus 421 radiatus 376
cancellatus 422 sinensis 376
pedunculatus 429 symploci 376
| pertusus 429 Coenogonium
Clavaria 417 isidiiferum 46
atropurpurea 421 Collema
brachiata 422 leucocarpum 323
cornea 423 Colletotrichum 455
~- comu-alces 423 Collybia
comu-cervi 423 boryana 218
corticalis 423 butyracea
digitata 424 var. asema 406
fastigiata 424 extuberans 406
var. alpha 424 ixodes 219
var. beta 424 maculata 406
var. gamma 424 peronata 406
flabellaris 425 Coltricia 118, 237, 243, 467
fructiculosa 425 perennis 237, 239, 241-243, 467-468, 473
gyrans 426 Coltriciella 467
hirta 426 Cookeina 329, 331
hypoxylon 426 colensoi 334
lumbricalis 427 insititia 329, 334-335
ae,
[Cookeina] sinensis 329-331, 334-336
tricholoma 331
Coprotus
lacteus 376
marginatus 379
Corneromyces
kinabalui 189, 193
Corticium
botryoideum 192
corticolor 140
epichlorum 149
exile 181, 183, 185
galactinum 199
griseliniae 198
mellinum 184
permodicum 185
punctulatum 194
rhabarbarinum 160-161
simulans 143
Cortinarius 419
allutus 408
anomalus 408
f. lepidopus 408
argyrophilus 408
bulbosus 408
bulliardii 408
callisteus 408
calochrous 409
caninus 409
claricolor
var. subturmalis 409
var. turmalis 409
claroflavus 409
croceus 409
cumatilis 409
diabolicus 409
dibaphus
var. nemorosus 409
duracinus
var. raphanicus 409
elegantior 409
elegantissimus 409
fasciatus 409
isabellinus 419
mairei
var. juranus 409
melanotus 409
ochroleucus 419
polymorphus 409
prasinocyaneus 409
purpurascens
var. largusoides 409
riculatus 409
rufo-olivaceus 409
safranopes 409
sodagnitus 409
spadiceus 410
suillus 410
turgidus 410, 414
varius 419
venetus
var. venetus 410
violaceus 410
xanthophyllus 410
Cortinellus
bulbiger 410
Craterium 419
Crocicreas
fuscum 307-308
Curvularia
pallescens 209
Cyathus 419
olla 419
Cyclomyces 467, 475
Cylindrocladiella 373
Cylindrocladium 373
candelabrum 209
gracile 210
quinqueseptatum 210
spathulatum 210
Cystangium
pineti 4
Dactylaria 361-362, 370-372
echinophila 368, 370-372
purpurella 370, 372
Daedalea
vorax 411
Daedaleopsis
confragosa 411
Daldinia
concentrica 75-77
Dasyscyphella
dryina 376
nivea 379
Dasyscyphus
acutipilus 379
agassizii 379
apalus 379
bicolor 279
calyciformis 379
foliicola 379
fuckelii 379
niveus 379
subcorticalis
var. wulaiensis 379
Datronia
caperata 467, 469, 471, 473, 477
Dicephalospora
damingshanica 376
pinglongshanica 376
Dichochaete 107, 111, 118-120
[Dichochaete] resupinata 112
setosa 114, 116, 123, 125, 129
Dichostereum 235, 237, 239, 243-244
durum 237, 241-242
effuscatum 237, 241-242
Dictyochaeta
novae-guineensis 210
Dictyopanus 7-8, 15, 17-18
orientalis 8
pusillus 7-16, 18
var. pseudorhipidium 8
var. sublamellatus 8
Didymium 447-448, 452
bahiense 448, 452-454
canariense 454
iridis 447-449, 451-454
megalosporum 447-450-454
nigripes 448, 452-454
ovoideum 447-450, 452-454
verrucosporum 448, 452-454
Dimerella
chiodectonoides 47
Diplomitoporus 62
Diploschistes 326
muscorum 326
Discostroma
tricellular 76-78
Doassansiopsis 233
EURYALIS 231*-233
nymphaeae 233
ticonis 233
Echinoderma
carinii 406
Echinoplaca
gemmifera 46
Elvela 418
Embolus 418
crocatus 424
pertusus 429
sepulchralis 419
Encoelia 376
dalongshanica 376
Endophragmiella
boewei 201, 204-205
Entoloma
eulividum 405
lividum 405
pseudoturbidum 405
undatum 405
vernum 405
Entyloma
brefeldii 262
Epicoccum
nigrum 210
Flammula
picrea 410
Fomes 118, 243
Ser. Igniaires 118
fomentarius 237, 241-242
Fomitiporia 237, 474
punctata 237, 241-242
Fomitopsis 243
pinicola 237, 241-242
Fulvifomes 474
Fuscoporia 237, 243, 473
ferruginosa 237, 239, 241-243
Galiella 315-316, 318
celebica 315-317
rufa 315
Ganoderma
tsugae 372
Geastrum
quadrifidum
rank? gamma fenestratum 419
Geopora
perprolata 308
Gloeocystidium
ochroleucum 199
Gymnopilus
picreus 410
Gymnopus
alliaceus 221-222, 224, 228
boryanus 218
Gyrothrix
circinata 210
verticiclada 210
Hamatocanthoscypha
uncipila 376
Hebeloma 419
cistophilum 410
fastibile 410, 419
leucosarx 410
Helminthosporium
velutinum 210
Helvella 418
albella 308
atra 308
calyciformis 422
chinensis 308
crispa 308
cucullata 424
elastica 308
lacunosa 308
lilacina 427
pezizoides 308
rubiginosa 164, 166
sepulcralis 419, 430
serpentiformis 419
515
514
[Helvella] unctuosa 432
Heniscospora
coronata 201, 205
Hermatomyces 53
Hippocrepidea
nigra 43
Histeridomyces 82, 84-85
acriti 81, 84
europaeus 81, 84
flagelliferus 82, 84
ramosus 82, 84
TISHECHKINII 81-82*, 84
venezolanus 82, 84
Hohenbuehelia 8, 17, 19
atrocaerulea 406
myxotricha 406
Hoiwaya
mucida
ssp. nipponica 376
Homaromyces 81
Humaria
hemisphaerica 308
HYALOSETA 267, 269*, 271-272
NOLINAE 267-269*
Hydnellum
auratile 413
concrescens 413
zonatum 413
Hydnochaete 108-109, 111, 118-120, 236-237,
243, 467, 473, 475
duportii 237, 239, 241-242
olivacea 113, 116, 123, 125, 131
resupinata 129
setigera 128
setosa 129
tabacina 113, 116, 123, 125, 132
Hydnocystis 308
japonica 307-308
piligera 308
Hydnoporia
fuscescens 131
Hydnotrya
cubispora 376
Hydnum 417
aurantiacum 419
auriscalpium 422
carnosum 422
clandestinum 423
coralloideum 423
hystricinum 419, 426
hystrix 419
occarium 428
olivaceum 131
orbiculatum 419
pectiniforme 419, 429
resupinatum 129, 131
suberosum 431
var. alpha spongiosum 430-431
var. beta aurantiacum 419, 421, 431
var. gamma cinereum 423, 431
subsquamosum 431
var. alpha 431
var. beta 431
zonatum 432
Hygrocybe 19
citrinopallida 13, 16-17
pseudoconica
var. tristis 405
spadicea 405
tristis 405
Hygrophorus
flavodiscus 405
gliocyclus 405
latitabundus 405
limacinus 405
Hymenochaete 107-110, 118-120, 139, 147-
148, 236, 237, 243-244, 467-468, 473
agglutinans 108-109, 144-145
allantospora 117, 126, 133-134
americana 115-116, 126, 134
anomala 108, 112-113, 116, 128, 135
arida 109, 112, 141, 143
aspera 130-131
asperata 149-150, 160
australis 169
badioferruginea 109, 163, 166
borealis 109, 166, 169
burdsallii 114, 116, 124, 127, 136-137, 143
cacao 109, 113, 116, 125, 137-138
carpatica 114, 117, 121, 123-124, 128, 138-
139
cervina 114, 116, 120, 123-124, 127, 139-
141, 150, 155, 171, 173
cinnamomea 112, 115-116, 120, 137, 141,
143, 150, 154, 160-161, 170
ssp. cinnamomea 142-143
ssp. spreta 117, 123-124, 127, 136, 141,
143, 145-146, 153, 160-161, 169, 171,
173
corrugata 108, 113, 117, 119, 124, 127, 139,
141, 143-147, 152-153, 155, 157, 160,
173 j
f. conglutinans 144
corticola 140
corticolor 139, 154-155
cubensis 157-158
curtisii 114, 117, 123, 125, 127, 146, 153,
160, 166, 169
damaecornis 147
damicornis 107, 110, 115, 117, 119, 121,
123, 125, 147-148
dendroidea 150
{[Hymenochaete] epichlora 113, 116, 127, 143,
149-150, 160
episphaeria 108-109, 127, 153, 160, 172-173
escobarii 114, 117, 120, 123, 125, 150-151,
160
formosa 148
fuliginosa 108, 115, 117, 124, 128, 151-153,
155, 170-171
fulva 112, 115-116, 126, 153-154
fusca 155
imbricatula 108, 166
insularis 144, 160
jobii 114, 116, 124, 127, 139, 141, 146, 152-
155, 160, 166, 170-171, 173
leonina 113, 116, 123, 126, 155
luteobadia 113, 117, 123, 126, 138, 157-
158, 163
mollis 136
multisetae 169-170
obesa 166
opaca 108-109, 127-128, 173
pinnatifida 113, 116, 123-124, 126, 146-
147, 150-151, 153, 157-158, 160, 166
reflexa 157-158
reticulata 119
rhabarbarina 115-117, 127, 143, 160-161,
166, 173
rheicolor 108-109, 115-116, 125, 161, 163,
169
rigidula 108, 113, 116, 123, 126-127, 150,
163
rubiginosa 108, 114, 116, 124, 126, 155,
160, 164, 166, 169, 237, 239, 241-242
sallei 108, 161, 469, 471, 473-475, 477
semistupposa 153
simulans 141, 143
spreta 108-109, 143, 160, 171
subfuliginosa 152, 155
tabacina 108, 112, 115-116, 123-124, 126,
134, 147, 157, 163, 166, 169
tenuis 108-109, 113, 116, 124, 128, 153,
169-170, 173
tenuissima 163
ungulata 109, 154-155
unicolor 113, 117, 127, 140-141, 143, 155,
170-171
vaginata 135
villosa 138, 163
yasudai 136
Hymenochaetella
arida 141
Hymenoscyphus
ADLASIOPODIUM 307, 308*-3 10
ericae 395
fructigenus 307, 310
lasiopodium 308, 310
lutescens 376
repandus 310
sp. "#1" 376
sp. "#2" 376
Hyphoderma
brunneocontextum 189, 193-194
variolosum 193-194
Hyphodontia 199
alutaria 199
gamundiae 194
griselinae 198
wrightii 194
Hypochnicium
punctulatum 194
Hypogymnia 23-24, 27, 253
FLAVIDA 23, 24*-26
hypotrypa 23-24, 26
hypotrypella 23-24, 26
pseudohypotrypa 23-24, 26-27
pseudophysodes 27
sinica 23, 25-27
zeylanica 257
Hypomyces
chrysostomus 150
Hypotrachyna 247, 253
comeola 255
imbricatula 256
majoris 250
physcioides 256
radiculata 250
reducens 256
Hypoxylon
fragiforme 75-77
magnosporum 490
pavimentosum 491
sandvicense 493-494
Idriella 207
Inocutis 237
rheades 237, 241-242
Inocybe
adaequata 410
asterospora 410
friesii 410
hirtella 410
jurana 410
nitidiuscula 410
phaeoleuca 410
pudica 410
Inonotopsis 237, 243
subiculosa 237, 239, 241-243
Inonotus 118, 237, 243, 467, 473
hispidus 237, 241-242
rheades 237
subiculosus 237
triqueter 237
515
516
Irenopsis 373 sp. "#2" 377
Irpex subpygmaem 377
cinnamomeus 131 taiwanense 377
tabacinus 132 eillisii 377
Lactarius 420
Jafnea blennius
fusicarpa 310 f. viridis 411
blumii 411
Karschia camphoratus 411
stygia 309-310 cilicioides 411
Kretzschmaria 481-482, 487, 491 cimicarius 411
ARGENTINENSIS 481-483*, 484, 492 fuliginosus 411
clavus 481-487, 490, 492 helvus 75
coenopus 487 intermedius 411
curvirima 494-495 luridus 411
deusta 481-482, 487-488, 490, 492, 494 pubescens 411, 414
divergens 486 salmonicolor 411
micropus 483 semisanguifluus 412
pavimentosa 481-482, 488, 490-492 sphagneti 412
puiggarii 486 tesquorum 412
pusilla 486 uvidus 412
sandvicensis 481-482, 487-488, 490, 492- vinosus 412
493 Lambertella
SIGMOIDIRIMA 481-482, 484, 492, 494*- caudatoides 377
495 Lanzia
tessulata 494 guangxiensis 377
zonata 490 sinensis 377
Lasiobelonium
Laboulbenia 81 guangxiense 377
Lachnellula ningxiaense 377
agassizii 379 Lasiodiplodia
calyciformis 379 theobromae 373
fuckelii 379 Lecania
Lachnocladium 236 turicensis 36
Lachnum Lecanora
albidulum 376 crenulata 36
apalum 379 Leccinum
var. beatonii 376 crocipodium 408
bicolor 379 nigrescens 408
brevipilosum 376 tesselatum 408
caricis 310 Lentinellus
carneolum 376 omphalodes 19
cylindricum 376 ursinus 19
euterpes 377 Lentinula 217, 219, 221, 223, 227
foliicola 379 boryana 217-219, 221, 223, 225, 227-228
granulatum 376 cubensis 222-223
legalii 376 detonsa 223, 225
lunatum 377 guarapiensis 217
nudipes 310 RAPHANICA 228*
var. minor 377 Lentinus 19
oncospermatum 377 boryanus 218
palmae 377 cubensis 222, 224, 226, 228
pteridophyllum 377 detonsus 223, 225, 227-228
salicariae 377 ixodes 219
sclerotii 379 leprieurii 226
sp. "#1" 377 proximus 225-228
[Lentinus] puiggarii 226-228
Lenzitella
malenconii 58
Lenzites
warnieri 41 1
Leotia
lubrica 310
Lepiota
brunneoincarnata 404
clypeolaria 404
grangei 404
ignivolvata 404
Lepiotula
grangei 404
Lepista
densifolia 406
sordida
var. lilacea 406
Leptosphaeria
salvinii 361-362
Leptosporomyces
septentrionalis 192
Leptotrema 319, 325-326
heterosporum 325
mastoideum 325
santense 325
zollingeri 326
Letrouitia 320
Leucoagaricus
melanotrichus 404
Leucocortinarius
bulbiger 410
Lichenochora 36
epinashi 36
Lophodermium
dicranopteris 377
Lycoperdon 417
admorsum 421
arrhizon 419, 421
arrhizum 419
boletiforme 422
bombacinum 422
capitatum 422
carpobolus 423
cepiforme 423
cervinum 423
chal ybeum 423
cinereum 423
circumscissum 423
var. alpha 423
var. beta 423
var. gamma 423
var. delta 423
complanatum 423
corollinum 423
corticale 423
defossum 424
dispar 424
echinus 424
favogineum 425
fenestratum 425
var. alpha 425
var. beta 419, 425
var. beta et gamma 425
var. gamma 425
furfuraceum 419, 425
geaster 425
gemmatum 425
giganteum 419, 425
hirtum 426
lacerum 427
lanatum 427
lumbricale 427
luteum 427
multifidum 428
muricatum 428
palmatum 419
palmiforme 419, 429
pedicellatum 429
pedunculatum 429
pineum 429
polyrhizon 419, 429
polyrhizum 419
pusillum 419, 430
pyriforme 430
radiatum 430
stellatum 431
var. alpha 431
var. beta 431
truncatum 432
tuber 432
verrucosum 432
versiculosum 432
vesparium 432
Lyophyllum
leucophaeatum 406
transforme 406
trigonosporum 406
Macowanites 1, 4
agaricinus |
americanus 1, 4-5
ammophilus 1
krjukowensis 1
lymanensis 4
messapicoides |
mexicanus 4
olidus 1, 4
VINACEODORJUS 1, 2*-4
Macrocystidia
cucumis 406
514
518
Macrolepiota
fuliginosa 404
rickenii 405
Marasmius
Subg. Pleurotopsis 18
cohaerens 406
Melanoleuca
brevipes 406
decembris 406
evenosa 406
iris 406
meridionalis 406
pseudolucina 406
subpulverulenta 407
Meliola 373
Memnoniella
echinata 210
Menisporopsis
pirozynskii 201, 205-206
pleiosetosa 206
theobromae 210
Microglossum
viride 377
Microstoma 329
floccosum 310, 329, 332, 334-335
MINOSTROSCYTA 189, 194*, 197
DISCOIDALIS 189, 194*-195
Molliardiomyces
coccinea 334
domingensis 332-333
occidentalis 334
Mollisia
caesia 307, 310
cinerea 310
Monocillium 271-272
bulbillosum 271
constrictum 271
granulatum 271
indicum 271
NOLINAE 267-270*, 271
Morchella 419
Mucor 417
ater 421
cancellatus 422
furfuraceus 425
glaucus 426
mucedo 428
sphaerocephalus 430
virens 432
Musaespora
coccinea 43
MUSCODOR 71*-72
ALBUS 67, 71*-78
Mutatoderma 189, 193
brunneocontextum 189, 193
heterocystidium 193
mutatum 193
populneum 193
Mycena 15, 19
chlorinella 407
clavicularis 7, 13, 15-16
diosma 407, 414
epipterygia
var. pelliculosa 407
flavipes 407
galericulata 13, 16
leptocephala 407
luteoalcalina 407
pelliculosa 407
pura
f. alba 407
renati 407
rutilanthiformis 7, 13, 15-16
zephirus 407
Mycosphaerella 53
Myelochroa 247-248
coreana 247
crenulata 247-248
immiscens 247
lindmanii 247
nothofagi 247
salazinica 247
siamea 247
SIKKIMENSIS 247, 248*-249
sinica 247-248
xantholepis 248
Myriotrema 319, 325-326
parvidiscum 46
wightii 326
Myxotrichum 383, 395
Nakataea 361-362, 366
curvularioides 362
cylindrospora 361-363, 366
fusispora 362
rarissima 362
serpens 362
sigmoidea 361, 366
Neococcomyces 377
rhododendri 377
Neolentiporus
squamosellus 58
Nidularia
campanulata 419
Niesslia 271-273
AGAVACEARUM 267, 272*-274
coloradensis 273
erysiphoides 274
exigua 271, 273
exilis 273
exosporioides 271, 273-274
lanea 274
[Niesslia] palmicola 271, 274
pulchriseta 274
Nigrospora
sphaerica 210
Ocellularia 325-326
cavata 326
Ochroconis 361, 367, 371
constricta 371
Octospora
humosa 307, 310
yunnanica 377
Odontia
olivascens 184
Oidiodendron 384
griseum 384
maius 383-385, 390-391, 394-395
tenuissimum 384
truncatum 394
Oligoporus
rancidus 60
Onnia 118, 237
triquetra 237, 239, 241-242
Opegrapha 36
rupestris 36
Orbilia
delicatula 307, 309-3 10, 377
luteorubella 307, 311
satraziniana 377
Otidea 398
Oudemansiella
melanotricha 407
Pachyella
babingtonii 377
Panaeolus
acuminatus 405
caliginosus 405
Panellus 7-8, 17-19
Subg. Mitellus 8, 18
Subg. Panellus 8
Subg. Serotinae 8
cantharelloides 7
_copelandii 8
dealbatus 7
eugrammus 7
farinaceous 7
flabellatus 7
haematopus 7
jalapensis 7
longinquus 7-12, 14-18
mitis 7-12, 14-19
orientalis 8
patellaris 7-12, 14-18
pusillus 8
ringens 7-12, 14-19
serotinus 7-12, 14-18
stypticus 7-18 :
subcantharelloides 7
ursinus 7
violaceofulvus 7-12, 14-20
vulpinus 7
Panus 8, 17, 19
leprieurii 226-228
operculatus 18
Parachnopeziza
bambusae 377
guangxiensis 377
sinensis 377
variabilis 377
Parasympodiella
laxa 210
Parmelia
hypotrypa 23-24
f. balteata 26
hypotrypella 23
pseudohypotrypa 26-27
Parmelina 247
Parmotrema 247, 253
cooperi 257
dilatatum 257
lobulascens 254, 257
NEGROSORIENTALUM 253*-255
permutatum 258
rampoddense 253-254, 258
sancti-angelii 258
Paxillus 19
Peniophora 137
Penzigia
macrospora 349
Periconia
byssoides 210
Peronosclerospora 88-89, 91-92
ERIOCHLOAE 87-89%, 90-91
globosa 88-89
heteropogoni 96
maydis 87-88, 95
miscanthi 95
noblei 87-88, 92-94, 97
philippinensis 94-95
sacchari 87-88, 94
sorghi 87, 94-95
Perrotia
hongkongensis 377
nanjenshana 377
pilifera 378
yunnanensis 378
Pestalosphaeria
hansenii 76-78
Pestalotiopsis 459, 461-464
maculans 455, 457, 461-463
ag he
520
Pezicula
cinnamomea 378
rubi 378
Peziza 311, 378, 417
amenti 421
annularis 421
antiquata 421
auricula 422
bolaris 422
brunnea 422
callosa 422
calyculus 422
var. alpha 422
var. beta 422
var. gamma 422
rank? beta infundibulum 419
carpini 422
cemua
rank? beta 419
cinerea 423
citrina 423
cochleata 423
var. alpha 423
var. beta 423
var. gamma 423
comitialis 423
convivalis 419, 423
coronata 423
crater 424
crucibulum 424
cupressi 419, 424
cupressina 419
cupula 424
cyathoidea
rank? beta convivalis 419
diadema 424
dubia 424
eruciformis 424
floccosa 425
grisea 426
guizhouensis 378
hepatica 426
hians 426
hirsuta 426
hirudo 426
infundibuliformis 426
infundibulum 419, 426
jenensis 426
leporina 427
michelii 311
miniata 427
minutissima 427
nivea 428
nutans 419, 428
var. alpha 428
var. beta 428
rank? beta 419
olivacea 428
olla 419, 428
var. alpha 428
var. beta 428
pineti 429
porphyrea 429
pseudoviolacea 307, 311
punicea 429
pyxis 430
sceptrum 430
schenkii 430
scutellata 430
var. alpha 430
var. beta 430
var. gamma 430
var. delta 430
seminulum 430
sepulcralis 430
shearii 378
sigillatoria 430
spadicea 430
subumbrina 311
sulphurea 43 1
tenella 432
tuba 419, 432
tubaeformis 419
urinophila 378
virginea 432
Pezoloma
ciliifera 378
Phaeohelotium
subcarneum 378
Phaeoisaria
clematidis 210
Phallus 417
acaulis 42]
acuminatus 421
anastomosis 421
brunneus 422
costatus 423
var. alpha 423
var. beta 424
var. gamma 424
fungoides 419, 425
gigas 419, 425
lobatus 419
rete 430
undosus 419, 432
volvatus 432
Phellinidium 237, 243
ferrugineofuscum 238-239, 241-243
Phellinus 118-119, 237, 243, 467-468, 473-
474, 477
apiahynus 469, 471, 474
extensus 469, 471, 474
[Phellinus] ferreus 473
ferrugineofuscus 238
ferruginosus 237
gilvus 469, 471, 473-474
grenadensis 469, 471
igniarius 238, 241-242
juniperinus 58
lundellii 411
melleoporus 469, 471
membranaceus 469, 471
nigrolimitatus 238
palmicola 469, 471, 473-474, 477
pini 238
punctatus 237
ribis 238
rimosus 469, 471, 474
robustus 474
rosmarini 58
torulosus 473
vorax 411
Phellopilus 237, 243
nigrolimitatus 238-239, 241-243
Phialina
damingshanica 378
Phialocephala
fortinii 395
Phillipsia 329
domingensis 329, 332-333, 335
hartmannii 378
umbilicata 378
Phylloblastia
dolichospora 46
Phyllocratera
papuana 43
Phyllophiale 46
Phylloporia 118, 237, 467-468, 474
pectinata 469, 471
ribis 238-239, 241-242
Phylloporina
macrospora 46
Phylloporus 19
Phyllosticta
caryota 463
Piptarthron 53
Pisolithus
arhizus 413
tinctorius 413
Pithomyces
chartarum 210
Pithyella
erythrostigma 378
Platismatia 253
regenerans 259
Plectania
rhytidia 378
nannfeldtii 378
521
Pleurocybella 8, 17
Pleurotopsis 7, 18
longinqua 13, 18-19
longinquus 15
spodoleucus 18
Pleurotus 8, 17, 19
albidus 19
corticatus 411
djamor 19
dryinus 411
tephrotrichus 41 1
Polycoccum
opulentum 36
Polydesmia
pteridoicola 378
recta 378
Polyporus
melanopus 411
Porina 46
Porodaedalea 237
pini 238-239, 241-242
Poronia 78
punctata 75-77
Proliferodiscus
inspersus
var. inspersus 278
Protogenea 308
japonica 308
Protomyces
inouyei 71, 76-77
Psalliota
abruptibulba 404
Pseudoomphalina
clusiliformis 407
PSEUDOTRICHOCONIS 361, 367*
ECHINOPHILA 367, 368*-369, 371-373
Psilopezia
dabaensis 311
deligata 307, 311
nummularialis 311
Pterula 112
Pulveroboletus
cramesinus 408
PULVINELLA 51, 52*-53, 55-56
NOLINAE 52*, 54-55
Pulvinula
laeterubra 311
militina 307, 311
Pyricularia 366
fusispora 210
Pyrrhoderma 467
Radulomyces 198
confluens 198
SUBSIGMOIDEUS 189, 196-197*
Ramaria 112
ee
[Ramaria] flaccida 410
gracilis 410
largentii 410
REIMNITZIA 319, 325*-326
SANTENSIS 319, 325*-327
Resinomycena 19
acadiensis 7, 13, 15-16
Resupinatus 8, 17
RHEXODENTICULA 361, 363*, 367
CYLINDROSPORA 363*, 365
Rhinocladiella
aquaspersa 206
selenoides 201, 206
Rhipidiomyces 81
Rhizopogon 101
Subsect. Fulviglebae 105
abietus 105
aromaticus 102, 104-105
BUENOI 101, 102*-105
corsicus 105
luteolus 105
ochraceorubens 105
subalpinus 105
verii 105
vinicolor 105
Rimelia 253
austrocetrata 259
Rinodina
bischoffii 36
Rogersella 199
asperula 198
griseliniae 198-199
Rosellinia 78
necatrix 75-77
Russula 2, 4, 243-244
adulterina 412
amethystina 412
amoena 412
amoenolens 412
atropurpurea 412
azurea 412
badia 412
cessans 4
cicatricata
var. fusca 412
cyanoxantha
var. peltereaui 412
densifolia 412
fageticola 412
faginea 412
farinipes 412
graveolens 412
illota 412
insignis 412
krombholzii 412
langei 412
livescens 412
luteotacta 412
mairei
var. fageticola 412
melliolens 413
mustelina 413
nana 413
nauseosa 413
obscura 413
persicina 413
pseudointegra 413
puellaris 413
risigallina 413
f. luteorosella 413
romellii 413
sphagnophila 413
vesca 413
f. viridata 413
vinosa 413
violacea 237-238, 241-242
violeipes
f. citrina 413
viscida 413
Sagenidiopsis
merrotsii 47
Sarcodon
amarescens 413
glaucopus 413
martioflavus 414
Sarcomyxa 7, 18
serotina 18
Sarcoscypha 329
coccinea 334
humberiana 329, 334-335
mesocyatha 378
occidentalis 334
f. occidentalis 335
shennongjiana 378
vassiljevae 312, 335
Sarcoma 315
globosum 315
Schiffnerula 373
Scleroderma
meridionale 413
Sclerophthora 88
macrospora 87-89, 96
Sclerospora 88, 96
butleri 96
graminocola 92, 94
iseilematis 96
noblei 87, 92-93
secalina 89
Scolecobasidium 361-362, 367, 371
echinophilum 368
longiphorum 366
:
:
Scutellinia 313
cejpii 378
shiangmaiensis 378
citrina 179
colensoi 312
crinita 312
jilinensis 278
jungneri 378
kerguelensis 312
paludicola 179
phymatodeus 378
sinensis 177-178
sinosetosa 378
subhirtella 312
superba 378
Scytinostroma 197
galactinum 199
neogalactinum 199
ochroleucum 199
Secotium
krjukovensis 1
Selenodriella 207
perramosa 201, 206-207
Selenosporella 207
curvispora 201, 207
Sericeomyces
subvolvatus 405
Sistotrema
fuscescens 131
olivaceum 131-132
Skeletocutis
lenis 62, 66
Smardaea
microspora 312
protea 312
Soleella
chinensis 378
Sowerbyella
fagicola 312
Speiropsis
scopiformis 201, 207
Sphaeria 418
acinosa 419, 421
_bombarda 422
clavus 485
coryli 423
deusta 487
globularis 426
hirsuta
rank? beta acinosa 419
spiculosa 430
tentaculata 432
Sporopodiopsis
mortimeriana 43
Stachybotrys
atra 210
ae)
Stemonitis 418
ferruginosa 425
Stereum
badioferrugineum 166
cacao 137-138
curtisii 146-147
damicorne 147
laetum 157
pulchrum 157
rheicolor 161, 163
Stictis
stellata 378
Stilbella
aciculosa 210
Stipitochaete 119, 467, 473
damicornis 147
Strossmayeria
bakeriana 378
Subicularium 53
Subulispora
longirostrata 201, 208
procurvata 210
Tania
lanosa 47
Taphrina
deformans 71, 76-77
pruni-subcordatae 71, 76-77
wiesneri 71, 76-77
Tapinella 19
Tarzetta 397-398
catinus 312
Tectella 7-8, 17-18
operculatus 18
patellaris 18-19
Thelenella 44
Thelephora 108
cinnamomea 141
corrugata 144
episphaeria 172
fuliginosa 151
galactina 199
imbricatula 166
luteobadia 157
setosa 129, 131
Thelopsis
byssoidea 47
Theloschistes 32
Thelotrema 319, 325-326, 328
gibbosum 327
heterosporum 319, 325
lepadinum 326, 328
muscigena 322
nostalgicum 319, 327
obturatum 326
pachystomum 327
524
[Thelotrema pachystomum] ssp. piluliferum
327
piluliferum 319, 327
santense 319, 325
vernicosum 319, 327
Thozetella
cristata 210
cubensis 211
Tibellia
dimerelloides 47
Tilletia
calamagrostidis 262
deyeuxiae 261-262, 264
inolens 261, 264
Tomentella
crinalis 129
Topeliopsis 320-321, 325, 328
ACUTISPORA 319, 320*-321, 323, 325
CORTICOLA 319-320, 322*, 324-325
muscicola 319-320, 322-325
MUSCIGENA 319, 322*, 325
VEZDAE 319, 321, 323*-325
Torrendiella
guangxiensis 378
Trametes
multicolor 411
ochracea 411
rubescens 41 1
zonatella 411
Trechispora 182, 184
Tremella
foliacea 237-239, 241-242
Trichaptum 468, 473
byssogenum 467-469, 471, 473
Trichoconis 362, 366, 372-373
caudata 373
echinophila 361-362, 368
Trichoderma
harzianum 387
Tricholoma
album 407
bufonium 407
focale 407
fucatum
var. subglobisporum 407
myomyces 407
pardalotum 407
pardinum 407, 414
pessundatum 407
pseudoalbum 407
pseudonictitans 407
saponaceum
var. ardosiacum 407
var. squaamosum 407
sejunctum
var. coniferarum 407
sulphureum
var. coronarium 408
tigrinum 407
Trichophaea 312-313
bullata 312
DONGLINGENSIS 307, 312*
pallidibrunnea 3 13
pseudogregaria 378
woolhopeia 313
Tripospermum
myrti 211
Triramulispora
gracilis 201, 208
Tuber
liui 378
olibospermum 378
taiyuanense 309, 312
xizangense 378
Uncobasidium 198
luteolum 198
Unguiculariopsis
changbaiensis 378
damingshanica 378
Urceolella
crispula 379
Uredo
striiformis 262
Urocystis
calamagrostidis 262, 264
Ustilago
calamagrostidis 262, 264
davisii 265
deyeuxiae 261, 264
DEYEUXICOLA 261, 262*-265
hypodytes 262, 264
scrobiculata 261-262, 264
striiformis 262, 264
Ustilentyloma
brefeldii 262, 264
Ustulina 481
deusta 489-491
linearis 490
vulgaris 489-490
zonata 489, 491, 493-494
Vararia 131, 235-237, 239, 243-244
gallica 238, 241-243
ochroleuca 238, 241-243
Velutarina
rufo-olivacea 379
Verdipulvinus 51, 53, 56
Verrucaria 36
calciseda 36
macrostoma
f. furfuracea 36
Volutella
minima 211
WENYINGIA 397*-398
SICHUANENSIS 397*-399
Wiesneriomyces
laurinus 211
Xerocomus
leonis 408
Xylaria 67, 72, 76-78, 337-338, 340, 349, 485
adscendens 339-340
ALBISQUAMULA 337, 339, 340*-341
apiculata 340, 342, 345
arbuscula 67, 75, 342, 344-345, 358
var. plenofissura 344
australis 341
carpophila 75-77
chordaeformis 359
coccophora 357-358
corniculata 352
comu-damae 75
cubensis 339, 341, 353
curta 76-77
DURANII 337-338, 342*-343
hypoxylon 75-77, 339, 347, 353-355
juniperus
var. asperula 338, 344-345
D295
juruensis 344
laevis 353
longiana 339-340, 346-347, 355-356
longipes 67, 75
luxurians 359
magnoliae 339, 347-348
mali 67, 75
MICHOACANA 337-338, 348*, 350
moelleroclavus 352
multiplex 340
nigrescens 353
pallida 341
platypoda 352
polymorpha 75-77
QUERCINOPHILA 337-338, 349*, 351-
352
scopiformis 340
scruposa 338, 352
SUBCOCCOPHORA 337, 339, 355*, 357-
358
trichopoda 342-343
tuberoides 341
TUMULOSA 337, 339, 358*-359
Zygosporium
echinosporum 201, 208
S27
ERRATA
VOLUME SEVENTY-FOUR
Page 121, line 20, and
page 128, last line for balanae read balaenae
VOLUME SEVENTY-EIGHT
Cover page 2, line 5 for reophylla read rheophyllus
Page iv, line 1 for reophylla read rheophyllus
Page 185, line 23 for Bat. And Farr read Bat. and Farr
Page 185, line 25 for types and D. australiense read _ types, and D. australiense
Page 185, line 26 for Bat. D. gauntii read Bat., D. gauntii
Page 185, line 27 for Hughes, D. subramaniani read Hughes, and D. subramaniani
Page 185, line 30 for have not a sporodochial read lack a sporodochial
Page 186, line 44 for conidium is read conidia are
Page 186, line 45 for similar with read similar to
Page 187, line 1 for conidia read conidial
Page 187, line 3 for also its read also conidial
Page 187, line 5 for Detail read Details
Page 187, line 6 for Condium read Conidia
Page 188, line 2 for Detail of the conidium read Details of conidia
Page 259, line 2 for reophylla read rheophyllus
Page 262, line 6 for reophylla read rheophyllus
Page 354, line 26 for Klotczh read Klotzsch
528
VOLUME SEVENTY-NINE
Page 76, line 6, page 77, line 6, and
page 78, line 6
Page 96, line 19
Page 177, line 11
Page 206, line 40
Page 207, line 25
Page 208, line 15
Page 211, line 16
Page 308, line 5
Page 310, line 17
Page 310, line 26
Page 311, line 34
Page 319, lines 1, 10
Page 340-358
Page 340-358
for
for
for
for
for
for
for
for
for
for
for
for
for
for
[Discostroma] tricellular read_tricellulare
Scleropsora read Sclerospora
amonia read ammonia
restrict read restricted
collected few times in the neotropical
read collected a few times in neotropical
taxon to the read taxon in the
the suggests read his suggestions
Dxion read Dixon
CAUDATAS read CAUDATUS
discomycetes read discomycete
ascospores's read ascospore
[Thelotrema] heterospora read heterosporum
San Martin read F. San Martin
Lavin read P. Lavin
Page 439, line 35, page 441, line 20, page 442, line 20, page 444, line 18, and
page 445, line 5
Page 469, line 21
Page 471, line 15
Page 495, line 8
for
for
for
for
[Cladonia] symphicarpia read symphicarpa
[Phellinus] apihaymus __ read apiahynus
Phelinus read Phellinus
[K.] sigmoidrima read sigmoidirima
a29
Reviewers, Volume Seventy-Nine
The Editors express their appreciation to the following individuals who have, prior to
acceptance for publication, reviewed one or more of the papers appearing in this volume.
T. Ahti
A. W. Archer
I. Barash
T. Baroni
R. Bendt
B. J. Coppins
R. Courtecuise
J. L. Crane
C. R. Cripps
P. Diederich
R. Duran
T. L. Esslinger
A. Frisch
J. Ginns
R. D. Goos
ies)
. F. Haskins
. Hennebert
. T. Hodge
. Heiland
SP Rott
. Lizon
G. Moreno
VTAKRAQA
O. K. Miller, jr.
T. Niemela
I. Pascoe
S. Perotto
G. S. Ridley
P. Roberts
J. D. Rogers
A. Y. Rossman
L. Ryvarden
G. J. Samuels
F. San Martin
K. A. Seifert
R. G. Shivas
B. Spooner
S. Tchabanenko
L. Tibell
S. Tokumasu
R. E. Tullos
R. Watling
C. Wetmoore
A. J. S. Whalley
W.-Y. Zhuang
Publication Date for Volume Seventy-Eight
MYCOTAXON for April-June 2001, volume 78: 1-540,
was issued on June 4, 2001.
MYCOTAXON is published quarterly during the periods of January-March, April—June, July—
September, and October-December by Mycotaxon, Ltd., 316 Richard Pl., Ithaca, NY 14850-
3129. Periodical postage paid at Ithaca, NY, and at additional mailing offices. Subscription rates:
In U.S. and possessions, one year, $268.00; reduced rate for personal subscribers, one year,
$128.00. Foreign subscriptions, add $8 for surface mail, or add $40 for ISAL air mail.
POSTMASTER: Send address changes to Mycotaxon, Ltd., P.O. Box 264, Ithaca, NY 14851-0264.
MYCOTAXON offers some of our recent Books
prices include surface mail shipment (for more books see www.mycotaxon.com/books.html)
Mycotaxon, Ltd., P. O. Box 264, Ithaca, NY 14851-0264, U.S.A.
Fungi of China, by S. C. Teng. Mycotaxon, Ltd. 1996. Hardbound, xiv + 586 pp., 426 illustrations, map,
portrait, index, 8-1/2x11 inches. $79.00. Airmail price varies by country: enquire. ISBN 0-930845-05-6.
Special for Mycotaxon subscribers: deduct 20% from regular price
Edited by Richard P. Korf, with a foreword by Teng's daughter, Rosaline Z. Deng.
Proceeds from sales go to the Teng family.
What reviewers have to say about Teng's Fungi of China
“.. one of the most valuable books on the fungi of China ever published in English.”
Mycologia 90: 1091-1092, 1998.
“_.. a great big blue uncompromising brick of a book ... an instant classic. Anyone interested in identification
of fungi, particularly in Asia, should get this book immediately. Mycology owes another debt to Dick Korf for his
sympathetic and intelligent editing of this superb work.” Bibliography of Systematic Mycology 10(6): xlviii-xlix. 1998.
“The publication of Teng's work now gives taxonomists easy access to the contributions of this remarkable
scientist without having to undertake a fastidious searching in libraries.” Sydowia 48: 277-278. 1997.
“The book is important for any researcher interested in the systematic relationships, diversity,
and distribution of fungi on a global scale.” - New Zealand Journal of Botany. 35: 265-266. 1977.
“An extensive index to all taxa ... makes this book readily accessible to the user. It should be present
in every public and private mycological library.” - Persoonia 16: 424. 1997.
The mycological flora of the Ficuzza Wood - Rocca Busambra Territory (North Sicily, Italy), by G.
Venturella, A. Saitta, S. La Rocca, & S. Onofri. Mycotaxon, Ltd. 2001. Softbound, 68 pp., illustrated, 21
x 29.7 cm. US$30, or 66,000 Italian Lira, or 35 Euro. (Please order direct from Societa Editrice ISPE
Archimede s.r.1., Via Domenico Trentacoste 34, 90100 Palermo, Italy, email:
ispearchimede@katamail.com, tel. +39091302039, fax +39091304551.) ISBN 0-930854-11-0.
The Ficuzza Wood - Rocca Busambra Natural Reserve is considered one of the most interesting areas in
Sicily. 669 Basidiomycetes and 72 Ascomycetes are listed together with their habitat, substrate,
fructification period, cartogarphic reference, and status.
A check-list of the mycological flora of Madonie Park (North Sicily), edited by Giusseppe Venturella,
Alessandro Saitta, & Salvatore La Rocca. Mycotaxon, Ltd. 2000. Softbound, 246 pp., illustrated, 16.5 x 23.54 cm,
80,000 Italian Lira. (Please order direct from Ente Parco della Madonie, Via Paolo Agliata 16, 90027 Petralia —
Scottana (Palermo), Italy, email: epm@abies.it, tel. +39 0921 68401, fax: +39 0921 680478. ISBN 0-930845-10-2.
This is a detailed report with full collection details on 614 specific and infraspecific taxa of macrofungi
(Ascomycetes and Basidiomycetes) within the Madonie Park area, each provided with substrates,
a distribution map within the Park, and a graph of the months in which collections have been recorded.
Mycotaxon Cumulative Index for Volumes XLI-LX (1991-1996), by Karen D. Gettelman, Richard P. |
Korf, Susan C. Gruff, and Ian F. Korf. Mycotaxon, Ltd. 1998. Softbound, 296 pp., 6x9 inches. $35.00. Airmail, |
$55.00. ISBN 0-930845-07-2.
Mycotaxon Cumulative Index for Volumes XXI-XL (1984-1991), by Richard P. Korf and Susan C.
Gruff. Mycotaxon, Ltd. 1991. Softbound, 352 pp., 6x9 inches. $30.00. Airmail, $50.00. ISBN 0-930845-01-3.
Mycotaxon Cumulative Index for Volumes I-XX (1974-1984), by Richard P. Korf and Susan C. Groff.
Mycotaxon, Ltd. 1984. Softbound, 232 pp., 6x9 inches. $17.50. Airmail, $37.50. ISBN 0-930845-00-5.
A Monograph of the Fungus Genus Cercospora, by Charles Chupp. Published by the author, Ithaca. 1953. |
Hardbound, 667 pp. 222 illustrations, octavo, $25.00. Aitmail, $45.00
Still a clasic after nearly a half century.
=
ee
[Contents continued from the back of front cover]
| Online resources for fungal taxonomy & nomenclature: Web design
Kathie T. Hodge 497
| Nomenclatural novelties proposed in volume 79 499
| Author index 501
| Index to fungous and lichen taxa 505
| Errata 527
| Reviewers ee
Publication date for volume 78 529
EDITORS OF MYCOTAZXON
Pavel Lizon
EDITOR-IN-CHIEF
Department of Cryptogams
Institute of Botany
Dubravska 14, SK-842 23 Bratislava, Slovakia
David L. Hawksworth Karen D. Gettelman Grégoire L. Hennebert
BOOK REVIEW EDITOR INDEX EDITOR FRENCH LANGUAGE EDITOR
114 Finchley Lane, Hendon 7044 Amherst Avenue 32 Rue de I'Elevage
London NW4 1DG St. Louis, MO 63130 B-1340 Ottignies - LLN
United Kingdom U.S. A, Belgium
MYCOTAXON is a quarterly peer-reviewed journal devoted to all phases of mycological taxonomy and nomen=
clature. All articles are reviewed by specialists prior to acceptance. Publication is open to all persons. Papers may bey)
in English or in French, Summaries in those or any additional languages desired by the authors are given for longer
articles. Printing is on high quality, acid-free book paper. Authors prepare their own camera-ready copy after
having received critical comments from pre-submission reviewers. Instructions to Authors appeared in Mycotaxom)
77; 535-540, 2001 updated on out website at <www.mycotaxon.com/instructions.html>, and Guidelines for)
Reviewers appeared in Mycotaxon 78: 539-540, 2001, updated on our website at <www.mycotaxon.com/
reviewers.html>, |
.
SUBSCRIPTION INFORMATION .
|
we
|
Current volumes contain at least 512 pages. All subscriptions are on an annual basis, with four quarterly issues each |
year. Personal subscriptions are available at a substantially reduced rate for individuals who agree not to deposit-
their copies in another library than their personal one within 3 years of receipt. Do not address any orders to the
Editors, but instead to the Mycotaxon Order Department, P.O. Box 264, Ithaca, NY 14851-0264 USA, or your
agent. Prices and availability of back volumes will be sent upon request to that Department, but are also posted on=
line at <www.mycotaxon.com>, or can be provided in an E-mail version on request to <rkorf@att.net>. Mycotax
may also be obtained on a journal-exchange basis. Proposals for such exchanges from journals, institutions, OF
individuals with difficulty in obtaining foreign currency should be addressed to the Order Department.
ie
ze
The annual subscription rate (four volumes) are:
USA Foreign (surface mail) Foreign (ISAL airmail) ¥, |
REGULAR (multi-user) $268 $276 $308 al
PERSONAL (individual) $128 $136 $168
(All back volumes are available at $35 each by surface mail, $55 each by air mail;
in the case of volume 1, the original printing of part I is provided, with parts 2 and 3 reprinted..)
(ISBN 0-930845-01-03), and Volumes 41-60 (ISBN 0-930845-07-02) are available (see descriptions at
<www.mycotaxon.com/books.html> and order there or through your local bookstore's listings under “Books ii
Print”). An online Cumulative Index to Taxa in Volumes 61-ff, and the Cumulative Author Index to Volumes 61 q
are posted at <www.mycotaxon.com>. oe
AVAILABILITY IN MICROFILM, PHOTOCOPY, & ELECTRONIC VERSIONS e
MYCOTAXON is also available in microfilm from Bell & Howell Information and Learning, P. O. Box 1346, Aga”
Arbor, MI 48106-1346, U.S.A., through their Microfilm Catalog <www.umi.com/sim>. Tear sheets or photoc
of individual articles may be obtained through The Genuine Article™, 1.S.1., 3501 Market Street, Philadelphia, F
19104, U.S.A., or through their website, <www.isinet.com>. Photocopies or electronic versions of individual
articles are available from Infotrieve, 1066 Le Conte Ave., Los Angeles, CA 90024, U.S.A. or through their website,
<www.infotrieve.com>. 4
CONTACTING MYCOTAXON'S EDITOR-IN-CHIEF BY E-MAIL OR FAX
To reach the Editor-in-Chief regarding manuscripts, you may E-mail to <editor@mycotaxon.com> or you may
to Pavel Lizon at (421-2) 5477-1948.
CONTACTING MYCOTAXON'S ORDER DEPARTMENT BY E-MAIL OR FAX
To reach the Order Department for information or placing orders, you may E-mail to <info@mycotaxon.com> OF
you may Fax to Orders, Mycotaxon, Ltd., May—October at (607) 273-4357, and November—April at (727) 321-1460." |
VISIT MYCOTAXON ON THE WORLD WIDE WEB AT <www.mycotaxon.com>
J
¥
'
ae | J
P45
Lp
'
) Af
y
uD
24
=
1
»
j
:
,
‘
i
f “i
=
Gye
#
Live Music
Archive
Librivox
Free Audio
Metropolitan Museum
Cleveland
Museum of Art
Internet
Arcade
Console Living Room
Open Library
American
Libraries
TV News
Understanding
9/11